Submitted:
07 April 2026
Posted:
08 April 2026
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Materials and Methods
2.1. Tissue Sample Collection and Low-Salt Stress
2.2. RNA Extraction, cDNA Synthesis, mRNA, miRNA and LncRNA Expression
2.3. Culture of Sea Cucumber Coelomocytes
2.4. miRNAs, lncRNA and Targeted Gene Overexpression and Knockdown Experiments in Sea Cucumber Coelomocytes
2.5. Statistical Analysis
3. Results
3.1. Identification of miR-novel-91 and Target Gene NIPA2
3.2. Expression Profiles of miR-novel-91, lncRNA011760 and NIPA2 Under Salinity Stress
3.3. Validation of the miR-novel-91/NIPA2 Regulatory Axis In Vivo
3.4. Validation of the miR-novel-91/NIPA2 Regulatory Axis In Vitro
3.5. Proposed Mechanism of Salinity Response via the lncRNA011760/miR-novel-91/NIPA2 Axis and Small Molecule Pathway
4. Discussion
4.1. The miR-novel-91/NIPA2 Regulatory Axis in Salinity Stress
4.2. Physiological Implications of Metabolic Modulation in Salinity Adaptation
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Allan, R.P.; Barlow, M.; Byrne, M.P.; Cherchi, A.; Douville, H.; Fowler, H.J.; Gan, T.Y.; Pendergrass, A.G.; Rosenfeld, D.; Swann, A.L.S.; et al. Advances in Understanding Large-Scale Responses of the Water Cycle to Climate Change. Annals of the New York Academy of Sciences 2020, 1472, 49–75. [CrossRef] [PubMed]
- Röthig, T.; Trevathan-Tackett, S.M.; Voolstra, C.R.; Ross, C.; Chaffron, S.; Durack, P.J.; Warmuth, L.M.; Sweet, M. Human-Induced Salinity Changes Impact Marine Organisms and Ecosystems. Global Change Biology 2023, 29, 4731–4749. [CrossRef] [PubMed]
- Hu, M.; Li, Q.; Li, L. Effect of Salinity and Temperature on Salinity Tolerance of the Sea Cucumber Apostichopus Japonicus. Fish Sci 2010, 76, 267–273. [CrossRef]
- Meng, X.; Dong, Y.; Dong, S.; Yu, S.; Zhou, X. Mortality of the Sea Cucumber, Apostichopus Japonicus Selenka, Exposed to Acute Salinity Decrease and Related Physiological Responses: Osmoregulation and Heat Shock Protein Expression. Aquaculture 2011, 316, 88–92. [CrossRef]
- Li, L.; Li, Q.; Sun, X.; Kong, L. Effects of Temperature and Salinity on Larval Growth, Survival, and Development of the Sea Cucumber Apostichopus Japonicus. North American Journal of Aquaculture 2011, 73, 296–303. [CrossRef]
- Wang, F.; Yang, H.; Gao, F.; Liu, G. Effects of Acute Temperature or Salinity Stress on the Immune Response in Sea Cucumber, Apostichopus Japonicus. Comparative Biochemistry and Physiology Part A: Molecular & Integrative Physiology 2008, 151, 491–498. [CrossRef]
- Yuan, X.; Yang, H.; Wang, L.; Zhou, Y.; Gabr, H.R. Effects of Salinity on Energy Budget in Pond-Cultured Sea Cucumber Apostichopus Japonicus (Selenka) (Echinodermata: Holothuroidea). Aquaculture 2010, 306, 348–351. [CrossRef]
- Mei, Y.; Xu, Y.; Gao, Q.; Li, Z.; Dong, S. Effects of Temperature and Salinity on CO2 Fluxes Dynamics and Respiration Metabolism in the Sea Cucumber Apostichopus Japonicus (Selenka). Marine Pollution Bulletin 2025, 215, 117928. [CrossRef]
- Brusca, R.C.; Brusca., G.J. Invertebrates; Sinauer Associates, Sunderland, Massachusetts., 2004; 53; ISBN ISBN 0–87893–097–3.
