Prerpints.org logo
Preprint
Article

This version is not peer-reviewed.

Phylogenetic Analysis of Lactococcosis-Causing Bacteria Isolated from Different Fish Species in Brazil Using Multilocus Sequence Typing

Guilherme Campos Tavares  *,Sarah Portes Carneiro,Angelo Carlo Chaparro Barbanti,Angélica Emanuely Costa do Rosário
,Helena Caldeira Matos
,Cynthia Rafaela Monteiro da Silva Maia,Henrique Lopes Costa
,Renata Catão Egger,Luiz Fagner Ferreira Nogueira
,Júlio César Câmara Rosa
,Felipe Luiz Pereira,Fabiana Pilarski
,Silvia Umeda Gallani,Esteban Soto,Carlos Augusto Gomes Leal,Henrique César Pereira Figueiredo

Submitted:

08 February 2026

Posted:

10 February 2026

You are already at the latest version

Abstract

Lactococcosis has emerged as an economically and ecologically significant disease in aquatic animals worldwide. This study employed multilocus sequence typing (MLST) to investigate the genetic diversity of Lactococcus spp. strains from Brazilian fish species and evaluate their phylogenetic relationships with global isolates to elucidate potential epidemiological connections involving multiple host species and distinct geographic regions. A total of 55 isolates had their DNA extracted, followed by the amplification and sequencing of the internal fragments of seven housekeeping genes (als, atpA, tuf, gapC, gyrB, rpoC and galP). Sequence types (STs) and clonal complexes (CCs) were defined. An unrooted neighbor-joining phylogenetic tree was generated using allele profiles from this study and those previously reported from other aquatic animal species. The isolates comprised 29 STs (11 previously reported, 18 novel ones), which were grouped into species-specific CCs: CC5 (L. formosensis); CC4, CC17, CC62 (L. garvieae); CC24, CC29, CC97 (L. petauri). Considerable genetic divergence was observed, with L. formosensis and L. garvieae forming heterogeneous populations, while L. petauri was more homogeneous. Phylogenetics confirmed groupings within the CCs and revealed significant genetic arrangements. In conclusion, the Brazilian Lactococcus spp. strains analyzed in this study constitute a genetically diverse population based on their STs. MLST and phylogenetic analysis demonstrated genetic relatedness between the L. garvieae and L. formosensis isolates from this study and those from other aquatic animal species. In contrast, all the STs identified for L. petauri in this study were unrelated to the MLST lineages responsible for outbreaks in Brazilian Nile tilapia (Oreochromis niloticus) and North American rainbow trout (Oncorhynchus mykiss). This suggests that piscine L. petauri populations in the Americas evolved from distinct ancestral origins.

Keywords: 
Lactococcus
;  
native fish species
;  
ornamental fish
;  
sequence type
;  
clonal complex
;  
phylogenetic relationships
Subject: 
Biology and Life Sciences  -   Animal Science, Veterinary Science and Zoology

Introduction

Lactococcosis has emerged as an economically and ecologically significant disease in aquatic animals worldwide [1]. Disease outbreaks and associated mortality have been linked to infections caused by Lactococcus formosensis, L. garvieae and L. petauri in various fishes and prawn species, particularly in aquaculture systems [2,3,4,5,6,7,8]. Among the lactococcosis-causing bacteria (LCBs), L. petauri has been responsible for the most significant economic losses in commercial rainbow trout (Oncorhynchus mykiss) [9] and Nile tilapia (Oreochromis niloticus) [3] production in the Americas. Nevertheless, LCBs have been detected in a wide range of fish species, some of which are susceptible to natural infection or experimental challenge [10,11,12,13,14,15,16,17,18,19,20,21]. In addition to aquatic animals, these three pathogens have also been identified in, terrestrial animals including humans, products destined for human consumption, and in the environment [22,23,24,25,26].
Given the broad range of hosts and wide geographic distribution of these pathogens, genetic characterization studies have become a critical tool in epidemiological investigations. Such studies help elucidate the pathogen’s genetic structure and assess genetic relatedness or the divergence among isolates [23]. Different molecular typing methods have been employed for the genotyping of strains of LCBs. These include PCR-based DNA fingerprinting techniques such as repetitive sequence-based PCR (REP-PCR), random amplification of polymorphic DNA (RAPD-PCR), restriction fragment length polymorphism (RFLP), and pulsed-field gel electrophoresis (PFGE) [19,27,28,29], as well as sequencing-based approaches like multilocus sequence analysis (MLSA) and multilocus sequence typing (MLST) [3,9,22].
Among the sequencing-based methods, MLST is the most widely adopted for assessing genetic diversity in bacterial pathogens, including those that affect aquatic host species [30,31]. MLST is a molecular typing technique that relies on sequencing internal fragments of housekeeping genes and has been extensively used to determine phylogenetic relationships among bacterial isolates [23], infer ancestral genotypes and trace evolutionary lineages [22]. For LCBs, the seven housekeeping genes analyzed—along with their corresponding proteins—are als (α-acetolactate synthase), atpA (ATP synthase α subunit), tuf (elongation factor EF-Tu), gapC (glyceraldehyde-3-phosphate dehydrogenase), gyrB (DNA gyrase β subunit), rpoC (RNA polymerase β subunit) and galP (galactose permease) [22]. The combination of alleles from these genes defines an allelic profile, which corresponds to a sequence type (ST). Genetic relatedness among isolates can be inferred by comparing these allelic profiles. Allele and ST designations can be used to classify strains into clonal complexes (CCs) or lineages, thus providing insights into population structure and evolutionary dynamics [32]. Furthermore, curated MLST databases, particularly those hosted by PubMLST [33], offer standardized nomenclature and facilitate phylogenetic analysis to infer evolutionary relationships [32]. This approach enables the differentiation of LCB strains isolated from a variety of hosts and from different geographic regions [3,22,23,24,25,26,34,35].
In Brazil, a recent study evaluated the genetic diversity of isolates from LCBs derived from native fish species using PCR-based DNA fingerprinting techniques (REP-, RAPD-, and BOX-PCR) [19]. The results demonstrated significant genetic heterogeneity among L. garvieae strains, whereas L. petauri isolates exhibited a more homogeneous population [19]. To date, MLST analysis in Brazil has been restricted to L. garvieae and L. petauri isolates obtained from Nile tilapia from different commercial farms, revealing that there are only three STs (ST24, ST46 and ST47) in circulation [3]. However, no MLST data are available for LCBs strains from other fish species in the country. This represents a critical knowledge gap since it remains unclear whether the genetic structure of Lactococcus spp. infecting non-Nile tilapia hosts mirrors that reported in tilapia-associated strains, or whether the same genotypes are shared between fish farms and wild fish populations. Furthermore, MLST-based surveillance is ideal for assessing potential cross-species transmission and supports evidence-based biosecurity measures in Brazilian aquaculture.
Therefore, this study aimed to evaluate the genetic diversity and population structure of Brazilian LCB strains isolated from multiple fish species using the MLST approach. Additionally, we sought to investigate the phylogenetic relationships between these isolates and globally deposited strains by comparing them with the sequences available in the PubMLST database, in order to elucidate potential epidemiological connections among diverse different host species and across geographic regions.

Methods

Bacterial Strains and Identification

This study used a total of 55 Lactococcus spp. strains, comprising L. formosensis (n = 7), L. garvieae (n = 20) and L. petauri (n = 28) isolates. The strains were obtained from 16 fish species from wild populations and commercial farms in six Brazilian states (Amazonas, Bahia, Mato Grosso do Sul, Minas Gerais, Pará and São Paulo) between 2012 and 2024 (Table 1). The isolates were obtained during routine diagnostic investigations of bacterial infections in fish, and were identified to the species level via gyrB sequencing, following previously described methods [19].

