Submitted:
28 January 2026
Posted:
29 January 2026
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Results
2.1. Lactobacillus Acidophilus Isolated from the Ileum of Free-Living Rats Releases MVs
2.2. Antimicrobial Effect of L. acidophilus MVs is Higher than Their Whole Cells (W.C) Against Escherichia coli
2.3. Administration of W.C and MVs of L. Acidophilus Triggers Activation of RAW 264.7cells
2.4. RAW 264.7 Cells Stimulated with W.C or MVs of L. acidophilus Showed Differences in Cytokine Expression
2.4. E. coli Challenge Enhances the Immunological Profile of Macrophages Stimulated with MVs
3. Discussion
4. Materials and Methods
4.1. Bacterial Strains
4.2. Isolation and Quantification of L. acidophilus MVs
4.3. Transmission Electron Microscopy (TEM) of MVs
4.4. Antimicrobial Inhibition Assays of MVs or W.C from L. acidophilus on Enteropathogenic Bacterial Cultures
4.5. Stimulation of RAW 264.7 Cells with L. acidophilus MVs and Challenge with E. coli
4.6. qPCR Quantification of IL-1β, TNFα, IL-10, IL-12, and TLR2 in RAW 264.7 Cells Stimulated with MVs of L. acidophilus and Challenged with E.coli
4.7. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| ANOVA | Analysis of variance |
| APCs | Antigen-Presenting Cells |
| BSA | Bovine serum albumin |
| cDNA | Complementary DNA |
| CFS | Cell-free supernatant |
| DMEM | Dulbecco’s Modified Eagle Medium |
| HPRT | Hypoxanthine-Guanine Phosphoribosyltransferase |
| IL-1β | Interleukin 1 beta |
| IL-4 | Interleukin 4 |
| IL-6 | Interleukin 6 |
| IL-10 | Interleukin 10 |
| IL-12 | Interleukin 12 |
| LAB | Lactic Acid Bacteria |
| LPS | Lipopolysaccharide |
| MRS | Man–Rogosa–Sharpe medium |
| MVs | Membrane vesicles |
| NOD2 | Nucleotide-binding oligomerization domain-containing protein 2 |
| OH | Hydroxyl radical |
| PBS | Phosphate-buffered saline |
| PGRPs | Peptidoglycan recognition proteins |
| PRRs | Pattern recognition receptors |
| qPCR | Quantitative Polymerase Chain Reaction |
| RNA | Ribonucleic Acid |
| SIM | Sulfide, Indole, Motility medium |
| TEM | Transmission electron microscopy |
| TLR2 | Toll-like receptor 2 |
| TLR3 | Toll-like receptor 3 |
| TLR7 | Toll-like receptor 7 |
| TLR9 | Toll-like receptor 9 |
| TNF-α | Tumor Necrosis Factor Alpha |
| W. C | Whole cells |
References
- Bron, P.A.; Kleerebezem, M.; Brummer, R.-J.; Cani, P.D.; Mercenier, A.; MacDonald, T.T.; Garcia-Ródenas, C.L.; Wells, J.M. Can probiotics modulate human disease by impacting intestinal barrier function?. Br. J. Nutr. 2017, 117, 93–107. [CrossRef]
- Lebeer, S.; Vanderleyden, J.; De Keersmaecker, S.C.J. Host interactions of probiotic bacterial surface molecules: comparison with commensals and pathogens. Nat. Rev. Microbiol. 2010, 8, 171–184. [CrossRef]
- Akira, S.; Uematsu, S.; Takeuchi, O. Pathogen recognition and innate immunity. Cell 2006, 124, 783–801. [CrossRef]
- Medzhitov, R., Toll-like receptors and innate immunity. Nat Rev Immunol, 2001. 1(2): p. 135-45.
