Preprint
Article

This version is not peer-reviewed.

The lncRNA011760/miR-novel-91/NIPA2 ceRNA Network Regulates Salinity Stress Response in Sea Cucumber (Apostichopus japonicus)

Submitted:

07 April 2026

Posted:

08 April 2026

You are already at the latest version

Abstract
Abstract Low-salinity stress poses a critical constraint on the commercial aquaculture and survival of the sea cucumber (Apostichopus japonicus). This study investigated the regulatory network involving lncRNA011760, miR-novel-91, and their target gene NIPA2 in response to salinity fluctuations. Using integrated in vivo and in vitro functional assays, we demonstrate that lncRNA011760 acts as a competitive endogenous RNA (ceRNA) to sponge miR-novel-91, thereby alleviating the post-transcriptional repression of NIPA2. Based on these molecular dynamics, we propose a novel inhibition-adaptation-survival three-stage model. Initially (0–3h), acute NIPA2 upregulation enhances Mg²⁺ transport efficiency to mitigate osmotic shock. During the mid-stage (3–24 h), miR-novel-91-mediated NIPA2 suppression creates a transient biosynthetic window, facilitating a shift from passive tolerance to active metabolic adaptation. Ultimately (24–48 h), lncRNA-driven NIPA2 restoration sustains Mg²⁺ homeostasis, allowing the organism to enter a low-metabolism survival mode. These stage-specific shifts reflect the inherent physiological strategies of sea cucumbers as osmoconformers. Our findings elucidate the complex epigenetic orchestration of osmotic stress tolerance and highlight the lncRNA011760/miR-novel-91/NIPA2 axis as a promising molecular target for the marker-assisted breeding of salt-tolerant strains.
Keywords: 
;  ;  ;  

1. Introduction

The sea cucumber (Apostichopus japonicus) is an important marine aquaculture species in East Asia. The growing market demand has made the sustainable farming of sea cucumbers particularly important. However, intensifying global climate change and human activities have led to significant fluctuations in coastal salinity, posing a serious threat to the sustainable production of sea cucumbers [1,2]. As stenohaline invertebrates, sea cucumbers lack specialized osmoregulatory organs and are strictly confined to a narrow salinity range and are highly sensitive to changes in the salinity of their surrounding environment[3,4,5]. Consequently, hypoosmotic shock leads to a rapid disruption of intracellular osmotic equilibrium, triggering physiological dysfunctions, suppressed metabolic activity, and high mortality rates in aquaculture systems [6,7,8].
As an osmo-conforming marine invertebrate, sea cucumbers are considered to be strictly marine animals confined to a narrow salinity range [9] because sea cucumbers lack specialized osmoregulatory organs, rendering them particularly susceptible to salinity changes [10,11]. To overcome these challenges, sea cucumbers and other echinoderms have evolved a range of strategies to enhance their adaptability. According to Binyon (1972) and Diehl (1986), sea cucumbers exhibit hypo-osmotic regulatory mechanisms at low salinity and hyperosmotic regulatory strategies at high salinity [10,12]. Gray sea cucumber (Holothuria grisea) showed obvious protective behaviors: temporally regulate the osmotic pressure of its coelomic fluids by possibly contracting ambulacral feet and oral tentacles to reduce body wall permeability and slow coelomic fluid flow [13,14]. In extreme cases, sea cucumbers may discharge their intestines to adapt to salinity changes in the environment [15]. Adult Echinus esculentus can acclimate to decreased salinity, thereby increasing their resistance to subsequent hypo-osmotic stress, yet their capacity for acute tolerance is restricted [16]. Physiologically, they rely on cellular-level adjustments, primarily the active regulation of osmotic pressure through ion transport mechanisms [14,17,18]. Hypo-salinity stress induced an increase in the activity of Na⁺/K⁺-ATPase activity and antioxidant enzymes to mitigate oxidative damage from osmotic stress [19]. Inorganic ions, amino acids, nucleotides, and their derivatives play crucial osmoregulatory roles in sea cucumbers under hypo-osmotic [20]. In a sea star and two sea urchin species (Asterias rubens, Psammechinus milliaris, and Strongylocentrotus droebachiensis) could utilize various combinations of FAAs to maintain osmotic equilibrium [21]. While these physiological and metabolic responses are documented, the upstream molecular networks—specifically the epigenetic mechanisms orchestrating these complex processes—remain largely elusive.
Recent research has highlighted non-coding RNAs (ncRNAs), such as microRNAs (miRNAs) and long non-coding RNAs (lncRNAs), as master regulators of gene expression under environmental stress [22,23]. Specifically, lncRNAs can function as competitive endogenous RNAs (ceRNAs), acting as molecular sponges to sequester miRNAs and thereby alleviating the post-transcriptional repression of target mRNAs [24]. Transcriptomic studies have found that lncRNA001074 acts as a ceRNA and can regulate the expression of the Na+/K+-ATPaseαsubunit (NKAα) under low-salt stress through let-7[25]. The over-expression of miR-novel-3 suppressed SLC17a9, whereas lncRNA015168 acted as a competitive endogenous RNA (ceRNA) to sequester miR-novel-3 to deal with salinity stress [26]. The emphasized the critical role of ncRNA networks in maintaining ionic gradients. However, the specific ceRNA axes governing small-molecule metabolic pathways and cation transport during salinity adaptation have not been fully characterized.
Among the various cations, Mg2+ is the second most abundant cation in cells, present in high concentrations and tightly regulated within cells, playing an important role in biochemical functions, particularly those involving ATP hydrolysis [27,28]. In vertebrates, Mg²⁺ homeostasis is tightly controlled by a diverse array of transporters, including MAGT1, MRS2, and the SLC41 family [29]. Magnesium transporter protein 1 (MAGT1) is upregulated by low Mg2+ concentrations and is an essential protein in Mg2+ uptake into cells [27,28]. The SLC41A1 and SLC41A2 encode magnesium transport proteins 1 and 2 respectively (MagT1 and MagT2), which both mediate the uptake of Mg2+ into cells [27,30]. MAGT1 and SLC41 families mediate generalized cellular uptake. Magnesium transporter MRS2 homolog, mitochondrial (MRS2) mediates the influx of Mg2+ into the mitochondrial matrix [31]. TRPM6 along with its close relative TRPM7 may play an important role in regulating Mg2+ homeostasis in vertebrates[32]. Membrane magnesium transporter 1 (MMGT1) mediates the uptake of Mg2+ across the Golgi membrane [33]. NIPA2 (Non-imprinted in Prader-Willi syndrome region gene 2) has emerged as a highly selective Mg²⁺ transporter localized in the plasma membrane and early endosomes [34]. Given that seawater Mg²⁺ concentrations correlate linearly with salinity, dynamic changes in environmental osmotic pressure directly impact the intracellular demand for Mg²⁺ to sustain metabolic flux. However, whether NIPA2 is integrated into a ceRNA regulatory network to facilitate the active salinity adaptation of echinoderms remains entirely unknown.
Based on previous high-throughput transcriptome screening under simulated low-salinity stress (18 psu) and the evolutionary conservation of the ceRNA mechanism, we hypothesized that the lncRNA011760/miR-novel-91/NIPA2 axis acts as a critical molecular switch mediating salinity adaptation in A. japonicus by orchestrating Mg²⁺ homeostasis and associated metabolic pathways. To test this, we employed quantitative real-time PCR (qRT-PCR) and rigorous in vivo and in vitro functional validations (including agomirs, mimics, and siRNA interference). Our objectives were to verify the regulatory interaction within the lncRNA011760/miR-novel-91/NIPA2 axis; to elucidate the temporal dynamics of this axis during salinity stress; and to propose a mechanistic model linking molecular oscillations to physiological survival. This work provides a theoretical foundation for the molecular mechanisms of stress tolerance in echinoderms and identifies potential molecular biomarkers for the marker-assisted breeding of salt-tolerant sea cucumber varieties.

2. Materials and Methods

2.1. Tissue Sample Collection and Low-Salt Stress

The experiment was conducted at the Key Laboratory of Marine Aquaculture and Stock Enhancement in the Northern Seas of the Ministry of Agriculture and Rural Affairs, Dalian Ocean University. The animal research was approved by the Institutional Animal Care and Use Committee (IACUC) of Dalian Ocean University (Approval No.: DOU-IACUC-2023-0901). All experiments were conducted in accordance with the Guidelines for the Management and Use of Laboratory Animals of the Chinese Academy of Fishery Sciences and local regulations. Healthy sea cucumbers (average weight 20.2 g ± 1.1 g) were collected from a commercial farm in Liaoning Province, China. Before the experiment, the sea cucumbers were acclimated for 14 days under controlled conditions in 1000-liter fiberglass tanks (30 individuals per tank):the temperature was 16-18℃, the pH is 7.8-8.0, and the dissolved oxygen is 5.0-6.0 mg/L (measured using the YSI ProODO® multiparameter meter, Yellow Springs Instruments, USA). Sediment (sieved to remove debris) was replaced every two weeks, and a customized diet plan (60% Sargassum thunbergii, 40% sea mud) was provided daily at 3–5% of body weight.
After acclimation, sea cucumbers were randomly distributed to the control and experimental groups with three replicate groups (n=3 tanks/group, with 30 sea cucumbers per tank). For salinity challenge, the seawater salinity was gradually reduced from 30 PSU (control) to 18 PSU within 24 hours using deionized water to minimize osmotic shock. Control groups were maintained at 30 PSU throughout the experiment. Five experimental subgroups were established to verify the function under 18 PSU stress: negative control (NC) group (transfected with non-targeting oligonucleotides); miR-novel-91 agomir-transfected group; miR-novel-91 mimics-transfected group; si-NIPA2-transfected group; lncRNA011760 mimics-transfected group. Transfection was carried out 24h before salinity stress by intraperitoneal injection (50 µL per individual). Sea cucumber samples were randomly collected at six time points after salinity stress (1.5, 3, 6, 12, 24, and 48h), with 3 individuals per group at each time point. Coelomic fluid was extracted by puncturing the coelom with a syringe, centrifuged at 3000 × g for 5 minutes at 4 °C, and then the supernatant was immediately frozen in liquid nitrogen and stored at -80 °C for subsequent RNA extraction and sequencing. The entire experimental design used in this study was shown in Figure 1.

2.2. RNA Extraction, cDNA Synthesis, mRNA, miRNA and LncRNA Expression

Total RNA was extracted from body cavity fluid samples using TRIzol® Reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions [35]. The purity and integrity of the RNA were assessed using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, USA) and 1.5% agarose gel electrophoresis, respectively. miRNA-specific cDNA was synthesized using the miRcute Plus miRNA First-Strand Kit (Sangon Biotech, Shanghai). The 20 μL reaction system contained 100 ng of total RNA, 10 μL of 2× miRNA P-RT Solution mix, 2 μL of miRNA P-RT Enzyme mix, and nuclease-free water to reach the final volume. The reaction was carried out at 37 °C for 60 minutes, followed by incubation at 85 °C for 5 minutes. The first-strand synthesis of lncRNA cDNA was performed using the lnRcute lncRNA cDNA First-Strand Synthesis Kit (Degenmol, Tiangen Company). The preparation and handling of the reaction system were as follows: 100 ng of RNA, 2 μL of 5× gDNA Buffer, and RNase-free water were added in a 10 μL volume. The mixture is combined and incubated at 42 °C for 3 minutes, then placed on ice. Into the mixture, 2 μL of 10× lnR RT Buffer, 1 μL of lnR RT Enzyme mix, 2 μL of lnR-RT Primer mix, and RNase-free water were added to reach a final volume of 20 μL. The reaction mixture is incubated at 42 °C for 15 minutes, then at 95 °C for 3 minutes, and stored at 80 °C in preparation for subsequent experiments.
The qRT-PCR was performed using the LightCycler® 96 (Roche Diagnostics, Basel, Switzerland) with 2×SG Fast qPCR Master Mix (Sangon Biotech, Shanghai, China). The 20 µL reaction system consisted of 10 µL of 2×SG Fast qPCR Master Mix, 1.0 µL of cDNA template, 0.4 µL of each primer (10 mmol/L), and nuclease-free water to a final volume. The reaction program was as follows: pre-denaturation at 95 °C for 30 seconds; 55 cycles of denaturation at 95 °C for 3 seconds and annealing at 60 °C for 30 seconds. All reactions were performed with three technical replicates and three biological replicates, with Cytb and RNU6B serving as reference genes for mRNA and miRNA/lncRNA, respectively[25,36]. All primers were designed using Primer 5.0 software and synthesized by Sangon Biotech (Shanghai, China) (Table 1). Each sample was analyzed in three technical replicates and three biological replicates. Relative expression levels were calculated using the 2⁻ΔΔCt method.

2.3. Culture of Sea Cucumber Coelomocytes

Collected 1 mL of coelomic fluid from healthy sea cucumbers and mix it 1:1 with ice-cold anticoagulant solution, centrifuged at 1000 × g for 5 minutes at 4 °C (Eppendorf 5810R centrifuge, Hamburg, Germany), then washed twice with isotonic buffer (Leibovitz’s L-15 medium supplemented with 10% fetal bovine serum, 100 U/mL penicillin, and 100 μg/mL streptomycin). Resuspend the coelomic cells in Leibovitz ‘s L-15 medium, adjusting the cell density to 6 × 10⁵ cells/mL. Dispensed 500 μL of the cell suspension (6 × 10⁵ cells per well) into 24-well culture plates. Cultured in the dark under humid conditions at 16 °C with 5% CO₂. After 24 hours of culture, washed the adherent coelomic cells twice with ice-cold PBS (pH 7.4) and collected them by centrifugation at 1000g for 5 minutes for transfection.

2.4. miRNAs, lncRNA and Targeted Gene Overexpression and Knockdown Experiments in Sea Cucumber Coelomocytes

Selected miR-novel-91, lncRNA011760, and their target gene NIPA2 for functional validation through overexpression (agomir) and inhibition (antagomir) to elucidate their roles in salinity stress response. Used Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions, transfected 30 pmol miR-novel-15 agomir/mimic, si-NIPA2, lncRNA011760 mimics, or the corresponding negative controls into adherent co-cultured cells. In short, diluted the oligonucleotides and Lipofectamine 2000 in 50 μL of serum-free L-15 medium, mixed and incubated at room temperature for 20 minutes. Then added the transfection mixture to each culture well and continued incubating the cells for 24 hours. After transfection, exposed the cells to low salinity stress (18 PSU), diluting seawater with deionized water, and collected samples at 6, 24, and 48 hours post-stress for RNA extraction and qRT-PCR analysis.

2.5. Statistical Analysis

All data are presented as mean ± standard deviation (SD). The statistical differences in the temperature and spatial expression of miR-novel-91, NIPA2, and lncRNA011760 were analyzed using one-way ANOVA (post-test using LSD) tested in SPSS software (version 22.0). A significance level of P<0.05 was set. Graphs were generated using GraphPad Prism 8.0 software (GraphPad Software, San Diego,CA, USA).

3. Results

3.1. Identification of miR-novel-91 and Target Gene NIPA2

The corresponding target genes of miR-novel-91 were predicted by using the software miRanda v3.3a and the local database, and the miR-novel-91 and NIPA2 corresponding binding sites are shown in Figure 2D. The length of the mature region of miR-novel-91 was 21, the length of the target gene NIPA2 was 1000, the sequence alignment score was 154, the minimum free energy was -24.0 kcal/mol, and the P<0.05 were correlated, and the 2-20 on the mature region of miR-novel-91 was combined with the 433-450 locus on the 3ʹ-UTR region of NIPA2.

3.2. Expression Profiles of miR-novel-91, lncRNA011760 and NIPA2 Under Salinity Stress

The temporal expression patterns of miR-novel-91, lncRNA011760, and target gene NIPA2 during salinity stress response were determined by real-time quantitative PCR (Figure 2). The expression level of miR-novel-91 gradually increased with the duration of stress, peaking at 24 hours with a significantly higher expression relative to the control group (Figure 2A). Exhibiting a similar to that of miR-novel-91, NIPA2 showed a gradual upregulation from 0 to 3 hours and peaked significantly at 24 hours, before returning to the basal, unstressed level by 48 hours (Figure 2B). The relative expression of lncRNA011760 displayed significant fluctuations across the time course. Notably, its expression dropped below the detection limit at 6 hours—a result confirmed by repeated assays—yet rebounded at 24 hours to a level showing no significant difference from the unstressed control group (Figure 2C). These dynamic patterns indicate that the 24-hour mark represents a critical temporal window for the involvement of miR-novel-91 and its target NIPA2 in the salinity adaptation process of the sea cucumber.

3.3. Validation of the miR-novel-91/NIPA2 Regulatory Axis In Vivo

To verify the regulatory relationship between miR-novel-91 and NIPA2, in vivo functional assays were conducted under low-salinity stress using miR-novel-91 agomir and small interfering RNA targeting NIPA2 (si-NIPA2) (Figure 3). The transcript levels of both genes exhibited significant dynamic alterations depending on the delivery conditions. In the miR-novel-91 agomir-treated group, the basal expression of miR-novel-91 was initially lower than that of the control group prior to stress induction; however, it increased progressively with the duration of the low-salinity stress. This upregulation reached a highly significant level at 24 hours (P<0.01) and remained significantly elevated at 48 hours (P<0.05) (Figure 3A). Concurrently, the expression of NIPA2 displayed a highly significant variation at 6 hours and was notably repressed compared to the control group by 48 hours (Figure 3B), demonstrating an inverse expression pattern relative to the microRNA. Conversely, in the si-NIPA2-treated group, the expression of miR-novel-91 showed a highly significant difference prior to stress and was subsequently downregulated as the stress duration extended, dropping below the control group level after 24 hours (Figure 3C). Meanwhile, the expression of NIPA2 was upregulated over the stress time course, peaking with a highly significant difference at 24 hours (Figure 3D). Collectively, these temporal expression dynamics confirm a negative regulatory relationship between miR-novel-91 and NIPA2 in A. japonicus during low-salinity adaptation.

3.4. Validation of the miR-novel-91/NIPA2 Regulatory Axis In Vitro

The regulatory interaction was further validated in vitro using cultured A. japonicus coelomocytes transfected with miR-novel-91 mimics or si-NIPA2 (Figure 4). In the miR-novel-91 mimics-transfected group, the expression of miR-novel-91 peaked immediately post-transfection (0 hours) and maintained a highly significant elevation at 6 hours (P < 0.01). Subsequently, with prolonged stress exposure, its expression was downregulated, dropping below that of the control group at 24 hours (Figure 4A). The expression of the target gene NIPA2 was significantly repressed at 24 hours compared to the control, but later exhibited a highly significant rebound at 48 hours (Figure 4B). In the experimental group transfected with si-NIPA2, the expression of miR-novel-91 was progressively upregulated throughout the stress period, reaching a highly significant peak at 48 hours (Figure 4C). Meanwhile, the expression of NIPA2 displayed a highly significant peak at 0 hours, sharply declined below the control level at 6 hours, and subsequently rebounded, showing a significant upregulation again by 48 hours (Figure 4D). Collectively, these in vitro temporal dynamics substantiate that miR-novel-91 actively regulates NIPA2 expression, further confirming the critical role of this microRNA-target interaction in the cellular response to salinity stress.

3.5. Proposed Mechanism of Salinity Response via the lncRNA011760/miR-novel-91/NIPA2 Axis and Small Molecule Pathway

Based on the observed expression profiles and functional validation results, a three-stage adaptive model for sea cucumber salinity adaptation was proposed (Figure 5). This model operates through a ceRNA regulatory network, in which the lncRNA011760-miR-novel-91 axis tightly regulates NIPA2 expression, thereby fine-tuning Mg²⁺ transport and associated small-molecule metabolic pathways. The chronological cascade of this osmotic stress response is categorized into the following three distinct physiological phases. The initial stage (0-3 hours) is acute osmotic shock and passive tolerance. Upon exposure to acute salinity fluctuations, the intracellular ion balance of the sea cucumber is rapidly disrupted, challenging the homeostasis of inorganic cations such as Mg²⁺. At 0 hours, lncRNA011760 is significantly upregulated to act as a ceRNA sponge, sequestering miR-novel-91. This event effectively relieves the post-transcriptional repression of NIPA2, driving a marked increase in its expression (Figure 2). As an essential cation transporter, the enriched NIPA2 facilitates the transmembrane flux of Mg²⁺ and other inorganic cations. This immediate molecular response stabilizes fundamental intracellular cation homeostasis and mitigates the structural and metabolic damage induced by the early osmotic shock.
Mid-stage (3-24 hours) was active physiological adaptation period. As the stress duration extends, the sea cucumbers gradually transition from passive tolerance to an active osmotic remodeling state. During this critical window, lncRNA011760 expression is markedly downregulated, which releases the sequestered miR-novel-91, leading to its significant upregulation and subsequent direct targeting of NIPA2 (Figure 5). The targeted suppression of NIPA2 strategically modulates the transport efficiency of inorganic cations. This regulatory bottleneck recalibrates the metabolic rhythm of small-molecule pathways, accommodating the dynamic energetic and ionic demands required for the cells to establish a newly adapted intracellular ionic equilibrium.
Late stage (24–48 hours) is low-metabolism survival and potential autolysis. Under prolonged osmotic stress, the intracellular energy and nutrient reserves approach critical depletion. By 48 hours, the expression of lncRNA011760 significantly rebounds, re-engaging its sponge effect on miR-novel-91 and consequently restoring NIPA2 expression levels. The recovered NIPA2 sustains the basal transport of Mg²⁺ and maintains the essential functions of small-molecule pathways. This shift ensures the homeostasis of critical intracellular cations while minimizing global energy expenditure, effectively transitioning the organism into a low-metabolism survival mode to endure extreme stress. However, if long-term salt stress persists beyond physiological limits, the prolonged energetic deficit may trigger excessive autophagy and an irreversible arrest of anabolic metabolism, ultimately culminating in autolysis and visceral damage.

4. Discussion

4.1. The miR-novel-91/NIPA2 Regulatory Axis in Salinity Stress

MicroRNAs (miRNAs) are key post-transcriptional regulatory factors that trigger mRNA degradation or translational repression by binding to the 3′ untranslated region (UTR) of target mRNAs [22,37]. In this study, we identified a negative regulatory relationship between miR-novel-91 and its target gene NIPA2 in sea cucumbers under salinity stress. Experimental data revealed that under low-salinity conditions, miR-novel-91 and NIPA2 exhibited coordinated temporal dynamics, both reaching peak significance at 24 hours. The involvement of non-coding RNAs in echinoderm osmoregulation has recently gained considerable attention. Recent evidence reveals that parallel ceRNA networks, such as the lncRNA001074/let-7/NKAα axis and the lncRNA015168/miR-novel-3/SLC17A9 transmembrane transporter axis, also exhibit critical inflection points at 24 hours under salinity stress[19,32]. These consistent temporal dynamics across different RNA networks strongly validate our findings and suggest that ceRNA-directed modulation of ion transporters is a universally conserved epigenetic strategy for osmoregulatory plasticity in sea cucumbers.
In vivo functional validation further demonstrated that overexpression of miR-novel-91 first upregulated and then downregulated NIPA2, whereas knockdown of NIPA2 expression led to upregulation of miR-novel-91. It is speculated that sea cucumbers consume miR-novel-91 in response to low-salinity stress, temporarily relieving the inhibition of NIPA2. The miR-novel-91 overexpression elicited a biphasic response in NIPA2, while NIPA2 knockdown triggered a compensatory upregulation of miR-novel-91. This feedback loop suggests that A. japonicus may modulate miR-novel-91 levels to transiently alleviate NIPA2 inhibition, thereby facilitating a rapid response to osmotic fluctuations. Liu et al. found that NIPA2 deficiency led to an increased frequency of spontaneous action potentials in neurons and a decrease in BK channel currents, whereas a specific BK channel activator NS11021 was able to reduce neuronal excitability in NIPA2 knockout mice [38].

4.2. Physiological Implications of Metabolic Modulation in Salinity Adaptation

NIPA2 is a highly selective magnesium transporter localized primarily on the plasma membrane and early endosomes, functioning to transfer extracellular Mg²⁺ into the cytoplasm [39]. The study also found that downregulation of NIPA2 expression can induce mitophagy, thereby affecting the osteogenic ability of osteoblast [40]. NIPA2 is involved in 29 entries, including 13 biological processes, 5 cellular components, and 11 molecular functions. NIPA2 is mainly located on the plasma membrane and, together with NIPA1, functions as a magnesium ion transport channel. NIPA2 is mainly found in the plasma membrane and functions together with NIPA1 as a magnesium ion transport channel. Studies have shown that NIPA2 mediates selective magnesium ion transport in the plasma membrane of Xenopus laevis. Goytain et al. found that NIPA2 expression was upregulated under low magnesium conditions, and its function as a selective magnesium transporter was confirmed in Xenopus laevis oocyte[34]. NIPA2 protein is primarily localized to early endosomes and the cell membranes and redistributes to the cell membranes under low magnesium conditions. Mutant NIPA2 proteins are unable to efficiently transport magnesium ions to the cell membrane, leading to reduced intracellular magnesium ion concentration [41]. Some studies have identified NIPA2 as a potential target for treating osteoporosis in type 2 diabetes. AGEs can dose-dependently reduce NIPA2 expression, thereby affecting intracellular magnesium levels, osteoblast apoptosis, and osteoclast activity [39]. Downregulation of NIPA2 expression activates mitochondrial autophagy, which in turn affects the osteogenic capacity of osteoblasts. At the same time, NIPA2 can regulate PINK1/Parkin-mediated mitophagy through the PGC-1α/FoxO3a/MMP pathway [40].
Mg2+ is an abundant cation that is important for many intracellular biochemical functions, especially as a cofactor for ATP. The process by which cells produce energy consists of many Mg²⁺-dependent enzymatic reactions, and disruption of Mg²⁺ homeostasis impairs ATP production by affecting energy metabolism and morphological changes[42]. NIPA2 acts as a selective Mg2+ transporter and helps maintain Mg2+ influx [41], is involved in the transport of inorganic cations such as Mg2+ in small molecule pathways. Small molecule signaling pathways can regulate the physiological state of cells in response to changes through intracellular and extracellular signal transduction [43]. As a key mediator linking Mg2+ transport with the regulation of small molecule pathways, the loss or downregulation of NIPA2 can have a significant impact on small molecule pathways. Mg²⁺ is an indispensable cofactor for ATP-dependent enzymatic reactions, linking its homeostasis intrinsically to energy metabolism [44,45]. At the early stage of acute low-salinity stress (0–3h), the rapid decline in environmental and coelomic fluid Mg²⁺ concentration acts as an intracellular starvation signal, triggering the immediate upregulation of NIPA2 (Figure 5). Previous physiological studies on intertidal holothurians demonstrate that while sodium and chloride levels fluctuate passively with external salinity, Mg²⁺ exhibits a distinct pattern of active homeostatic control [45]. The acute upregulation of NIPA2 enhances the efficiency of Mg2+ transmembrane transport and uptake, thereby reshaping intracellular Mg2+ homeostasis [46], systemically regulating small molecule pathways and inorganic cation balance, and alleviating damage caused by initial osmotic stress.
As stress progresses to the mid-stage (3–24 h), A. japonicus undergoes a strategic shift from passive endurance to active physiological adaptation. This transition involves a complex synergy of ion transport—particularly the fluctuant activation of Na⁺/K⁺-ATPase and the mobilization of intracellular osmolytes [19,20,47]. NIPA1 expression increases as Mg2+ concentration decreases, enhancing Mg2+ uptake to maintain homeostasis [48]. Behaviorally, adaptive strategies are manifested through defensive mechanisms, such as reducing body wall permeability. This was observed in the gray sea cucumber (Holothuria grisea), which lowers body wall permeability by contracting its tube feet and oral tentacles, thereby reducing water influx and alleviating osmotic stress[45]. The miR-novel-91 is significantly upregulated, inhibiting NIPA2 and reducing the transport efficiency of inorganic cations such as Mg2+ (Figure 2A-B). The significant upregulation of miR-novel-91 during this phase suppresses NIPA2, effectively recalibrating the transport efficiency of Mg²⁺. This regulatory bottleneck adjusts the metabolic process of small-molecule pathways, allowing cells to establish a newly adapted ionic equilibrium and providing support for adapting to the osmotic environment [39,40].
As an organism that lacks specialized organs for regulating osmotic pressure, sea cucumbers can only live within a certain salinity range and are very sensitive [17]. Prolonged salinity stress eventually leads to the depletion of cellular energy reserves, such as glucose and branched-chain amino acids [49]. As cellular energy and amino acid reserves are depleted, they shift from active adaptation to passive tolerance. At 48 hours, the rebound of lncRNA011760 acts as a ceRNA sponge to sequester miR-novel-91, effectively restoring NIPA2 levels and maintaining basal Mg²⁺ influx (Figure 4). This shift ensures the persistence of essential metabolic functions while transitioning the organism into a low-metabolism survival mode [46].
Crucially, Mg²⁺ availability and NIPA2 expression are tightly linked to mitochondrial physiology and autophagy. In vertebrate models, the downregulation or absence of NIPA2 leads to intracellular Mg²⁺ deficiency, which directly activates PINK1/Parkin-mediated mitophagy via the AMPK/mTOR or PGC-1α signaling pathways to clear damaged mitochondria [50]. We postulate a similar mechanism in A. japonicus: to minimize energy expenditure under prolonged stress, the sea cucumber halts energy-intensive protein synthesis and fully activates systemic autophagy to recycle intracellular components. Unlike the early protective autophagy, the late-stage autophagy mainly recycles intracellular components into essential nutrients needed to maintain energy [49]. This shift is a direct result of the sea cucumber limited salinity tolerance—because it cannot sustain active osmoregulation, it prioritizes saving energy to prolong survival. However, this survival strategy has limitations: with prolonged salinity stress, the continued activation of autophagy and complete cessation of anabolic metabolism may exceed physiological thresholds, and the sea cucumber may adopt its ultimate survival strategy—evisceration [15].
This study demonstrates the pivotal role of the lncRNA011760/miR-novel-91/NIPA2 axis in the salinity adaptation of Apostichopus japonicus, specifically by modulating metabolic pathways and cation homeostasis. Our findings offer a novel framework for understanding how stenohaline echinoderms multi-stage adaptive strategies at the epigenetic level. Nevertheless, several limitations warrant further consideration. The intricate interplay between NIPA2-mediated Mg²⁺ flux and downstream effectors within the broader metabolic network—including secondary ion transporters and specific osmolytes—requires more further research to fully delineate the regulatory hierarchy. Additionally, the macroscopic physiological consequences of manipulating this ceRNA axis, particularly its impact on long-term osmotic equilibrium, remain to be empirically validated. Future research should address these gaps through the integration of multi-omics (transcriptomics, proteomics, and metabolomics) and functional genomics to refine this regulatory network. Such efforts will be instrumental in exploring the potential of this axis as a molecular target for the genetic enhancement and marker-assisted breeding of salt-tolerant strains in this economically significant but salinity-sensitive species.

5. Conclusions

This study elucidates the pivotal role of the lncRNA011760/miR-novel-91/NIPA2 axis in orchestrating the salinity adaptation of Apostichopus japonicus via metabolic pathways. Through integrated in vivo and in vitro functional assays, we confirmed a competitive endogenous RNA mechanism where lncRNA011760 acts as a molecular sponge for miR-novel-91, thereby alleviating the post-transcriptional repression of the magnesium transporter NIPA2. Based on these molecular dynamics, we propose a novel inhibition-adaptation-survival three-stage model. Initially, the acute upregulation of NIPA2 enhances Mg²⁺ transport efficiency to mitigate immediate osmotic shock. Subsequently, miR-novel-91-mediated suppression of NIPA2 creates a transient biosynthetic window, facilitating the transition from passive tolerance to active metabolic adaptation. Ultimately, the lncRNA-driven restoration of NIPA2 maintains Mg²⁺ homeostasis, enabling the transition into a low-metabolism survival mode. These stage-specific adaptive shifts reflect the inherent physiological constraints of sea cucumbers as osmoconformers. Our findings provide deep insights into the epigenetic regulation of stress tolerance in echinoderms and identify the lncRNA011760/miR-novel-91/NIPA2 axis as a promising molecular target for the marker-assisted breeding of salt-tolerant strains.

Author Contributions

Yi Tian, Junwei Chen, Yudi Zhao, Jiawei Zhong, Haotian Xue, Project administration, Visualization, Writing. Xin Wei, Qing Gao,: Data curation, Supervision, review & editing.

Funding

This work was supported by the National Natural Science Foundation of China (No. 32273117).

Institutional Review Board Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding author.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Allan, R.P.; Barlow, M.; Byrne, M.P.; Cherchi, A.; Douville, H.; Fowler, H.J.; Gan, T.Y.; Pendergrass, A.G.; Rosenfeld, D.; Swann, A.L.S.; et al. Advances in Understanding Large-Scale Responses of the Water Cycle to Climate Change. Annals of the New York Academy of Sciences 2020, 1472, 49–75. [CrossRef] [PubMed]
  2. Röthig, T.; Trevathan-Tackett, S.M.; Voolstra, C.R.; Ross, C.; Chaffron, S.; Durack, P.J.; Warmuth, L.M.; Sweet, M. Human-Induced Salinity Changes Impact Marine Organisms and Ecosystems. Global Change Biology 2023, 29, 4731–4749. [CrossRef] [PubMed]
  3. Hu, M.; Li, Q.; Li, L. Effect of Salinity and Temperature on Salinity Tolerance of the Sea Cucumber Apostichopus Japonicus. Fish Sci 2010, 76, 267–273. [CrossRef]
  4. Meng, X.; Dong, Y.; Dong, S.; Yu, S.; Zhou, X. Mortality of the Sea Cucumber, Apostichopus Japonicus Selenka, Exposed to Acute Salinity Decrease and Related Physiological Responses: Osmoregulation and Heat Shock Protein Expression. Aquaculture 2011, 316, 88–92. [CrossRef]
  5. Li, L.; Li, Q.; Sun, X.; Kong, L. Effects of Temperature and Salinity on Larval Growth, Survival, and Development of the Sea Cucumber Apostichopus Japonicus. North American Journal of Aquaculture 2011, 73, 296–303. [CrossRef]
  6. Wang, F.; Yang, H.; Gao, F.; Liu, G. Effects of Acute Temperature or Salinity Stress on the Immune Response in Sea Cucumber, Apostichopus Japonicus. Comparative Biochemistry and Physiology Part A: Molecular & Integrative Physiology 2008, 151, 491–498. [CrossRef]
  7. Yuan, X.; Yang, H.; Wang, L.; Zhou, Y.; Gabr, H.R. Effects of Salinity on Energy Budget in Pond-Cultured Sea Cucumber Apostichopus Japonicus (Selenka) (Echinodermata: Holothuroidea). Aquaculture 2010, 306, 348–351. [CrossRef]
  8. Mei, Y.; Xu, Y.; Gao, Q.; Li, Z.; Dong, S. Effects of Temperature and Salinity on CO2 Fluxes Dynamics and Respiration Metabolism in the Sea Cucumber Apostichopus Japonicus (Selenka). Marine Pollution Bulletin 2025, 215, 117928. [CrossRef]
  9. Brusca, R.C.; Brusca., G.J. Invertebrates; Sinauer Associates, Sunderland, Massachusetts., 2004; 53; ISBN ISBN 0–87893–097–3.
  10. Binyon, J. Physiology of Echinoderms; Elsevier, 1972; ISBN 978-0-08-016991-0.
  11. Willmer, P.; Stone, G.; Johnston, I.A. Environmental Physiology of Animals; 2nd ed.; Blackwell Pub: Malden, Mass, 2004; ISBN 978-1-4051-0724-2.
  12. Diehl, W.J. Osmoregulation in Echinoderms. Comparative Biochemistry and Physiology Part A: Physiology 1986, 84, 199–205. [CrossRef]
  13. Vidolin, D.; Gouvea, I.A.S.; Freire, C.A. Estabilidade Osmótica Dos Fluídos Celômicos de Um Pepino Do Mar (Holothuria Grisea) e de Uma Estrela-Do-Mar (Asterina Stellifera) (Echinodermata) Expostos Ao Ar Durante a Maré Baixa: Um Estudo de Campo. ABPar 2002, 31. [CrossRef]
  14. Castellano, G.C.; Souza, M.M.; Freire, C.A. Volume Regulation of Intestinal Cells of Echinoderms: Putative Role of Ion Transporters Na+/K+-ATPase and NKCC). Comp Biochem Physiol A Mol Integr Physiol 2016, 201, 124–131. [CrossRef] [PubMed]
  15. Fankboner, P.V. Seasonal Visceral Atrophy and Response to Salinity by Parastichopus Californicus (Stimpson): Osmoregulation? 2002, Bull.17.
  16. Barrett, N.J.; Harper, E.M.; Last, K.S.; Reinardy, H.C.; Peck, L.S. Behavioural and Physiological Impacts of Low Salinity on the Sea Urchin Echinus Esculentus. Journal of Experimental Biology 2024, 227, jeb246707. [CrossRef]
  17. Dong, Y.; Dong, S.; Meng, X. Effects of Thermal and Osmotic Stress on Growth, Osmoregulation and Hsp70 in Sea Cucumber (Apostichopus Japonicus Selenka). Aquaculture 2008, 276, 179–186. [CrossRef]
  18. Huang, L.; Zhong, S.; Pan, C.; Mo, H.; Pan, Z.; Huang, G.; Mi, S.; Gao, C.; Liu, Y. Effects of Acute Salinity Stress on Physiology and Immunoenzymatic Activity in Juvenile Sea Cucumber, Stichopus Monotuberculatus. Aquaculture 2024, 578, 740094. [CrossRef]
  19. Russell, M.P. Echinoderm Responses to Variation in Salinity. Adv Mar Biol 2013, 66, 171–212. [CrossRef]
  20. Jiang, J.; Tang, Y.; Cao, Z.; Zhou, C.; Yu, Z. Effects of Hypo-Osmotic Stress on Osmoregulation, Antioxidant Response, and Energy Metabolism in Sea Cucumber Holothuria Moebii under Desalination Environment. Environmental Research 2024, 252, 118800. [CrossRef]
  21. Podbielski, I.; Hiebenthal, C.; Hajati, M.-C.; Bock, C.; Bleich, M.; Melzner, F. Capacity for Cellular Osmoregulation Defines Critical Salinity of Marine Invertebrates at Low Salinity. Front. Mar. Sci. 2022, 9. [CrossRef]
  22. Esteller, M. Non-Coding RNAs in Human Disease. Nat Rev Genet 2011, 12, 861–874. [CrossRef]
  23. Zheng J.; Zhang G.; Ren L. Advances in miRNA research: Unraveling the complexities of gene regulation. Animal Models and Experimental Medicine 2025, 8, 1741–1759. [CrossRef] [PubMed]
  24. Zhang, S.; Shao, Y.; Li, C. Characterization of Host lncRNAs in Response to Vibrio Splendidus Infection and Function as Efficient miRNA Sponges in Sea Cucumber&#13; Front. Immunol. 2021, 12, 792040. [CrossRef]
  25. Shang, Y.; Tian, Y.; Wang, Y.; Guo, R. Novel lncRNA lncRNA001074 Participates in the Low Salinity-Induced Response in the Sea Cucumber Apostichopus Japonicus by Targeting the Let-7/NKAα Axis. Cell Stress and Chaperones 2021, 26, 785–798. [CrossRef] [PubMed]
  26. Wei, X.; Chen, J.; Zhao, Y.; Li, N.; Wang, N.; Xu, T.; Yang, Y.; Chang, Y.; Tian, Y. A ceRNA Network Mediates Salinity Adaptation Via miR-Novel-3-LNC_015168-SLC17A9 Axis in Sea Cucumber. Mar Biotechnol 2026, 28, 21. [CrossRef] [PubMed]
  27. Goytain, A.; Quamme, G.A. Identification and Characterization of a Novel Mammalian Mg2+ Transporter with Channel-like Properties. BMC Genomics 2005, 6, 48. [CrossRef]
  28. Zhou, H.; Clapham, D.E. Mammalian MagT1 and TUSC3 Are Required for Cellular Magnesium Uptake and Vertebrate Embryonic Development. Proc. Natl. Acad. Sci. U.S.A. 2009, 106, 15750–15755. [CrossRef]
  29. Brandao, K.; Deason-Towne, F.; Perraud, A.-L.; Schmitz, C. The Role of Mg2+ in Immune Cells. Immunol Res 2013, 55, 261–269. [CrossRef] [PubMed]
  30. Sahni, J.; Nelson, B.; Scharenberg, A.M. SLC41A2 Encodes a Plasma-Membrane Mg2+ Transporter. Biochem J 2007, 401, 505–513. [CrossRef]
  31. Zsurka, G.; Gregán, J.; Schweyen, R.J. The Human Mitochondrial Mrs2 Protein Functionally Substitutes for Its Yeast Homologue, a Candidate Magnesium Transporter. Genomics 2001, 72, 158–168. [CrossRef] [PubMed]
  32. Schmitz, C.; Deason, F.; Perraud, A.-L. Molecular Components of Vertebrate Mg2+-Homeostasis Regulation. Magnes Res 2007, 20, 6–18.
  33. Goytain, A.; Quamme, G.A. Identification and Characterization of a Novel Family of Membrane Magnesium Transporters, MMgT1 and MMgT2. Am J Physiol Cell Physiol 2008, 294, C495-502. [CrossRef]
  34. Goytain, A.; Hines, R.M.; Quamme, G.A. Functional Characterization of NIPA2, a Selective Mg2+ Transporter. Am J Physiol Cell Physiol 2008, 295, C944-953. [CrossRef]
  35. Simms, D.; Chomczynski, P. TRIzolTM: A New Reagent for Optimal Single-Step Isolation of RNA. Focus (San Francisco, Calif.) 1992, 15.
  36. Tian, Y.; Shang, Y.; Guo, R.; Chang, Y.; Jiang, Y. Salinity Stress-Induced Differentially Expressed miRNAs and Target Genes in Sea Cucumbers Apostichopus Japonicus. Cell Stress and Chaperones 2019, 24, 719–733. [CrossRef]
  37. Ali, S.A.; Peffers, M.J.; Ormseth, M.J.; Jurisica, I.; Kapoor, M. The Non-Coding RNA Interactome in Joint Health and Disease. Nat Rev Rheumatol 2021, 17, 692–705. [CrossRef]
  38. Liu, N.; Xie, H.; Xiang-wei, W.; Gao, K.; Wang, T.; Jiang, Y. The Absence of NIPA2 Enhances Neural Excitability through BK (Big Potassium) Channels. CNS Neurosci Ther 2019, 25, 865–875. [CrossRef]
  39. Zhao, W.; Zhang, W.-L.; Yang, B.; Sun, J.; Yang, M.-W. NIPA2 Regulates Osteoblast Function via Its Effect on Apoptosis Pathways in Type 2 Diabetes Osteoporosis. Biochemical and Biophysical Research Communications 2019, 513, 883–890. [CrossRef]
  40. Zhao, W.; Zhang, W.; Ma, H.; Yang, M. NIPA2 Regulates Osteoblast Function by Modulating Mitophagy in Type 2 Diabetes Osteoporosis. Sci Rep 2020, 10, 3078. [CrossRef]
  41. Xie, H.; Zhang, Y.; Zhang, P.; Wang, J.; Wu, Y.; Wu, X.; Netoff, T.; Jiang, Y. Functional Study of NIPA2 Mutations Identified from the Patients with Childhood Absence Epilepsy. PLoS ONE 2014, 9, e109749. [CrossRef]
  42. Yamanaka, R.; Tabata, S.; Shindo, Y.; Hotta, K.; Suzuki, K.; Soga, T.; Oka, K. Mitochondrial Mg2+ Homeostasis Decides Cellular Energy Metabolism and Vulnerability to Stress. Sci Rep 2016, 6, 30027. [CrossRef] [PubMed]
  43. Camilli, A.; Bassler, B.L. Bacterial Small-Molecule Signaling Pathways. Science 2006, 311, 1113–1116. [CrossRef] [PubMed]
  44. Madrid, E.; Zanders, I.P.; Herrera, F.C. Changes in Coelomic Fluid and Intracellular Ionic Composition in Holothurians Exposed to Diverse Sea Water Concentrations. Comparative Biochemistry and Physiology Part A: Physiology 1976, 54, 167–174. [CrossRef]
  45. Castellano, G.C.; Santos, I.A.; Freire, C.A. Maintenance of Ionic Gradients and Tissue Hydration in the Intertidal Sea Cucumber Holothuria Grisea under Hypo- and Hyper-Salinity Challenges. Journal of the Marine Biological Association of the United Kingdom 2018, 98, 325–332. [CrossRef]
  46. Quamme, G.A. Molecular Identification of Ancient and Modern Mammalian Magnesium Transporters. American Journal of Physiology-Cell Physiology 2010, 298, C407–C429. [CrossRef]
  47. Geng, C.; Tian, Y.; Shang, Y.; Wang, L.; Jiang, Y.; Chang, Y. Effect of Acute Salinity Stress on Ion Homeostasis, Na+/K+-ATPase and Histological Structure in Sea Cucumber Apostichopus Japonicus. SpringerPlus 2016, 5, 1977. [CrossRef]
  48. Goytain, A.; Hines, R.M.; El-Husseini, A.; Quamme, G.A. NIPA1(SPG6), the Basis for Autosomal Dominant Form of Hereditary Spastic Paraplegia, Encodes a Functional Mg2+ Transporter. Journal of Biological Chemistry 2007, 282, 8060–8068. [CrossRef]
  49. Rabanal-Ruiz, Y.; Otten, E.G.; Korolchuk, V.I. mTORC1 as the Main Gateway to Autophagy. Essays Biochem 2017, 61, 565–584. [CrossRef] [PubMed]
  50. Carroll, B.; Korolchuk, V.I.; Sarkar, S. Amino Acids and Autophagy: Cross-Talk and Co-Operation to Control Cellular Homeostasis. Amino Acids 2015, 47, 2065–2088. [CrossRef] [PubMed]
Figure 1. The entire experimental procedure used in this study.
Figure 1. The entire experimental procedure used in this study.
Preprints 206934 g001
Figure 2. Expression profiles of miR-novel-91 and NIPA2 during low-salinity adaptation in A. japonicus. (A) Relative expression of miR-novel-91. (B) Relative expression of NIPA2. (C) Relative expression of lncRNA011760. Data are presented as mean ± standard error of the mean (SEM) (n=3 biological replicates). Note: * indicates a significant difference compared to the control group (P < 0.05), ** indicates a highly significant difference compared to the control group (P < 0.01). (D) Binding site maps of miR-novel-91 and its corresponding target genes.
Figure 2. Expression profiles of miR-novel-91 and NIPA2 during low-salinity adaptation in A. japonicus. (A) Relative expression of miR-novel-91. (B) Relative expression of NIPA2. (C) Relative expression of lncRNA011760. Data are presented as mean ± standard error of the mean (SEM) (n=3 biological replicates). Note: * indicates a significant difference compared to the control group (P < 0.05), ** indicates a highly significant difference compared to the control group (P < 0.01). (D) Binding site maps of miR-novel-91 and its corresponding target genes.
Preprints 206934 g002
Figure 3. Expression profiles of miR-novel-91 and NIPA2 in A. japonicus under low-salinity stress following in vivo delivery of miR-novel-91 agomir or si-NIPA2. (A) Expression of miR-novel-91 after injection of miR-novel-91 agomir; (B) Expression of NIPA2 after injection of miR-novel-91 agomir; (C) Expression of miR-novel-91 after transfection with si-NIPA2; (D) Expression of NIPA2 after transfection with si-NIPA2. Data are presented as mean ± SEM (n=3 biological replicates). Note: * indicates a significant difference compared with the control group (P<0.05), ** indicates a highly significant difference compared with the control group (P<0.01).
Figure 3. Expression profiles of miR-novel-91 and NIPA2 in A. japonicus under low-salinity stress following in vivo delivery of miR-novel-91 agomir or si-NIPA2. (A) Expression of miR-novel-91 after injection of miR-novel-91 agomir; (B) Expression of NIPA2 after injection of miR-novel-91 agomir; (C) Expression of miR-novel-91 after transfection with si-NIPA2; (D) Expression of NIPA2 after transfection with si-NIPA2. Data are presented as mean ± SEM (n=3 biological replicates). Note: * indicates a significant difference compared with the control group (P<0.05), ** indicates a highly significant difference compared with the control group (P<0.01).
Preprints 206934 g003
Figure 4. Expression profiles of miR-novel-91 and NIPA2 in A. japonicus coelomocytes (in vitro) under low-salinity stress following the transfection with miR-novel-91 mimics or si-NIPA2. (A) Expression of miR-novel-91 after transfection with miR-novel-91 mimics; (B) Expression of NIPA2 after transfection with miR-novel-91 mimics; (C) Expression of miR-novel-91 after transfection with si-NIPA2; (D) Expression of NIPA2 after transfection with si-NIPA2. Note: * indicates a significant difference compared with the control group (P < 0.05), ** indicates a highly significant difference compared with the control group (P < 0.01).
Figure 4. Expression profiles of miR-novel-91 and NIPA2 in A. japonicus coelomocytes (in vitro) under low-salinity stress following the transfection with miR-novel-91 mimics or si-NIPA2. (A) Expression of miR-novel-91 after transfection with miR-novel-91 mimics; (B) Expression of NIPA2 after transfection with miR-novel-91 mimics; (C) Expression of miR-novel-91 after transfection with si-NIPA2; (D) Expression of NIPA2 after transfection with si-NIPA2. Note: * indicates a significant difference compared with the control group (P < 0.05), ** indicates a highly significant difference compared with the control group (P < 0.01).
Preprints 206934 g004
Figure 5. A three-stage adaptive model for salinity acclimation in sea cucumbers based on the results and small molecule pathway. (Created in https://BioRender.com).
Figure 5. A three-stage adaptive model for salinity acclimation in sea cucumbers based on the results and small molecule pathway. (Created in https://BioRender.com).
Preprints 206934 g005
Table 1. miR-novel-91, NIPA2, and lncRNA011760 homologous gene primers used for expression.
Table 1. miR-novel-91, NIPA2, and lncRNA011760 homologous gene primers used for expression.
Categroy Sequences name Sequence (5′-3′)
qRT-PCR Primers NIPA2-F CTGACCTGCCTTCCGTGAGTAAG
NIPA2-R TGGCTGCTCTCCTCCTCTGAC
miR-novel-91 CATGTGACCGTTACAATGGGCG
lncRNA011760-F GGAGAGCCTAGATTATGATACCGTTAC
lncRNA011760-R TTCACCACTAATCGTTCCACCAAG
Cytb-F TGAGCCGCAACAGTAATC
Cytb-R AAGGGAAAAGGAAGTGAAAG
U6 ACGCAAATTCGTGAAGCGTT
Functional oligonucletides Negative Control UUGUACUACACAAAAGUACUG
GUACUUUUGUGUAGUACAAUU
miR-novel-91 agomir/minics AUGUGACCGUUACAAUGGGCG
CCCAUUGUAACGGUCACAUUU
si-NIPA2 GCGAUAUCUACAAGAAACUTT
AGUUUCUUGUAGAUAUCGCTT
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.
Copyright: This open access article is published under a Creative Commons CC BY 4.0 license, which permit the free download, distribution, and reuse, provided that the author and preprint are cited in any reuse.
Prerpints.org logo

Preprints.org is a free preprint server supported by MDPI in Basel, Switzerland.

Subscribe

Disclaimer

Terms of Use

Privacy Policy

Privacy Settings

© 2026 MDPI (Basel, Switzerland) unless otherwise stated