DNA Extraction

The selected Lactococcus spp. strains were cultured from cryopreserved stocks on de Man, Rogosa and Sharp (MRS) agar (Merck, Darmstadt, Germany) and incubated at 28 ºC for 72 h under aerobic conditions. Colonies were harvested and resuspended in 180 µL of lysis buffer (20 mg/mL lysozyme, 20 mM Tris-HCl [pH 8.0], 2mM EDTA, and 1.2% Triton X-100), followed by incubation at 37 ºC overnight. Bacterial DNA was extracted using the Maxwell® 16 Tissue DNA Purification kit (Promega, Madison, USA) in accordance with the manufacturer’s protocol. DNA concentration and purity were assessed spectrophotometrically (Nanodrop® 2000, Thermo Fisher Scientific, Wilmington, USA) at 260/280 nm absorbance ratios. DNA samples were stored at -20 ºC until further analysis.

Multilocus Sequence Typing

For the MLST analysis, the isolates were characterized by sequencing internal fragments of seven housekeeping genes, following a modified version of the previously described protocol [22]. In summary, PCR amplification was performed using the Gotaq® PCR Core System kit (Promega) in 25 µL reaction volumes containing 100 ng of DNA template (2 µL) and 23 µL of PCR mix (1× PCR buffer, 0.2 µM of each primer [Table 2], 0.2 mM dNTPs, 1.5 mM MgCl2, 0.625 U of DNA polymerase, and nuclease-free water). The primers were synthesized and purified by Invitrogen (Thermo Fisher Scientific).
Amplification of als, tuf, gapC, gyrB, rpoC and galP was conducted in a 96-well thermal cycler (Veriti®, Applied Biosystems, Foster City, USA) under the following conditions: initial denaturation at 95 ºC for 5 min; 35 cycles of 94 ºC for 45 s, 56-58 ºC (primer-specific, see Table 2) for 45 s, and 72 ºC for 70 s; and a final extension at 72 ºC for 5 min. The atpA gene was amplified using a touchdown protocol: initial denaturation at 95 ºC for 5 min; 3 cycles of 95 ºC for 60 s, 56 ºC for 135 s, and 72 ºC for 75 s; followed by 30 cycles of 95 ºC for 35 s, 56 ºC for 75 s, and 72 ºC for 75 s; with a final extension at 72 ºC for 7 min.
Amplicons were size verified by capillary electrophoresis (QIAxcel Advanced System, Qiagen, Hilden, Germany) using the QX DNA Screening kit (Qiagen) according to the manufacturer’s protocol. PCR products were then purified using the Agencourt AMPure® XP kit (Beckman Coulter, Brea, USA). Sanger sequencing was performed using the BigDye® Terminator v3.1. Cycle Sequencing kit (Applied Biosystems) in a genetic analyzer (ABI 3500, Applied Biosystems). Sequencing contigs were assembled and manually curated using Geneious Prime v. 2022.2.2 (Dotmatics, Boston, USA).

Data Analysis

To determine the allelic profiles and STs for each isolate, the assembled contigs were analyzed against the L. garvieae typing scheme in the PubMLST database (https://pubmlst.org/organisms/lactococcus-garvieae) [33]. The number of alleles and polymorphic sites were calculated using the BIGSdb Polymorphic Site Analysis plugin. Additional Lactococcus spp. strains isolated from aquatic animals with publicly available genome sequences in GenBank databases [36,37], but without prior ST designations in the literature, were selected for analysis (Table S1). The corresponding FASTA sequences were retrieved and subsequently uploaded to the PubMLST database via the BIGSdb platform for automated in silico analysis. Novel allelic profiles and STs were assigned to both the newly sequenced strains in this study and the previously deposited genomes.
The genetic relationships among the LCB isolates were inferred using the goeBURST algorithm [38,39], performed in PHYLOViZ software v. 2.0 [40]. Clonal complexes were defined based on single-locus variants (SLVs) using the software’s default parameters. The novel STs and CCs identified in this study were designated with the prefix ‘n’ preceding the ST, or the CC number.
The discriminatory power of the MLST scheme was evaluated using Simpson’s diversity index [41], calculated with the Comparing Partitions online tool (http://www.comparingpartitions.info/) [42].
To examine the phylogenetic relationships among the LCB isolates, we constructed an unrooted phylogenetic tree incorporating both novel allele profiles from this study and previously reported alleles from diverse animal aquatic species worldwide (Table S2). The seven housekeeping gene sequences were concatenated and the isolate sequences composed by all the loci were aligned using ClustalW implemented in MEGA12 [43]. A neighbor-joining phylogenetic tree was generated using the Tamura-Nei model, with branch support assessed using 1,000 bootstrap replicates to evaluate topological robustness [44]. The resulting phylogenetic trees were visualized using iTOL v. 6 online tool [45].

Results

MLST Analysis

The MLST analysis of the 55 LCB strains evaluated in this study grouped the isolates into 29 distinct STs (Table 1). The map of the distribution of L. formosensis, L. garvieae, and L. petauri STs are shown in Figure 1. Sequence analysis revealed that all the loci were polymorphic, with the number of variable nucleotide sites ranging from 9 (gapC) to 111 (gyrB), resulting in 8 (gapC) to 22 (als) distinct alleles (Table 2).
Analysis of the 67 LCB genome sequences isolated from aquatic animals and subjected to MLST analysis in PubMLST identified 20 STs, including 10 novel STs. Only the ERR5094895 strain (from rainbow trout in Poland) lacked an assigned ST due to the absence of the als gene in its genome sequence (Table S1).
The L. formosensis strains used in this study were grouped into 6 different STs, including one previously reported (ST20) and five novel STs (nST166, nST168, nST174, nST178 and nST179). All of these STs were characterized as singletons (Table 1, Figure 2). The Simpson’s diversity index (SDI) value was 0.933.
The L. garvieae strains grouped into 14 different STs, including five previously reported STs (ST4, n = 2; ST6, n = 1; ST46, n = 1; ST105, n = 1; ST122, n = 1) and nine novel STs (nST164, n = 1; nST165, n = 4; nST167, n = 2; nST169, n = 1; nST170, n = 1; nST171, n = 1; nST173, n = 2; nST176, n = 1; and nST180, n = 1). ST4 and ST122 were grouped into CC4. ST46 and nST180 clustered into CC17, and the nST176 belongs to CC62. The nST165 and nST173 clustered together, but differed only in the galP gene allele (a 4-nucleotide divergence), without forming a distinct clonal complex. All the isolates belonging to these STs were obtained from fish in northern Brazil, demonstrating genetic similarity associated with geographical origin. Finally, ST6, ST105, nST164, nST167, nST169, nST170 and nST171 were characterized as singletons (Table 1, Figure 2). The SDI value was 0.953.
The L. petauri strains grouped into nine different STs, including five previously reported STs (ST25, n = 1; ST29, n = 13; ST35, n = 6; ST61, n = 1; ST152, n = 3) and four novel STs (nST172, n = 1; nST175, n = 1; nST177, n = 1; nST181, n = 1). ST29, ST35 and ST152 were grouped into CC29. ST35 was exclusively identified in isolates from fish from the state of Amazonas, and ST152 was found only in Pseudoplatystoma ssp. from Mato Grosso do Sul. ST29, however, was detected in different hosts and across various geographical regions. ST61, nST177 and nST181 clustered with ST27, ST53 and ST47, respectively, but did not form distinct CCs. Finally, ST25, nST172 and nST175 were characterized as singletons (Table 1, Figure 2). The SDI value was 0.726.
Phylogenetic Relatedness Between Fish Isolates
The phylogenetic tree, constructed from concatenated MLST allele sequences of piscine L. formosensis, L. garvieae, and L. petauri, are presented in Figure 3, Figure 4 and Figure 5, respectively.
The L. formosensis strains clustered into five major groups, with the strains reported in this study forming three distinct clusters. These exhibited phylogenetic divergence from isolates obtained from marine fish of the Carangidae family (ST56 and ST115) from Japan and China (Figure 3).
The L. garvieae strains clustered into fourteen groups, demonstrating the high genetic heterogeneity of this species. The Brazilian isolates that were not from tilapia grouped independently or alongside other aquatic animal isolates worldwide within eight of these groups. The LG10-14 (ST105), LG66-22 (ST46) and 31MS (nST180) strains clustered with isolates obtained from disease outbreaks in Nile tilapia in Brazil (Figure 4).
The L. petauri strains clustered into nine distinct phylogenetic groups. The Brazilian isolates that were not from tilapia were distributed among five of these clusters, with the majority (82.1%) forming a single predominant cluster. The analysis revealed genetic divergence between these isolates and those obtained from disease outbreaks in rainbow trout in Europe (ST14), the United States (nST145) and Mexico (nST145). Notably, AM-LG02 and AM-LG03 strains clustered with ST47 and ST24 isolates, respectively, which originated from disease outbreaks in Brazilian tilapia farms (Figure 5).

Discussion

The present study investigated the population structure and genetic profile of a set of LCB strains obtained from different fish species in Brazil, using MLST as the genotyping method. Based on sequences deposited in the PubMLST database for L. garvieae—including the isolates reported in this study—80 STs were assigned to isolates derived from aquatic animals (Figure 2), which include isolates from both clinical disease cases, stool samples and fish meat products. Among these, 18 STs belong to L. formosensis, 29 to L. petauri and 33 to L. garvieae (Table 3), highlighting the genetic heterogeneity among these bacterial species.
When the MLST scheme was first developed by Ferrario et al. [22], all the isolates were believed to belong to L. garvieae, revealing two distinct genetic populations within the analyzed collection of strains. Subsequent studies, using strains from diverse sources (human, animal, food and environmental), identified a wide range of STs, which indicates the genetic heterogeneity of L. garvieae [23,24,34,35]. However, a study conducted in 2017 redefined the L. garvieae subgroup A as a new species, named L. petauri, and suggested the reassignment of previously characterized isolates [46]. Consequently, various studies have been conducted to improve the speciation within the genus Lactococcus [19,37,47]. It was only after 2023 that the first studies using the MLST approach to differentiate genetic profiles among LCB species were published [3,6,25,26], demonstrating high and comparable genetic diversity within each species, based on isolates from both human and animal sources [26]. During this same period, our research team constructed the L. garvieae MLST scheme in the PubMLST database. Since then, we have curated all the newly deposited sequences—including alleles, isolates and genomes—to ensure standardized nomenclature for major STs and CCs, integrating and consolidating data from LCB strains, and providing a comprehensive analysis of their genetic and epidemiological characteristics. Thus, by sequencing the seven housekeeping genes of our isolates and utilizing the PubMLST database (accessed 5 August 2025), it was possible to compare the population structure and phylogenetic relationships of Lactococcus spp. strains obtained from fish in Brazil, with those of other countries.
Our results demonstrate that the LCB isolates from the fish belong to 11 previously established STs (L. formosensis: ST20; L. garvieae: ST4, ST6, ST46, ST105 and ST122; L. petauri: ST25, ST29, ST35, ST61 and ST152). ST4 and ST122 were previously identified in animal-derived products, including fish meat, from China, Italy and Spain [22,26]. Notably, ST4, ST20, ST29 and ST105 have been associated with human diseases in China, Singapore, Spain and the United States [22,23,26,35]. Additional epidemiological findings include: ST6 reported in vegetable isolates from Italy; ST61 detected in water samples from Spain; ST25, ST35 and ST152 identified in human and swine fecal samples from China and Spain [22,23]. Among the previously reported STs, only ST6 and ST46 have been found in diseased fish, in the United States and Brazil, respectively [3,37]. The high values of the SDI show a considerable genetic divergence among the isolates evaluated, with L. formosensis and L. garvieae being a heterogeneous population and L. petauri a more homogeneous population.
It is important to mention that when evaluating the ancestry of the isolates through CC analysis, no cluster comprising three or more STs formed exclusively by isolates from aquatic animals was observed (Figure 2). Our results suggest that, regardless of the bacterial species evaluated, LCBs tend to be adapted to multiple hosts.
L. garvieae CC4, which groups ST4 (LG09-14 and LG63-21 strains) and ST122 (177 strain) identified in this study, appears to be associated with isolates from animal-derived products, particularly samples originating from the European continent [26]. Nonetheless, ST13, which also belongs to this CC, includes isolates from rainbow trout in Italy [22,37]. On the other hand, L. garvieae CC17 appears to harbor more STs (ST16, ST17, ST46, and ST139) associated with clinical manifestations of disease in fish [3,22,23,25]. This corroborates results from our study, as 31MS (nST180) and LG66-22 (ST46) strains, isolated from diseased Pseudoplatystoma fasciatum and Phractocephalus hemioliopterus, respectively, grouped within this CC. A previous study assessed the pathogenicity of the 31MS strain through experimental infection (107 CFU/fish) in Pseudoplatystoma spp. [48]. During the 21-day monitoring period, 10.6% of the animals exhibited clinical signs of diseases; however, no mortality was observed. Conversely, the LG66-22 strain belongs to the same ST identified in disease outbreaks affecting Nile tilapia in Brazil in 2019 and 2021 [3]. Since the pathogenicity of this specific ST has not been evaluated, future laboratory controlled challenges comparing the susceptibility of Nile tilapia and Phractocephalus hemioliopterus is warranted to better understand the pathogenicity of this ST. Finally, L. garvieae CC62 includes isolates from fish in India and Spain (ST62 and nST157) [37], and is grouped with a strain from the current study, LG64-21 (nST176), which was obtained from an ornamental fish species. Although a few LCB isolates from ornamental fish were included in this study, the two L. garvieae strains possess different STs, demonstrating no clear association between STs and host origin or geographical source.
L. formosensis CC5 is also predominantly associated with isolates from animal-derived products, including fish meat from China (ST5 and ST113) [26]. In the current study, we did not identify any isolates belonging to this CC.
L. petauri CC24 comprises isolates associated with diseases in fish (Nile tilapia – ST24; catfish – nST142) and humans (ST24), as well from human (ST24) and swine (ST155) feces [3,23,35,37]. ST24 has been the predominant genetic profile among L. petauri isolates obtained from Nile tilapia in different types of commercial production and different geographic regions in Brazil between 2020 and 2022, and its pathogenicity and high virulence for this aquatic host were confirmed [3]. Interestingly, none of the isolates evaluated in this study shared this ST or belonged to CC24, suggesting that these isolates may have emerged from a distinct ancestor. On the other hand, L. petauri CC29 clustered isolates from diverse sources and was the largest CC identified in this study. CC29 clustered isolates from human feces [22,23], fish (cobia and European seabass) and prawn sashimi, such as ST10, ST128 and ST135 [26,35,37]. A total of 22 out of 28 L. petauri strains from our study belong to this CC, indicating that isolates of this bacterial species tend to have a more homogeneous genetic profile compared to the other two bacterial species investigated. Other studies utilizing different genotyping methods (DNA fingerprinting approaches) also revealed a more homogeneous population for L. petauri strains [19]. Finally, L. petauri CC97 contains isolates linked to diseases in fish (ST98 and nST145) and fish meat (ST137) [26,37]. Among these, nST145 has been associated with major mortality outbreaks in rainbow trout in the United States and Mexico between 2016 and 2020 [9,49]. No isolate from this study grouped within this CC.
Other genetic relationships were also identified via goeBURST analysis. For L. petauri: ST27 (human feces, Spain) and ST61 (LG03-18 strain); ST47 (Nile tilapia, Brazil) and nST181 (14MS strain); ST53 (bovine mastitis, Spain) and nST177 (AM-LG03 strain); ST34 (red tilapia, Singapore) and ST82 (human feces, China). For L. garvieae: nST165 (LG88-23, LG89-23 and PA-LG01 strains) and nST173 (CRBP138 and CRBP144) from Amazonian fish species; ST39 (tilapia, Singapore) and ST50 (bovine mastitis, Spain). And for L. formosensis: ST41 (carp, Singapore) and ST59 (fish, Spain); ST91 (bovine mastitis, China) and ST151 (barramundi, USA) [25,35,37]. Furthermore, our study observed that many isolates were singletons (lacking a common ancestor with other isolates), underscoring the significant genetic heterogeneity of these bacteria. Despite this, there are currently 181 STs deposited in the PubMLST database. In the future, with the addition of more isolates and allelic profiles, new population structure relationships among LCBs may be revealed.
Phylogenetic analysis of the concatenated housekeeping genes was used to reconstruct the evolutionary relationships among the strains of the tested bacterial species. As expected, the analysis enabled the grouping of strains within the same CC. However, it also revealed arrangements that represented double- or triple-locus variants. The analysis revealed that our L. formosensis strains are closely related to others obtained from largemouth bass (nST140 and nST141), barramundi (nST151), and rainbow trout (nST150) in the USA; from a fish with no designated species in Singapore (ST43); and from salmon (ST113) and flounder sashimi (ST5) in China [26,35,37]. The L. garvieae strains are related to those obtained from salmon (ST122) and prawn (ST119) sashimi (China), rainbow trout (ST62, India; ST63, Spain), unspecified fish species (ST157 and ST158, Spain; ST6, USA), tilapia (ST39, Singapore; ST46, Brazil), yellowtail (ST16 and ST17, Japan), and so-iuy mullet (ST17, South Korea). This broad host range demonstrates a lack of host specificity and no clear phylogenetic distinction based on geographic origin. Conversely, the L. petauri strains demonstrated a more intriguing genetic relationship. Most of our isolates (those related to CC29) are genetically linked to other isolates obtained from tilapia (ST34, Singapore), cobia (ST10, Singapore), hybrid catfish (nST142, USA), European seabass (ST128, USA) and prawn sashimi (ST135, China) [26,35,37]. Isolates from clinical cases of piscine lactococcosis in trout were divided into two distinct phylogenetic clades: one associated with ST14, ST57 and nST146, identified primarily in European countries (with a single representative from the USA and Canada), and another clade associated with nST145, which, as previously mentioned, is linked to recent and impactful outbreaks in North America. This division presents a strong geographical signal of diversification among trout isolates. Our isolates are not phylogenetically related to these clades, indicating they evolved from different ancestors. In contrast, two of our L. petauri strains (AM-LG02 and AM-LG03), despite some phylogenetic distance, share a common ancestor with isolates associated with disease outbreaks in Nile tilapia in Brazil. Both isolates were obtained from the intestine of Colossoma macropomum. In an experimental infection study in this same aquatic host, the AM-LG02 strain did not cause any macroscopic or microscopic alterations in the challenged animals [50]. Therefore, future studies should use this and other LCBs isolates in challenge experiments with tilapia to verify their pathogenic potential for this species.
In conclusion, this study provides new insights into the genetic diversity of Brazilian Lactococcus spp. strains isolated from different fish species, using an MLST approach. The analysis revealed that LCB isolates constitute a genetically diverse population based on their STs. Specifically, L. garvieae and L. formosensis exhibited greater heterogeneity compared to L. petauri, for which the majority of isolates belonged to a single clonal complex (CC29). MLST and phylogenetic analysis demonstrated genetic relatedness between the L. garvieae and L. formosensis isolates from this study and those from other aquatic animal species deposited in the PubMLST database. Regarding the L. petauri strains, all the STs identified in this study were unrelated to the MLST lineages responsible for outbreaks in Brazilian Nile tilapia and North American rainbow trout. This suggests that piscine L. petauri populations in the Americas evolved from distinct ancestral origins. However, phylogenetic analysis and MLST data showed that, although they belong to different CC, two isolates from Colossoma macropomum are genetically closely related to isolates from Nile tilapia in Brazil. Therefore, future studies, particularly those employing a whole-genome sequencing approach, are necessary to better elucidate the ancestral relationship between these strains.

Supplementary Materials

The following supporting information can be downloaded at the website of this paper posted on Preprints.org. Table S1: Lactococcus ssp. strains isolated from aquatic animals with publicly available genome sequences in GenBank databases included in this study. Table S2: Lactococcus spp. strains isolated from diverse animal aquatic species with previously reported alleles and sequence type included in this study to phylogenetic analyses.

Author Contributions

GCT, FP, SUG, CAGL and HCPF conceived and designed the experiments. SPC, ACCB, AECdR, HCM, CRMdSM, HLC, RCE performed the microbiological analyses, DNA extraction, and PCR amplification. JCCR conducted the Sanger sequencing. FLP developed the L. garvieae MLST scheme for inclusion in PubMLST database. GCT and LFFN performed analyses and visualization of the data. GCT wrote the manuscript and coordinated all analyses of the project. FLP, FP, ES, CAGL and HCPF contributed substantially to data interpretation and to revisions of the manuscript. All authors read, critically reviewed, and approved the final manuscript.

Institutional Review Board Statement

No ethics was required for any aspect of this study.

Data Availability Statement

The data that support the findings of this study are available on request from the corresponding author.

Acknowledgments

This study was financed in part by the Coordenação de Aperfeiçoamento de Pessoal de Nível Superior – Brasil (CAPES), through the PROCAD/Amazônia (grant number 88881.200614/2018-01) and PDPG-CAPES calls; Fundação de Amparo à Pesquisa do Estado de Minas Gerais (FAPEMIG, grant numbers APQ-01227-22, APQ-04309-22 and PPM-00779-18), and Fundação de Amparo à Pesquisa do Estado do Amazonas (FAPEAM, grant number 01.02.016301.03071/2022-11).

Conflicts of Interest

The authors declare no competing interests.

References

  1. Shahin, K; Abdel-Glil, M; Saticıoğlu, IB; Duman, M; Altun, S; Colussi, S; et al. Diving into the depths: unveiling the main etiologies of piscine lactococcosis with a novel multiplex qPCR assay. J Fish Dis. 2025, e14147. [Google Scholar] [CrossRef]
  2. Rao, S; Pham, TH; Poudyal, S; Cheng, L-W; Nazareth, SC; Wang, P-C; et al. First report on genetic characterization, cell-surface properties and pathogenicity of Lactococcus garvieae, emerging pathogen isolated from cage-cultured cobia (Rachycentron canadum). Transbound Emerg Dis. 2022, 69, 1197–211. [Google Scholar] [CrossRef]
  3. Egger, RC; Rosa, JCC; Resende, LFL; de Pádua, SB; de Oliveira Barbosa, F; Zerbini, MT; et al. Emerging fish pathogens Lactococcus petauri and L. garvieae in Nile tilapia (Oreochromis niloticus) farmed in Brazil. Aquaculture 2023, 565, 739093. [Google Scholar] [CrossRef]
  4. Abraham, T; Yazdi, Z; Littman, E; Shahin, K; Heckman, TI; Quijano Cardé, EM; et al. Detection and virulence of Lactococcus garvieae and L. petauri from four lakes in southern California. J Aquat Anim Health 2023, 35, 187–98. [Google Scholar] [CrossRef] [PubMed]
  5. Salogni, C; Bertasio, C; Accini, A; Gibelli, LR; Pigoli, C; Susini, F; et al. The Characterisation of Lactococcus garvieae isolated in an outbreak of septicaemic disease in farmed sea bass (Dicentrarchus labrax, Linnaues 1758) in Italy. Pathogens 2024, 13. [Google Scholar] [CrossRef]
  6. Salif, M; Ogawa, R; Mikami, A; Daibata, M; Imajoh, M. Complete genome sequence of Lactococcus garvieae isolated from a greater amberjack (Seriola dumerili) farmed in Japan in 2022. Microbiol Resour Announc. 2024, 13, e00436-24. [Google Scholar] [CrossRef]
  7. Balan, R; Pandey, S; Wang, P-C; Byadgi, OV; Chen, S-C. Insights on the virulence and genomic features of Lactococcus garvieae isolated from giant freshwater prawn Macrobrachium rosenbergii (de Man 1879). J Fish Dis. 2024, 47, e14011. [Google Scholar] [CrossRef]
  8. Wongkaew, J; Chatchaiphan, S; Taengphu, S; Dong, HT; Senapin, S; Piyapattanakorn, S. Identification and pathogenicity of Lactococcus species in Nile tilapia (Oreochromis niloticus) and Asian sea bass (Lates calcarifer). J Fish Dis. 2025, 48, e14113. [Google Scholar] [CrossRef] [PubMed]
  9. Shahin, K; Veek, T; Heckman, TI; Littman, E; Mukkatira, K; Adkison, M; et al. Isolation and characterization of Lactococcus garvieae from rainbow trout, Onchorhyncus mykiss, from California, USA. Transbound Emerg Dis. 2022, 69, 2326–43. [Google Scholar] [CrossRef] [PubMed]
  10. Chang, PH; Lin, CW; Lee, YC. Lactococcus garvieae infection of cultured rainbow trout, Oncorhynchus mykiss, in Taiwan and associated biophysical characteristics and histopathology. Bull Eur Assoc Fish Pathol. 2002, 22, 319–27. [Google Scholar]
  11. Kang, SH; Shin, GW; Shin, YS; Palaksha, K. J; Rim, Kim Y; Hee, Yang H; et al. Experimental evaluation of pathogenicity of Lactococcus garvieae in black rockfish (Sebastes schlegeli). J Vet Sci. 2004, 5, 387–90. [Google Scholar] [CrossRef]
  12. Fukuda, Y; Tue, Y; Oinaka, D; Wada, Y; Yamashita, A; Urasaki, S; et al. Pathogenicity and immunogenicity of non-agglutinating Lactococcus garvieae with anti-KG- phenotype rabbit serum in Seriola spp. Fish Pathol 2015, 50, 200–6. [Google Scholar] [CrossRef]
  13. Meyburgh, CM; Bragg, RR; Boucher, CE. Lactococcus garvieae: an emerging bacterial pathogen of fish. Dis Aquat Organ. 2017, 123, 67–79. [Google Scholar] [CrossRef]
  14. Fukushima, HCS; Leal, CAG; Cavalcante, RB; Figueiredo, HCP; Arijo, S; Moriñigo, MA; et al. Lactococcus garvieae outbreaks in Brazilian farms: lactococcosis in Pseudoplatystoma sp. – development of an autogenous vaccine as a control strategy. J Fish Dis. 2017, 40, 263–72. [Google Scholar] [CrossRef]
  15. Pastorino, P; Vela Alonso, AI; Colussi, S; Cavazza, G; Menconi, V; Mugetti, D; et al. A summer mortality outbreak of lactococcosis by Lactococcus garvieae in a raceway system affecting farmed rainbow trout (Oncorhynchus mykiss) and brook trout (Salvelinus fontinalis). Animals 2019, 9. [Google Scholar] [CrossRef] [PubMed]
  16. Choi, HJ; Hur, JW; Cho, JB; Park, KH; Jung, HJ; Kang, YJ. Introduction of bacterial and viral pathogens from imported ornamental finfish in South Korea. Fish Aquat Sci. 2019, 22, 5. [Google Scholar] [CrossRef]
  17. Cardoso, PHM; Moreno, LZ; de Oliveira, CH; Gomes, VTM; Silva, APS; Barbosa, MRF; et al. Main bacterial species causing clinical disease in ornamental freshwater fish in Brazil. Folia Microbiol (Praha) 2021, 66, 231–9. [Google Scholar] [CrossRef] [PubMed]
  18. Neupane, S; Rao, S; Yan, W-X; Wang, P-C; Chen, S-C. First identification, molecular characterization, and pathogenicity assessment of Lactococcus garvieae isolated from cultured pompano in Taiwan. J Fish Dis. 2023, 46, 1295–309. [Google Scholar] [CrossRef] [PubMed]
  19. Barbanti, ACC; do Rosário, AEC; da Silva Maia, CRM; Rocha, VP; Costa, HL; Trindade, JM; et al. Genetic characterization of lactococcosis-causing bacteria isolated from Brazilian native fish species. Aquaculture 2024, 593, 741305. [Google Scholar] [CrossRef]
  20. Bondavalli, F; Colussi, S; Pastorino, P; Zanoli, A; Bezzo Llufrio, T; Fernández-Garayzábal, JF; et al. First report of Lactococcus petauri in the pumpkinseed (Lepomis gibbosus) from Candia lake (Northwestern Italy). Fishes 2024, 9. [Google Scholar] [CrossRef]
  21. Esposito, G; Bignami, G; Colussi, S; Pastorino, P; Bondavalli, F; Fioravanti, M; et al. Expanding horizons: the first reported outbreak of piscine lactococcosis in farmed gilthead seabream Sparus aurata in the Northern Tyrrhenian sea. J Fish Dis. 2025, 48, e14121. [Google Scholar] [CrossRef] [PubMed]
  22. Ferrario, C; Ricci, G; Milani, C; Lugli, GA; Ventura, M; Eraclio, G; et al. Lactococcus garvieae: where is it from? A first approach to explore the evolutionary history of this emerging pathogen. PLoS One 2013, 8, e84796. [Google Scholar] [CrossRef]
  23. Reguera-Brito, M; Galán-Sánchez, F; Blanco, MM; Rodríguez-Iglesias, M; Domínguez, L; Fernández-Garayzábal, JF; et al. Genetic analysis of human clinical isolates of Lactococcus garvieae: relatedness with isolates from foods. Infect Genet Evol. 2016, 37, 185–91. [Google Scholar] [CrossRef]
  24. Thiry, D; Billen, F; Boyen, F; Duprez, J-N; Quenault, H; Touzain, F; et al. Genomic relatedness of a canine Lactococcus garvieae to human, animal and environmental isolates. Res Vet Sci. 2021, 137, 170–3. [Google Scholar] [CrossRef] [PubMed]
  25. Lin, Y; Han, J; Barkema, HW; Wang, Y; Gao, J; Kastelic, JP; et al. Comparative genomic analyses of Lactococcus garvieae isolated from bovine mastitis in China. Microbiol Spectr. 2023, 11, e02995-22. [Google Scholar] [CrossRef]
  26. Chan, Y-X; Cao, H; Jiang, S; Li, X; Fung, K-K; Lee, C-H; et al. Genomic investigation of Lactococcus formosensis, Lactococcus garvieae, and Lactococcus petauri reveals differences in species distribution by human and animal sources. Microbiol Spectr. 2024, 12, e00541-24. [Google Scholar] [CrossRef] [PubMed]
  27. Eldar, A; Goria, M; Ghittino, C; Zlotkin, A; Bercovier, Herve. Biodiversity of Lactococcus garvieae strains isolated from fish in Europe, Asia, and Australia. Appl Environ Microbiol. 1999, 65, 1005–8. [Google Scholar] [CrossRef]
  28. Ferrario, C; Ricci, G; Borgo, F; Rollando, A; Fortina, MG. Genetic investigation within Lactococcus garvieae revealed two genomic lineages. FEMS Microbiol Lett. 2012, 332, 153–61. [Google Scholar] [CrossRef]
  29. Rao, S; Chen, M-Y; Sudpraseart, C; Lin, P; Yoshida, T; Wang, P-C; et al. Genotyping and phenotyping of Lactococcus garvieae isolates from fish by pulse-field gel electrophoresis (PFGE) and electron microscopy indicate geographical and capsular variations. J Fish Dis. 2022, 45, 771–81. [Google Scholar] [CrossRef]
  30. Evans, JJ; Bohnsack, JF; Klesius, PH; Whiting, A a; Garcia, JC; Shoemaker, C a; et al. Phylogenetic relationships among Streptococcus agalactiae isolated from piscine, dolphin, bovine and human sources: a dolphin and piscine lineage associated with a fish epidemic in Kuwait is also associated with human neonatal infections in Japan. J Med Microbiol. 2008, 57 Pt 11, 1369–76. [Google Scholar] [CrossRef]
  31. Barony, GM; Tavares, GC; Pereira, FL; Carvalho, AF; Dorella, FA; Leal, CAG; et al. Large-scale genomic analyses reveal the population structure and evolutionary trends of Streptococcus agalactiae strains in Brazilian fish farms. Sci Rep. 2017, 7, 13538. [Google Scholar] [CrossRef]
  32. Maiden, MCJ; van Rensburg, MJJ; Bray, JE; Earle, SG; Ford, SA; Jolley, KA; et al. MLST revisited: the gene-by-gene approach to bacterial genomics. Nat Rev Microbiol. 2013, 11, 728–36. [Google Scholar] [CrossRef] [PubMed]
  33. Jolley, KA; Bray, JE; Maiden, MCJ. Open-access bacterial population genomics: BIGSdb software, the PubMLST.org website and their applications. Wellcome Open Res. 2018, 3, 1–20. [Google Scholar] [CrossRef]
  34. Kozakai, M; Matsumoto, C; Matsumoto, M; Takakura, A; Matsubayashi, K; Satake, M. Different growth kinetics in blood components and genetic analysis of Lactococcus garvieae isolated from platelet concentrates. Transfusion 2020, 60, 1492–9. [Google Scholar] [CrossRef] [PubMed]
  35. Lin, YS; Kweh, KH; Koh, TH; Lau, QC; Abdul Rahman, NB. Genomic analysis of Lactococcus garvieae isolates. Pathology 2020, 52, 700–7. [Google Scholar] [CrossRef] [PubMed]
  36. Mahmoud, MM; Abdelsalam, M; Kawato, S; Harakawa, S; Kawakami, H; Hirono, I; et al. Comparative genome analyses of three serotypes of Lactococcus bacteria isolated from diseased cultured striped jack (Pseudocaranx dentex). J Fish Dis. 2023, 46, 829–39. [Google Scholar] [CrossRef]
  37. Heckman, TI; Yazdi, Z; Older, CE; Griffin, MJ; Waldbieser, GC; Chow, AM; et al. Redefining piscine lactococcosis. Appl Environ Microbiol 2024, 0, e02349-23. [Google Scholar] [CrossRef]
  38. Feil, EJ; Li, BC; Aanensen, DM; Hanage, WP; Spratt, Brian G. eBURST: Inferring patterns of evolutionary descent among clusters of related bacterial genotypes from multilocus sequence typing data. J Bacteriol. 2004, 186, 1518–30. [Google Scholar] [CrossRef]
  39. Francisco, AP; Bugalho, M; Ramirez, M; Carriço, JA. Global optimal eBURST analysis of multilocus typing data using a graphic matroid approach. BMC Bioinformatics 2009, 10, 152. [Google Scholar] [CrossRef]
  40. Nascimento, M; Sousa, A; Ramirez, M; Francisco, AP; Carriço, JA; Vaz, C. PHYLOViZ 2.0: providing scalable data integration and visualization for multiple phylogenetic inference methods. Bioinformatics 2017, 33, 128–9. [Google Scholar] [CrossRef]
  41. Hunter, PR; Gaston, MA. Numerical index of the discriminatory ability of typing systems: an application of Simpson’s index of diversity. J Clin Microbiol. 1988, 26, 2465–6. [Google Scholar] [CrossRef]
  42. Pinto, FR; Melo-Cristino, J; Ramirez, M. A confidence interval for the Wallace coefficient of concordance and its application to microbial typing methods. PLoS One 2008, 3, e3696. [Google Scholar] [CrossRef] [PubMed]
  43. Kumar, S; Stecher, G; Suleski, M; Sanderford, M; Sharma, S; Tamura, K. MEGA12: Molecular evolutionary genetic analysis version 12 for adaptive and green computing. Mol Biol Evol. 2024, 41, msae263. [Google Scholar] [CrossRef]
  44. Tamura, K; Stecher, G; Kumar, S. MEGA11: Molecular evolutionary genetics analysis version 11. Mol Biol Evol. 2021, 38, 3022–7. [Google Scholar] [CrossRef] [PubMed]
  45. Letunic, I; Bork, P. Interactive Tree of Life (iTOL) v6: recent updates to the phylogenetic tree display and annotation tool. Nucleic Acids Res. 2024, 52, W78–82. [Google Scholar] [CrossRef]
  46. Goodman, LB; Lawton, MR; Franklin-Guild, RJ; Anderson, RR; Schaan, L; Thachil, AJ; et al. Lactococcus petauri sp. nov., isolated from an abscess of a sugar glider. Int J Syst Evol Microbiol. 2017, 67, 4397–404. [Google Scholar] [CrossRef] [PubMed]
  47. Vela, AI; del Mar Blanco, M; Colussi, S; Kotzamanidis, C; Prearo, M; Altinok, I; et al. The association of Lactococcus petauri with lactococcosis is older than expected. Aquaculture 2024, 578, 740057. [Google Scholar] [CrossRef]
  48. Rodrigues, RA; do Nascimento Silva, AL; Siqueira, MS; Pilarski, F; Leal, CRB; Kuibida, KV; et al. Hematological, biochemical, and histopathological responses in sorubim Pseudoplatystoma spp. experimentally infected with Lactococcus garvieae. Aquac Int. 2020, 28, 1907–23. [Google Scholar] [CrossRef]
  49. Ortega, C; Irgang, R; Valladares-Carranza, B; Collarte, C; Avendaño-Herrera, R. First identification and characterization of Lactococcus garvieae isolated from rainbow trout (Oncorhynchus mykiss) cultured in Mexico. Animals 2020, 10. [Google Scholar] [CrossRef]
  50. Rosário, AEC; Reis, FYT; Barbanti, ACC; da Costa, ÉJC; da Silva Maia, CRM; Kotzent, S; et al. Susceptibility and clinicopathological findings of three Amazonian fishes experimentally infected with. Lactococcus spp. Preprints 2025. [Google Scholar] [CrossRef]
Preprints 198074 g001
Figure 1. Map of the distribution of L. formosensis (A), L. garvieae (B) and L. petauri (C) sequence types (ST) identified in this study according to Brazilian state. Different colors represent the different STs and symbol sizes are proportional to the number of isolates per ST. Lactococcus garvieae ST46, L. petauri ST24 and ST47 Nile tilapia-derived isolates were added to demonstrate Brazilian genetic diversity.
Figure 1. Map of the distribution of L. formosensis (A), L. garvieae (B) and L. petauri (C) sequence types (ST) identified in this study according to Brazilian state. Different colors represent the different STs and symbol sizes are proportional to the number of isolates per ST. Lactococcus garvieae ST46, L. petauri ST24 and ST47 Nile tilapia-derived isolates were added to demonstrate Brazilian genetic diversity.
Preprints 198074 g001
Preprints 198074 g002
Figure 2. Global optimal eBURST analysis of all sequence types (ST) available to date in the Lactococcus garvieae typing scheme in the PubMLST database. Each circle represents an ST. Blue circles represent ST isolated from fish or prawns, black circles represent ST observed in this study, and black lines represent single-locus variants. STs highlighted in dashed lines form a clonal complex.
Figure 2. Global optimal eBURST analysis of all sequence types (ST) available to date in the Lactococcus garvieae typing scheme in the PubMLST database. Each circle represents an ST. Blue circles represent ST isolated from fish or prawns, black circles represent ST observed in this study, and black lines represent single-locus variants. STs highlighted in dashed lines form a clonal complex.
Preprints 198074 g002
Preprints 198074 g003
Figure 3. Phylogenetic tree of Lactococcus formosensis strains. The unrooted phylogenetic tree was constructed using the neighbor-joining method with the Tamura-Nei model from the 5,713 bp concatenated DNA sequences of the seven loci (als, atpA, tuf, gapC, gyrB, rpoC and galP) and a bootstrap analysis of 1,000 replicates to determine the evolutionary relationships among L. formosensis strains obtained from aquatic animals. The isolate’s name in red denotes strains from this study. The colors of the circles and diamonds indicate the isolate’s country of origin and host origin, respectively.
Figure 3. Phylogenetic tree of Lactococcus formosensis strains. The unrooted phylogenetic tree was constructed using the neighbor-joining method with the Tamura-Nei model from the 5,713 bp concatenated DNA sequences of the seven loci (als, atpA, tuf, gapC, gyrB, rpoC and galP) and a bootstrap analysis of 1,000 replicates to determine the evolutionary relationships among L. formosensis strains obtained from aquatic animals. The isolate’s name in red denotes strains from this study. The colors of the circles and diamonds indicate the isolate’s country of origin and host origin, respectively.
Preprints 198074 g003
Preprints 198074 g004
Figure 4. Phylogenetic tree of Lactococcus garvieae strains. The unrooted phylogenetic tree was constructed using the neighbor-joining method with the Tamura-Nei model from the 5,713 bp concatenated DNA sequences of the seven loci (als, atpA, tuf, gapC, gyrB, rpoC and galP) and a bootstrap analysis of 1,000 replicates to determine the evolutionary relationships among L. garvieae strains obtained from aquatic animals. The isolate’s name in red denotes strains from this study. The colors of the circles and diamonds indicate the isolate’s country of origin and host origin, respectively.
Figure 4. Phylogenetic tree of Lactococcus garvieae strains. The unrooted phylogenetic tree was constructed using the neighbor-joining method with the Tamura-Nei model from the 5,713 bp concatenated DNA sequences of the seven loci (als, atpA, tuf, gapC, gyrB, rpoC and galP) and a bootstrap analysis of 1,000 replicates to determine the evolutionary relationships among L. garvieae strains obtained from aquatic animals. The isolate’s name in red denotes strains from this study. The colors of the circles and diamonds indicate the isolate’s country of origin and host origin, respectively.
Preprints 198074 g004
Preprints 198074 g005
Figure 5. Phylogenetic tree of Lactococcus petauri strains. The unrooted phylogenetic tree was constructed using the neighbor-joining method with the Tamura-Nei model from the 5,713 bp concatenated DNA sequences of the seven loci (als, atpA, tuf, gapC, gyrB, rpoC, and galP) and a bootstrap analysis of 1,000 replicates to determine the evolutionary relationships among L. petauri strains obtained from aquatic animals. The isolate’s name in red denotes strains from this study. The colors of the circles and diamonds indicate the isolate’s country of origin and host origin, respectively.
Figure 5. Phylogenetic tree of Lactococcus petauri strains. The unrooted phylogenetic tree was constructed using the neighbor-joining method with the Tamura-Nei model from the 5,713 bp concatenated DNA sequences of the seven loci (als, atpA, tuf, gapC, gyrB, rpoC, and galP) and a bootstrap analysis of 1,000 replicates to determine the evolutionary relationships among L. petauri strains obtained from aquatic animals. The isolate’s name in red denotes strains from this study. The colors of the circles and diamonds indicate the isolate’s country of origin and host origin, respectively.
Preprints 198074 g005
Table 1. Characteristics and allelic profiles of the Brazilian Lactococcus spp. isolates analyzed in this study.
Table 1. Characteristics and allelic profiles of the Brazilian Lactococcus spp. isolates analyzed in this study.
Isolate Species Origin Year Host MLST
Allele ST CC
als atpA tuf gapC gyrB rpoC galP
167/23-02 L. formosensis BA 2023 Arapaima gigas 22 62 18 3 20 4 78 n168 Singleton
167/23-06 L. formosensis BA 2023 Arapaima gigas 15 10 14 9 13 15 15 20 Singleton
167/23-09 L. formosensis BA 2023 Arapaima gigas 22 62 18 3 20 4 78 n168 Singleton
49/21-29 L. formosensis SP 2021 Pangasianodon hypophthalmus 100 4 18 3 20 4 79 n174 Singleton
52MS L. formosensis MS 2012 Pseudoplatystoma fasciatum 91 60 14 9 20 33 81 n179 Singleton
AM-LG05 L. formosensis AM 2022 Colossoma macropomum 90 35 14 9 20 38 81 n178 Singleton
LG91-23 L. formosensis MG 2023 Pseudoplatystoma sp. 92 4 50 3 20 4 73 n166 Singleton
177 L. garvieae MS 2012 Pseudoplatystoma fasciatum 3 3 4 2 59 3 3 122 CC4
31MS L. garvieae MS 2012 Pseudoplatystoma fasciatum 12 8 54 7 27 13 12 n180 CC17
49/21-11 L. garvieae SP 2021 Pangasianodon hypophthalmus 5 5 6 2 5 5 5 6 Singleton
CRBP53 L. garvieae AM 2023 Arapaima gigas 93 61 51 15 72 61 74 n167 Singleton
CRBP54 L. garvieae AM 2023 Arapaima gigas 93 61 51 15 72 61 74 n167 Singleton
CRBP138 L. garvieae AM 2023 Arapaima gigas 34 59 27 15 28 19 29 n173 -
CRBP144 L. garvieae AM 2023 Arapaima gigas 34 59 27 15 28 19 29 n173 -
LG09-14 L. garvieae SP 2014 Pseudoplatystoma corruscans 3 3 4 2 3 3 3 4 CC4
LG10-14 L. garvieae MG 2014 Lophiosilurus alexandri 60 8 6 7 10 45 48 105 Singleton
LG23-16 L. garvieae SP 2016 Pseudoplatystoma corruscans 88 22 46 25 71 20 71 n164 Singleton
LG63-21 L. garvieae MG 2021 Hoplias macrophtalmus 3 3 4 2 3 3 3 4 CC4
LG64-21 L. garvieae MG 2021 Xiphophorus maculatus 87 24 27 15 28 27 29 n176 nCC62
LG66-22 L. garvieae MG 2022 Phractocephalus hemioliopterus 12 8 6 7 27 13 12 46 CC17
LG88-23 L. garvieae MG 2023 Brycon amazonicus 34 59 27 15 28 19 72 n165 -
LG89-23 L. garvieae MG 2023 Brycon amazonicus 34 59 27 15 28 19 72 n165 -
LG114-23 L. garvieae AM 2023 Hoplias malabaricus 34 59 27 15 28 19 72 n165 -
LG115-23 L. garvieae MG 2023 Trichogaster lalius 21 13 1 2 73 16 75 n169 Singleton
LG116-23 L. garvieae MG 2023 Cichla sp. 94 3 52 2 73 62 76 n170 Singleton
LG119-24 L. garvieae MG 2024 Pseudoplatystoma sp. 95 69 6 2 5 63 77 n171 Singleton
PA-LG01 L. garvieae PA 2018 Arapaima gigas 34 59 27 15 28 19 72 n165 -
86 L. petauri MS 2012 Pseudoplatystoma sp. 9 7 3 2 37 9 9 152 nCC29
93 L. petauri MS 2012 Pseudoplatystoma sp. 9 7 3 2 37 9 9 152 nCC29
176 L. petauri MS 2012 Pseudoplatystoma fasciatum 9 7 3 4 16 9 17 25 Singleton
14MS L. petauri MS 2012 Pseudoplatystoma fasciatum 32 21 7 2 7 11 6 n181 -
167/23-03 L. petauri BA 2023 Arapaima gigas 94 6 7 2 7 11 82 n172 Singleton
167/23-04 L. petauri BA 2023 Arapaima gigas 9 7 3 4 18 9 9 29 nCC29
167/23-05 L. petauri BA 2023 Arapaima gigas 9 7 3 4 18 9 9 29 nCC29
167/23-07 L. petauri BA 2023 Arapaima gigas 9 7 3 4 18 9 9 29 nCC29
167/23-08 L. petauri BA 2023 Arapaima gigas 9 7 3 4 18 9 9 29 nCC29
167/23-10 L. petauri BA 2023 Arapaima gigas 9 7 3 4 18 9 9 29 nCC29
49/21-21 L. petauri SP 2021 Pangasianodon hypophthalmus 9 7 3 4 18 9 9 29 nCC29
89/2 L. petauri MS 2012 Pseudoplatystoma sp. 9 7 3 2 37 9 9 152 nCC29
AM-LG02 L. petauri AM 2020 Colossoma macropomum 61 6 7 35 7 11 8 n175 Singleton
AM-LG03 L. petauri AM 2022 Colossoma macropomum 89 20 26 2 24 25 6 n177 -
AM-LG06 L. petauri AM 2022 Pterophyllum scalare 9 7 3 2 7 9 9 35 nCC29
AM-LG07 L. petauri AM 2022 Brycon amazonicus 9 7 3 2 7 9 9 35 nCC29
AM-LG08 L. petauri AM 2022 Brycon amazonicus 9 7 3 2 7 9 9 35 nCC29
CRBP89 L. petauri AM 2023 Arapaima gigas 9 7 3 2 7 9 9 35 nCC29
CRBP98 L. petauri AM 2023 Arapaima gigas 9 7 3 2 7 9 9 35 nCC29
CRBP146 L. petauri AM 2023 Arapaima gigas 9 7 3 2 7 9 9 35 nCC29
LG03-18 L. petauri MG 2018 Pseudoplatystoma corruscans 33 6 10 2 7 11 8 61 -
LG86-23 L. petauri MG 2023 Pseudoplatystoma sp. 9 7 3 4 18 9 9 29 nCC29
LG94-23 L. petauri MG 2023 Pseudoplatystoma sp. 9 7 3 4 18 9 9 29 nCC29
LG104-23 L. petauri MG 2023 Pseudoplatystoma sp. 9 7 3 4 18 9 9 29 nCC29
LG106-23 L. petauri MG 2023 Pseudoplatystoma sp. 9 7 3 4 18 9 9 29 nCC29
LG117-23 L. petauri MG 2023 Pseudoplatystoma sp. 9 7 3 4 18 9 9 29 nCC29
LG120-24 L. petauri MG 2024 Carassius auratus 9 7 3 4 18 9 9 29 nCC29
LG121-24 L. petauri MG 2024 Carassius auratus 9 7 3 4 18 9 9 29 nCC29
Table 2. Oligonucleotide primers used in the MLST assay for Lactococcus spp. strains and polymorphism observed for each gene.
Table 2. Oligonucleotide primers used in the MLST assay for Lactococcus spp. strains and polymorphism observed for each gene.
Gene Primer pairs (5’-3’) Annealing temperature (ºC) Size (bp) Nº of alleles Nº of polymorphic sites
als F: ATTCGGCTCAGACTTAGTTG
R: TTCAGCTGCTTCAACATCAA		 58 811 22 85
atpA F: TAYRTYGGKGAYGGDATYGC
R: CCRCGRTTHARYTTHGCYTG		 56 803 18 51
tuf F: ATATGCGGCCGCCATYGGHCACGTBGACCA
R: AAAATATGCGGCCGCTCNCCNGGCATNACCAT		 56 809 15 30
gapC F: AAGTTGGTATTAACGGTTTCG
R: AAGTGTACGAACGAGGTTAG		 56 821 8 9
gyrB F: CATGCTGGTGGTAAATTTGG
R: GTCATCCATTTCTCCTAAACC		 58 827 16 111
rpoC F: TTGGTCCACAAAAGGACTGG
R: TCACGTCCTTTTGCTTCCAT		 58 830 18 58
galP F: TGGGGAAAATTTAAACCTTGG
R: ATCATCAGAACGGCTGGAAG		 58 812 21 107
Table 3. Number of aquatic animal-derived sequence types identified in this and previous studies, categorized by bacterial species.
Table 3. Number of aquatic animal-derived sequence types identified in this and previous studies, categorized by bacterial species.
Bacterial species ST in aquatic animals/ST totala STs identified in this study STs identified in other studies
L. formosensis 18/39 ST20, nST166, nST168, nST174. nST178, nST179 ST5, ST41, ST43, ST56, ST59, ST113, ST114, ST115, nST140, nST141, nST150, nST151
L. garvieae 33/55 ST4, ST6, ST46, ST105, ST122, nST164, nST165, nST167, nST169, nST170, nST171, nST173, nST176, nST180 ST1, ST13, ST16, ST17, ST39, ST62, ST63, ST95, ST109, ST119, ST120, ST121, ST123, ST124, ST139, nST144, nST147, nST157, nST158
L. petauri 29/85 ST25, ST29, ST35, ST61, ST152, nST172, nST175, nST177, nST181 ST10, ST14, ST15, ST24, ST34, ST47, ST57, ST98, ST128, ST132, ST133, ST134, ST135, ST136, ST137, ST138, nST142, nST145, nST146, nST149
Lactococcus ssp.b 0/2 - -
Total 80/181 29/181 51/181
a Proportion of sequence types identified from aquatic animal isolates relative to the total number of STs deposited in PubMLST. b Strains currently classified as Lactococcus garvieae in PubMLST database but shown by genomic analysis to represent a distinct, yet taxonomically uncharacterized Lactococcus species [37].
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.
Copyright: This open access article is published under a Creative Commons CC BY 4.0 license, which permit the free download, distribution, and reuse, provided that the author and preprint are cited in any reuse.
Prerpints.org logo

Preprints.org is a free preprint server supported by MDPI in Basel, Switzerland.

facebook logotwitter logolinkedin logo
bsky
MDPI Initiatives
Important Links
Subscribe

Disclaimer

Terms of Use

Privacy Policy

Privacy Settings

© 2026 MDPI (Basel, Switzerland) unless otherwise stated