- Mosser, D.M.; Edwards, J.P. Exploring the full spectrum of macrophage activation. Nat. Rev. Immunol. 2008, 8, 958–969. [CrossRef]
- Brown, L.; Wolf, J.M.; Prados-Rosales, R.; Casadevall, A. Through the wall: extracellular vesicles in Gram-positive bacteria, mycobacteria and fungi. Nat. Rev. Microbiol. 2015, 13, 620–630. [CrossRef]
- Kim, J.H.; Lee, J.; Park, J.; Gho, Y.S. Gram-negative and Gram-positive bacterial extracellular vesicles. Semin. Cell Dev. Biol. 2015, 40, 97–104. [CrossRef]
- Kaparakis-Liaskos, M.; Ferrero, R.L. Immune modulation by bacterial outer membrane vesicles. Nat. Rev. Immunol. 2015, 15, 375–387. [CrossRef]
- Marco, M.L.; Heeney, D.; Binda, S.; Cifelli, C.J.; Cotter, P.D.; Foligné, B.; Gänzle, M.; Kort, R.; Pasin, G.; Pihlanto, A.; et al. Health benefits of fermented foods: microbiota and beyond. Curr. Opin. Biotechnol. 2017, 44, 94–102. [CrossRef]
- Mohamadzadeh, M.; Olson, S.; Kalina, W.V.; Ruthel, G.; Demmin, G.L.; Warfield, K.L.; Bavari, S.; Klaenhammer, T.R. Lactobacilli activate human dendritic cells that skew T cells toward T helper 1 polarization. Proc. Natl. Acad. Sci. 2005, 102, 2880–2885. [CrossRef]
- Shen, Y.; Torchia, M.L.G.; Lawson, G.W.; Karp, C.L.; Ashwell, J.D.; Mazmanian, S.K. Outer Membrane Vesicles of a Human Commensal Mediate Immune Regulation and Disease Protection. Cell Host Microbe 2012, 12, 509–520. [CrossRef]
- Pérez-Martínez, P.I.; Gutiérrez-Espinosa, V.; Ávalos-Gómez, C.; De la Garza-Amaya, M.; Vargas-Ruíz, A.; Higuera-Piedrahita, R.I.; Marín-Flamand, E.; Lonngi-Sosa, C.D.; González-Díaz, F.R.; Ramírez-Álvarez, H.; et al. Evaluation of the Immunostimulant Effect of Microvesicles of Lactobacillus acidophilus Isolated from Wild Rats. Microorganisms 2025, 13, 1341. [CrossRef]
- Olovo, C.V.; Ji, Y.; Ocansey, D.K.W.; Huang, X.; Xu, M. Lactobacillus helveticus R0052-derived membrane vesicles ameliorate DSS-induced inflammatory bowel disease by modulating the gut microbiota and activating the cholinergic anti-inflammatory pathway. Int. Immunopharmacol. 2026, 171, 116058. [CrossRef]
- Hu, R.; Lin, H.; Li, J.; Zhao, Y.; Wang, M.; Sun, X.; Min, Y.; Gao, Y.; Yang, M. Probiotic Escherichia coli Nissle 1917-derived outer membrane vesicles enhance immunomodulation and antimicrobial activity in RAW264.7 macrophages. BMC Microbiol. 2020, 20, 1–13. [CrossRef]
- Deng, Z.; Hou, K.; Zhao, J.; Wang, H. The Probiotic Properties of Lactic Acid Bacteria and Their Applications in Animal Husbandry. Curr. Microbiol. 2021, 79, 1–11. [CrossRef]
- González-Lozano, E.; García-García, J.; Gálvez, J.; Hidalgo-García, L.; Rodríguez-Nogales, A.; Rodríguez-Cabezas, M.E.; Sánchez, M. Novel Horizons in Postbiotics: Lactobacillaceae Extracellular Vesicles and Their Applications in Health and Disease. Nutrients 2022, 14, 5296. [CrossRef]
- García, J.P.; Hoyos, J.A.; Alzate, J.A.; Cristancho, E. Bacteremia after Bacillus clausii administration for the treatment of acute diarrhea: A case report. Veter- Parasitol. Reg. Stud. Rep. 2021, 41, 13–20. [CrossRef]
- Toyofuku, M.; Nomura, N.; Eberl, L. Types and origins of bacterial membrane vesicles. Nat. Rev. Microbiol. 2019, 17, 13–24. [CrossRef]
- Sosa, C.D.L.; Díaz, F.R.G.; Álvarez, H.R.; Ruíz, A.V.; Hernández, J.L.M.; Piedrahita, R.I.H.; Cruz, H.A.d.l.C.; Hernández, M.L.; Ramírez-Rico, G.; Ordaz, J.A.C.; et al. Lactiplantibacillus plantarum Membrane Vesicles (MVs) exhibit immunomodulatory and bactericidal effects against Escherichia coli and Salmonella Typhimurium. PLOS ONE 2026, 21, e0332017. [CrossRef]
- Dean, S.N.; Leary, D.H.; Sullivan, C.J.; Oh, E.; Walper, S.A. Isolation and characterization of Lactobacillus-derived membrane vesicles. Sci. Rep. 2019, 9, 1–11. [CrossRef]
- Lee, B.-H.; Wu, S.-C.; Shen, T.-L.; Hsu, Y.-Y.; Chen, C.-H.; Hsu, W.-H. The applications of Lactobacillus plantarum-derived extracellular vesicles as a novel natural antibacterial agent for improving quality and safety in tuna fish. Food Chem. 2021, 340, 128104. [CrossRef]
- Yadav, P.; Debnath, N.; Mehta, P.K.; Kumar, A.; Yadav, A.K. Assessment of Antimicrobial Potential of Lactiplantibacillus plantarum and Their Derived Extracellular Vesicles. Mol. Nutr. Food Res. 2025, 69. [CrossRef]
- Yubo, Z., et al., Discovery of a novel antibacterial protein from Lactobacillus acidophilus using integrated genomic mining, molecular dynamics, and functional assays. Food Bioscience, 2025. 73.
- Toyofuku, M.; Schild, S.; Kaparakis-Liaskos, M.; Eberl, L. Composition and functions of bacterial membrane vesicles. Nat. Rev. Microbiol. 2023, 21, 415–430. [CrossRef]
- Briaud, P.; Carroll, R.K. Extracellular Vesicle Biogenesis and Functions in Gram-Positive Bacteria. Infect. Immun. 2020, 88. [CrossRef]
- Sandanusova, M.; Turkova, K.; Pechackova, E.; Kotoucek, J.; Roudnicky, P.; Sindelar, M.; Kubala, L.; Ambrozova, G. Growth Phase Matters: Boosting immunity via Lacticasebacillus-derived membrane vesicles and their interactions with TLR2 pathways. J. Extracell. Biol. 2024, 3, e169. [CrossRef]
- Orench-Rivera, N.; Kuehn, M.J. Environmentally controlled bacterial vesicle-mediated export. Cell. Microbiol. 2016, 18, 1525–1536. [CrossRef]
- Huang, F.; Teng, K.; Liu, Y.; Cao, Y.; Wang, T.; Ma, C.; Zhang, J.; Zhong, J. Bacteriocins: Potential for Human Health. Oxidative Med. Cell. Longev. 2021, 2021. [CrossRef]
- Chiba, M.; Miri, S.; Yousuf, B.; Esmail, G.A.; Leao, L.; Li, Y.; Hincke, M.; Minic, Z.; Mottawea, W.; Hammami, R. Dual bacteriocin and extracellular vesicle-mediated inhibition of Campylobacter jejuni by the potential probiotic candidate Ligilactobacillus salivarius UO.C249. Appl. Environ. Microbiol. 2024, 90, e0084524. [CrossRef]
- Xiaoyan, X.; Hongxia, S.; Jiamin, G.; Huicheng, C.; Ye, L.; Qiang, X. Antimicrobial peptide HI-3 from Hermetia illucens alleviates inflammation in lipopolysaccharide-stimulated RAW264.7 cells via suppression of the nuclear factor kappa-B signaling pathway. Microbiol. Immunol. 2022, 67, 32–43. [CrossRef]
- Gharavi, A.T.; Hanjani, N.A.; Movahed, E.; Doroudian, M. The role of macrophage subtypes and exosomes in immunomodulation. Cell. Mol. Biol. Lett. 2022, 27, 1–18. [CrossRef]
- