Submitted:
18 April 2026
Posted:
20 April 2026
You are already at the latest version
Abstract
Potato (Solanum tuberosum L.) is a vital food security and cash crop in Eritrea, yet bacterial and fungal pathogens responsible for 15–30% yield losses remain molecularly uncharacterized across its production systems. Here, we present the first nationwide amplicon-based metagenomic survey of potato pathogen communities, sampling 81 farms across 14 sub-regions spanning four agroclimatic regions during July–August 2024. High-throughput amplicon sequencing targeting the bacterial 16S rRNA V3–V4 region and fungal ITS1–ITS2 loci revealed pronounced geographic heterogeneity in community composition and alpha diversity. Pseudomonas spp. were ubiquitous, with peak relative abundance of 19.5% in Dekemhare. Dominant fungi included Alternaria spp. (14% in Berik), Fusarium spp. (highest diversity 53.8% in Adi Kuala), Botrytis cinerea (37% in Adi Keih), and Rhizoctonia solani (44.4% in Adi Tekeliezan). Bacterial Shannon diversity averaged 5.67; fungal, 4.70. Weighted UniFrac PCoA accounted for 56.5% of bacterial community variance along PC1, confirming distinct geographic clustering. Critically, latent infections of Pseudomonas, Alternaria, Fusarium, and Colletotrichum were detected in every asymptomatic sample examined, demonstrating the inadequacy of visual-only disease surveillance. These findings establish the first molecular baseline for potato pathogen diversity in Eritrea, providing the empirical foundation for region-specific integrated disease management and evidence-based seed certification protocols.
Keywords:
1. Introduction
2. Materials and Methods
2.1. Study Areas and Sampling

2.2. Crude Sample Extraction
2.3. DNA Extraction
2.4. Library Preparation and Sequencing
2.5. Data Preprocessing and ASV Generation
2.6. Taxonomy Analysis and Community Diversity
3. Results
3.1. Sequencing and ASV Output
3.2. Geographic Distribution of Bacterial Pathogens
3.3. Geographic Distribution of Fungal Pathogens
3.4. Alpha Diversity Patterns Across Geographic Locations
3.5. Geographic Clustering of Pathogen Communities
3.6. Pathogen Detection in Asymptomatic Plants
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| ASV | Amplicon Sequence Variant |
| CTAB | Cetyltrimethylammonium bromide |
| DADA2 | Divisive Amplicon Denoising |
| ITS | Internal Transcribed Spacer |
| NAPHL | National Animal and Plant Health Laboratory |
| NARI | National Agricultural Research Institute |
| NCBI | National Center for Biotechnology Information |
| PAC | Powdered Activated Charcoal |
| PBS | Phosphate-Buffered Saline |
| PCoA | Principal Coordinates Analysis |
| PD | Phylogenetic Diversity |
| QIIME | Quantitative Insights Into Microbial Ecology |
| rRNA | Ribosomal Ribonucleic Acid |
| SRA | Sequence Read Archive |
| SDS | Sodium Dodecyl Sulfate |
| UPGMA | Unweighted Pair Group Method with Arithmetic Mean |
References
- Harahagazwe, D.; Condori, B.; Barreda, C.; Bararyenya, A.; Byarugaba, A.A.; Kude, D.A.; Lung’Aho, C.; Martinho, C.; Mbiri, D.; Nasona, B.; et al. How Big Is the Potato (Solanum Tuberosum L.) Yield Gap in Sub-Saharan Africa and Why? A Participatory Approach. Open Agric. 2018, 3, 180–189. [Google Scholar] [CrossRef]
- Villamor, D.E.V.; Ho, T.; Al Rwahnih, M.; Martin, R.R.; Tzanetakis, I.E. High Throughput Sequencing For Plant Virus Detection and Discovery. American Phytopathological Society 2019, 109, 716–725. [Google Scholar] [CrossRef] [PubMed]
- Bartola, M. Della; Byrne, S.; Mullins, E. Characterization of Potato Virus Y Isolates and Assessment of Nanopore Sequencing to Detect and Genotype Potato Viruses. Viruses 2020, 12. [Google Scholar] [CrossRef]
- Roossinck, M.J. Deep Sequencing for Discovery and Evolutionary Analysis of Plant Viruses. Virus Res. 2017, 239, 82–86. [Google Scholar] [CrossRef] [PubMed]
- Massart, S.; Olmos, A.; Jijakli, H.; Candresse, T. Current Impact and Future Directions of High Throughput Sequencing in Plant Virus Diagnostics. Virus Res. 2014, 188, 90–96. [Google Scholar] [CrossRef]
- Walters, W.; Hyde, E.R.; Berg-Lyons, D.; Ackermann, G.; Humphrey, G.; Parada, A.; Gilbert, J.A.; Jansson, J.K.; Caporaso, J.G.; Fuhrman, J.A.; et al. Improved Bacterial 16S RRNA Gene (V4 and V4-5) and Fungal Internal Transcribed Spacer Marker Gene Primers for Microbial Community Surveys. mSystems 2015, 1. [Google Scholar] [CrossRef] [PubMed]
- Muñoz-Ramírez, Z.Y.; González-Escobedo, R.; Avila-Quezada, G.D.; Ramírez-Sánchez, O.; Higareda-Alvear, V.M.; Zapata-Chávez, E.; Borrego-Loya, A.; Muñoz-Castellanos, L.N. Exploring Microbial Rhizosphere Communities in Asymptomatic and Symptomatic Apple Trees Using Amplicon Sequencing and Shotgun Metagenomics. Agronomy 2024, 14, 357. [Google Scholar] [CrossRef]
- YU, X.L.; HU, X.Y.; WANG, X.X.; ZHANG, X.Y.; DU, K.B. A Protocol Specialized for Microbial DNA Extraction from Living Poplar Wood. Not. Bot. Horti Agrobot. Cluj. Napoca. 2022, 50, 12822–12822. [Google Scholar] [CrossRef]
- Orn, B.; Lindahl, D.; Nilsson, R.H.; Tedersoo, L.; Abarenkov, K.; Carlsen, T.; Kjøller, R.; K~ Oljalg, U.; Pennanen, T.; Rosendahl, S.; et al. Methods Fungal Community Analysis by High-Throughput Sequencing of Amplified Markers-a User’s Guide. New Phytologist 2013, 199, 288–299. [Google Scholar] [CrossRef]
- Martin, M. Cutadapt Removes Adapter Sequences from High-Throughput Sequencing Reads. EMBnet. J. 2011, 17, 10–12. [Google Scholar] [CrossRef]
- Callahan, B.J.; McMurdie, P.J.; Rosen, M.J.; Han, A.W.; Johnson, A.J.A.; Holmes, S.P. DADA2: High-Resolution Sample Inference from Illumina Amplicon Data. Nature Methods 2016, 13(13), 581–583. [Google Scholar] [CrossRef]
- Caporaso, J.G.; Kuczynski, J.; Stombaugh, J.; Bittinger, K.; Bushman, F.D.; Costello, E.K.; Fierer, N.; Pẽa, A.G.; Goodrich, J.K.; Gordon, J.I.; et al. QIIME Allows Analysis of High-Throughput Community Sequencing Data. Nature Methods 2010, 7:5 7, 335–336. [Google Scholar] [CrossRef]
- Meno, L.; Abuley, I.; Seijo, M.C.; Escuredo, O. Management Strategies for Early Blight in Potatoes: Assessment of the TOMCAST Model, Including the Aerobiological Risk Level and Critical Phenological Period. Agriculture 2024, 14, 1414. [Google Scholar] [CrossRef]
- da Silva Silveira Duarte, H.; Zambolim, L.; Machado, F.J.; Pereira Porto, H.R.; Rodrigues, F.Á. Comparative Epidemiology of Late Blight and Early Blight of Potato under Different Environmental Conditions and Fungicide Application Programs. Semin. Cienc. Agrar. 2019, 40, 1805–1818. [Google Scholar] [CrossRef]
- Davies, T.J.; Pedersen, A.B. Phylogeny and Geography Predict Pathogen Community Similarity in Wild Primates and Humans. Proceedings of the Royal Society B: Biological Sciences 2008, 275, 1695. [Google Scholar] [CrossRef] [PubMed]
- Chaloner, T.M.; Gurr, S.J.; Bebber, D.P. Plant Pathogen Infection Risk Tracks Global Crop Yields under Climate Change. Nature Climate Change 2021, 11 11, 710–715. [Google Scholar] [CrossRef]
- Bebber, D.P.; Gurr, S.J. Crop-Destroying Fungal and Oomycete Pathogens Challenge Food Security. Fungal Genetics and Biology 2015, 74, 62–64. [Google Scholar] [CrossRef]
- Kiige, J.K.; Kavoo, A.M.; Mwajita, M.R.; Mogire, D.; Ogada, S.; Wekesa, T.B.; Kiirika, L.M. Metagenomic Characterization of Bacterial Abundance and Diversity in Potato Cyst Nematode Suppressive and Conducive Potato Rhizosphere. PLoS One 2025, 20. [Google Scholar] [CrossRef]
- Zhang, X.; Zhang, X. Genetic And Biological Characterization Of Bacterial Complexes Causing Potato Blackleg And Soft Rot. Electronic Theses and Dissertations 2025, 4131. [Google Scholar]
- Hameed, A.; Zeeshan, M.; Binyamin, R.; Alam, M.W.; Ali, S.; Zaheer, M.S.; Ali, H.; Riaz, M.W.; Ali, H.H.; Elshikh, M.S.; et al. Molecular Characterization of Pectobacterium Atrosepticum Infecting Potato and Its Management through Chemicals. PeerJ 2024, 12, e17518. [Google Scholar] [CrossRef]
- Tiwari, R.K.; Lal, M.K.; Kumar, R.; Sharma, S.; Sagar, V.; Kumar, A.; Singh, B.; Aggarwal, R. Impact of Fusarium Infection on Potato Quality, Starch Digestibility, In Vitro Glycemic Response, and Resistant Starch Content. Journal of Fungi 2023, 9, 466. [Google Scholar] [CrossRef]
- Charkowski, A.; Sharma, K.; Parker, M.L.; Secor, G.A.; Elphinstone, J. Bacterial Diseases of Potato. In The Potato Crop; Springer International Publishing: Cham, 2020; pp. 351–388. [Google Scholar]
- Wang, Z.; Luo, W.; Cheng, S.; Zhang, H.; Zong, J.; Zhang, Z. Ralstonia Solanacearum – A Soil Borne Hidden Enemy of Plants: Research Development in Management Strategies, Their Action Mechanism and Challenges. Front. Plant Sci. 2023, 14, 1141902. [Google Scholar] [CrossRef]
- Compant, S.; Samad, A.; Faist, H.; Sessitsch, A. A Review on the Plant Microbiome: Ecology, Functions, and Emerging Trends in Microbial Application. J. Adv. Res. 2019, 19, 29–37. [Google Scholar] [CrossRef]
- Trivedi, P.; Mattupalli, C.; Eversole, K.; Leach, J.E. Enabling Sustainable Agriculture through Understanding and Enhancement of Microbiomes. New Phytologist 2021, 230, 2129–2147. [Google Scholar] [CrossRef]
- Borza, T.; Lumactud, R.A.; Shim, S.Y.; Al-Mughrabi, K.; Prithiviraj, B. Microbial Community Composition Associated with Potato Plants Displaying Early Dying Syndrome. Microorganisms 2025, 13, 1482. [Google Scholar] [CrossRef] [PubMed]
- Zimudzi, J.; van der Waals, J.E.; Coutinho, T.A.; Cowan, D.A.; Valverde, A. Temporal Shifts of Fungal Communities in the Rhizosphere and on Tubers in Potato Fields. Fungal Biol. 2018, 122, 928–934. [Google Scholar] [CrossRef] [PubMed]
- Hardoim, P.R.; van Overbeek, L.S.; Berg, G.; Pirttilä, A.M.; Compant, S.; Campisano, A.; Döring, M.; Sessitsch, A. The Hidden World within Plants: Ecological and Evolutionary Considerations for Defining Functioning of Microbial Endophytes. Microbiology and Molecular Biology Reviews 2015, 79, 293–320. [Google Scholar] [CrossRef] [PubMed]