- Binyon, J. Physiology of Echinoderms; Elsevier, 1972; ISBN 978-0-08-016991-0.
- Willmer, P.; Stone, G.; Johnston, I.A. Environmental Physiology of Animals; 2nd ed.; Blackwell Pub: Malden, Mass, 2004; ISBN 978-1-4051-0724-2.
- Diehl, W.J. Osmoregulation in Echinoderms. Comparative Biochemistry and Physiology Part A: Physiology 1986, 84, 199–205. [CrossRef]
- Vidolin, D.; Gouvea, I.A.S.; Freire, C.A. Estabilidade Osmótica Dos Fluídos Celômicos de Um Pepino Do Mar (Holothuria Grisea) e de Uma Estrela-Do-Mar (Asterina Stellifera) (Echinodermata) Expostos Ao Ar Durante a Maré Baixa: Um Estudo de Campo. ABPar 2002, 31. [CrossRef]
- Castellano, G.C.; Souza, M.M.; Freire, C.A. Volume Regulation of Intestinal Cells of Echinoderms: Putative Role of Ion Transporters Na+/K+-ATPase and NKCC). Comp Biochem Physiol A Mol Integr Physiol 2016, 201, 124–131. [CrossRef] [PubMed]
- Fankboner, P.V. Seasonal Visceral Atrophy and Response to Salinity by Parastichopus Californicus (Stimpson): Osmoregulation? 2002, Bull.17.
- Barrett, N.J.; Harper, E.M.; Last, K.S.; Reinardy, H.C.; Peck, L.S. Behavioural and Physiological Impacts of Low Salinity on the Sea Urchin Echinus Esculentus. Journal of Experimental Biology 2024, 227, jeb246707. [CrossRef]
- Dong, Y.; Dong, S.; Meng, X. Effects of Thermal and Osmotic Stress on Growth, Osmoregulation and Hsp70 in Sea Cucumber (Apostichopus Japonicus Selenka). Aquaculture 2008, 276, 179–186. [CrossRef]
- Huang, L.; Zhong, S.; Pan, C.; Mo, H.; Pan, Z.; Huang, G.; Mi, S.; Gao, C.; Liu, Y. Effects of Acute Salinity Stress on Physiology and Immunoenzymatic Activity in Juvenile Sea Cucumber, Stichopus Monotuberculatus. Aquaculture 2024, 578, 740094. [CrossRef]
- Russell, M.P. Echinoderm Responses to Variation in Salinity. Adv Mar Biol 2013, 66, 171–212. [CrossRef]
- Jiang, J.; Tang, Y.; Cao, Z.; Zhou, C.; Yu, Z. Effects of Hypo-Osmotic Stress on Osmoregulation, Antioxidant Response, and Energy Metabolism in Sea Cucumber Holothuria Moebii under Desalination Environment. Environmental Research 2024, 252, 118800. [CrossRef]
- Podbielski, I.; Hiebenthal, C.; Hajati, M.-C.; Bock, C.; Bleich, M.; Melzner, F. Capacity for Cellular Osmoregulation Defines Critical Salinity of Marine Invertebrates at Low Salinity. Front. Mar. Sci. 2022, 9. [CrossRef]
- Esteller, M. Non-Coding RNAs in Human Disease. Nat Rev Genet 2011, 12, 861–874. [CrossRef]
- Zheng J.; Zhang G.; Ren L. Advances in miRNA research: Unraveling the complexities of gene regulation. Animal Models and Experimental Medicine 2025, 8, 1741–1759. [CrossRef] [PubMed]
- Zhang, S.; Shao, Y.; Li, C. Characterization of Host lncRNAs in Response to Vibrio Splendidus Infection and Function as Efficient miRNA Sponges in Sea Cucumber Front. Immunol. 2021, 12, 792040. [CrossRef]