- Bak, G.R.; Lee, K.K.; Clark, I.M.; Mauchline, T.H.; Kavamura, V.N.; Jee, S.; Lee, J.T.; Kim, H.; Lee, Y.H. Changes in the Potato Rhizosphere Microbiota Richness and Diversity Occur in a Growth Stage-Dependent Manner. Sci. Rep. 2025, 15, 2284. [Google Scholar] [CrossRef]
- Liu, X.; Zhang, J.; Gu, T.; Zhang, W.; Shen, Q.; Yin, S.; Qiu, H. Microbial Community Diversities and Taxa Abundances in Soils along a Seven-Year Gradient of Potato Monoculture Using High Throughput Pyrosequencing Approach. PLoS One 2014, 9. [Google Scholar] [CrossRef]
- Li, Z.; Zhu, J.; Shi, T.; Gao, C.; Qiu, X.; Bao, M.; Li, Y.; Bi, Z.; Yao, P.; Sun, C.; et al. Microbial Community Restructuring under Crop Rotation: A Sustainable Strategy to Counteract Potato Monoculture-Induced Soil Degradation in Arid Ecosystems. Agric. Ecosyst. Environ. 2026, 400, 110245. [Google Scholar] [CrossRef]
- Charkowski, A.O. The Changing Face of Bacterial Soft-Rot Diseases. Annu. Rev. Phytopathol. 2018, 56, 269–288. [Google Scholar] [CrossRef] [PubMed]
- Imam, N.; Belda, I.; García-Jiménez, B.; Duehl, A.J.; Doroghazi, J.R.; Almonacid, D.E.; Thomas, V.P.; Acedo, A. Local Network Properties of Soil and Rhizosphere Microbial Communities in Potato Plantations Treated with a Biological Product Are Important Predictors of Crop Yield. mSphere 2021, 6. [Google Scholar] [CrossRef] [PubMed]






| Type | Read Type | Sequence |
| Nextera kit adapters for both 16S and ITS amplicon sequencing | Forward adapter | CTGTCTCTTATACACATCTCCGAGCCCACGAGAC |
| Reverse adapter | CTGTCTCTTATACACATCTGACGCTGCCGACGA | |
| 16S V3-V4 Primers | Forward primer | CCTACGGGNGGCWGCAG |
| Reverse primer | GACTACHVGGGTATCTAATCC | |
| ITS1-ITS2 Primers | Forward primer | CTTGGTCATTTAGAGGAAGTAA |
| Reverse primer | GCTGCGTTCTTCATCGATGC |
|
Sub region |
Bacterial | Fungal | ||||||
| Shannon | Gini-Simpson | PD whole tree | ASV | Shannon | Gini-Simpson | PD whole tree | ASV | |
| Dubarwa | 6.62 | 0.97 | 38.21 | 499 | 4.52 | 0.89 | 28.09 | 168 |
| Mendefera | 6.59 | 0.97 | 34.00 | 463 | 5.49 | 0.97 | 26.21 | 85 |
| Emni Haili | 7.05 | 0.99 | 36.13 | 517 | 4.29 | 0.89 | 28.85 | 84 |
| Adi Kuala | 6.12 | 0.96 | 28.37 | 391 | 3.36 | 0.79 | 26.27 | 119 |
| Senafe | 5.57 | 0.93 | 37.75 | 411 | 5.00 | 0.90 | 35.49 | 199 |
| Adi Keih | 6.91 | 0.98 | 34.88 | 531 | 4.36 | 0.84 | 31.78 | 208 |
| Segeneiti | 6.05 | 0.97 | 27.73 | 365 | 4.54 | 0.92 | 28.47 | 134 |
| Dekemhare | 5.94 | 0.95 | 23.16 | 313 | 4.68 | 0.93 | 30.53 | 168 |
| Gala Nefhi | 6.66 | 0.98 | 24.65 | 391 | 4.98 | 0.92 | 35.56 | 230 |
| Serejeka | 5.08 | 0.82 | 36.07 | 536 | 5.41 | 0.96 | 40.09 | 266 |
| Berik | 5.89 | 0.91 | 40.43 | 519 | 4.75 | 0.92 | 33.27 | 197 |
| Adi Tekeliezan | 6.73 | 0.98 | 24.65 | 390 | 4.37 | 0.90 | 28.02 | 174 |
| Asmara | 3.64 | 0.72 | 23.69 | 280 | 4.34 | 0.89 | 25.63 | 150 |
| Logo Anseba | 3.23 | 0.64 | 31.98 | 349 | 5.31 | 0.96 | 24.36 | 168 |
| Asy Dubarwa | 3.44 | 0.82 | 12.17 | 119 | 3.85 | 0.86 | 22.71 | 142 |
| Asy Adi Keih | 3.12 | 0.82 | 14.79 | 121 | 4.34 | 0.92 | 26.35 | 136 |
| Asy Gala Nefhi | 3.16 | 0.66 | 22.45 | 195 | 4.18 | 0.88 | 30.24 | 171 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).