- Shang, Y.; Tian, Y.; Wang, Y.; Guo, R. Novel lncRNA lncRNA001074 Participates in the Low Salinity-Induced Response in the Sea Cucumber Apostichopus Japonicus by Targeting the Let-7/NKAα Axis. Cell Stress and Chaperones 2021, 26, 785–798. [CrossRef] [PubMed]
- Wei, X.; Chen, J.; Zhao, Y.; Li, N.; Wang, N.; Xu, T.; Yang, Y.; Chang, Y.; Tian, Y. A ceRNA Network Mediates Salinity Adaptation Via miR-Novel-3-LNC_015168-SLC17A9 Axis in Sea Cucumber. Mar Biotechnol 2026, 28, 21. [CrossRef] [PubMed]
- Goytain, A.; Quamme, G.A. Identification and Characterization of a Novel Mammalian Mg2+ Transporter with Channel-like Properties. BMC Genomics 2005, 6, 48. [CrossRef]
- Zhou, H.; Clapham, D.E. Mammalian MagT1 and TUSC3 Are Required for Cellular Magnesium Uptake and Vertebrate Embryonic Development. Proc. Natl. Acad. Sci. U.S.A. 2009, 106, 15750–15755. [CrossRef]
- Brandao, K.; Deason-Towne, F.; Perraud, A.-L.; Schmitz, C. The Role of Mg2+ in Immune Cells. Immunol Res 2013, 55, 261–269. [CrossRef] [PubMed]
- Sahni, J.; Nelson, B.; Scharenberg, A.M. SLC41A2 Encodes a Plasma-Membrane Mg2+ Transporter. Biochem J 2007, 401, 505–513. [CrossRef]
- Zsurka, G.; Gregán, J.; Schweyen, R.J. The Human Mitochondrial Mrs2 Protein Functionally Substitutes for Its Yeast Homologue, a Candidate Magnesium Transporter. Genomics 2001, 72, 158–168. [CrossRef] [PubMed]
- Schmitz, C.; Deason, F.; Perraud, A.-L. Molecular Components of Vertebrate Mg2+-Homeostasis Regulation. Magnes Res 2007, 20, 6–18.
- Goytain, A.; Quamme, G.A. Identification and Characterization of a Novel Family of Membrane Magnesium Transporters, MMgT1 and MMgT2. Am J Physiol Cell Physiol 2008, 294, C495-502. [CrossRef]
- Goytain, A.; Hines, R.M.; Quamme, G.A. Functional Characterization of NIPA2, a Selective Mg2+ Transporter. Am J Physiol Cell Physiol 2008, 295, C944-953. [CrossRef]
- Simms, D.; Chomczynski, P. TRIzolTM: A New Reagent for Optimal Single-Step Isolation of RNA. Focus (San Francisco, Calif.) 1992, 15.
- Tian, Y.; Shang, Y.; Guo, R.; Chang, Y.; Jiang, Y. Salinity Stress-Induced Differentially Expressed miRNAs and Target Genes in Sea Cucumbers Apostichopus Japonicus. Cell Stress and Chaperones 2019, 24, 719–733. [CrossRef]
- Ali, S.A.; Peffers, M.J.; Ormseth, M.J.; Jurisica, I.; Kapoor, M. The Non-Coding RNA Interactome in Joint Health and Disease. Nat Rev Rheumatol 2021, 17, 692–705. [CrossRef]
- Liu, N.; Xie, H.; Xiang-wei, W.; Gao, K.; Wang, T.; Jiang, Y. The Absence of NIPA2 Enhances Neural Excitability through BK (Big Potassium) Channels. CNS Neurosci Ther 2019, 25, 865–875. [CrossRef]
- Zhao, W.; Zhang, W.-L.; Yang, B.; Sun, J.; Yang, M.-W. NIPA2 Regulates Osteoblast Function via Its Effect on Apoptosis Pathways in Type 2 Diabetes Osteoporosis. Biochemical and Biophysical Research Communications 2019, 513, 883–890. [CrossRef]
- Zhao, W.; Zhang, W.; Ma, H.; Yang, M. NIPA2 Regulates Osteoblast Function by Modulating Mitophagy in Type 2 Diabetes Osteoporosis. Sci Rep 2020, 10, 3078. [CrossRef]
- Xie, H.; Zhang, Y.; Zhang, P.; Wang, J.; Wu, Y.; Wu, X.; Netoff, T.; Jiang, Y. Functional Study of NIPA2 Mutations Identified from the Patients with Childhood Absence Epilepsy. PLoS ONE 2014, 9, e109749. [CrossRef]
- Yamanaka, R.; Tabata, S.; Shindo, Y.; Hotta, K.; Suzuki, K.; Soga, T.; Oka, K. Mitochondrial Mg2+ Homeostasis Decides Cellular Energy Metabolism and Vulnerability to Stress. Sci Rep 2016, 6, 30027. [CrossRef] [PubMed]
- Camilli, A.; Bassler, B.L. Bacterial Small-Molecule Signaling Pathways. Science 2006, 311, 1113–1116. [CrossRef] [PubMed]
- Madrid, E.; Zanders, I.P.; Herrera, F.C. Changes in Coelomic Fluid and Intracellular Ionic Composition in Holothurians Exposed to Diverse Sea Water Concentrations. Comparative Biochemistry and Physiology Part A: Physiology 1976, 54, 167–174. [CrossRef]
- Castellano, G.C.; Santos, I.A.; Freire, C.A. Maintenance of Ionic Gradients and Tissue Hydration in the Intertidal Sea Cucumber Holothuria Grisea under Hypo- and Hyper-Salinity Challenges. Journal of the Marine Biological Association of the United Kingdom 2018, 98, 325–332. [CrossRef]
- Quamme, G.A. Molecular Identification of Ancient and Modern Mammalian Magnesium Transporters. American Journal of Physiology-Cell Physiology 2010, 298, C407–C429. [CrossRef]
- Geng, C.; Tian, Y.; Shang, Y.; Wang, L.; Jiang, Y.; Chang, Y. Effect of Acute Salinity Stress on Ion Homeostasis, Na+/K+-ATPase and Histological Structure in Sea Cucumber Apostichopus Japonicus. SpringerPlus 2016, 5, 1977. [CrossRef]
- Goytain, A.; Hines, R.M.; El-Husseini, A.; Quamme, G.A. NIPA1(SPG6), the Basis for Autosomal Dominant Form of Hereditary Spastic Paraplegia, Encodes a Functional Mg2+ Transporter. Journal of Biological Chemistry 2007, 282, 8060–8068. [CrossRef]
- Rabanal-Ruiz, Y.; Otten, E.G.; Korolchuk, V.I. mTORC1 as the Main Gateway to Autophagy. Essays Biochem 2017, 61, 565–584. [CrossRef] [PubMed]
- Carroll, B.; Korolchuk, V.I.; Sarkar, S. Amino Acids and Autophagy: Cross-Talk and Co-Operation to Control Cellular Homeostasis. Amino Acids 2015, 47, 2065–2088. [CrossRef] [PubMed]





| Categroy | Sequences name | Sequence (5′-3′) |
| qRT-PCR Primers | NIPA2-F | CTGACCTGCCTTCCGTGAGTAAG |
| NIPA2-R | TGGCTGCTCTCCTCCTCTGAC | |
| miR-novel-91 | CATGTGACCGTTACAATGGGCG | |
| lncRNA011760-F | GGAGAGCCTAGATTATGATACCGTTAC | |
| lncRNA011760-R | TTCACCACTAATCGTTCCACCAAG | |
| Cytb-F | TGAGCCGCAACAGTAATC | |
| Cytb-R | AAGGGAAAAGGAAGTGAAAG | |
| U6 | ACGCAAATTCGTGAAGCGTT | |
| Functional oligonucletides | Negative Control | UUGUACUACACAAAAGUACUG |
| GUACUUUUGUGUAGUACAAUU | ||
| miR-novel-91 agomir/minics | AUGUGACCGUUACAAUGGGCG | |
| CCCAUUGUAACGGUCACAUUU | ||
| si-NIPA2 | GCGAUAUCUACAAGAAACUTT | |
| AGUUUCUUGUAGAUAUCGCTT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).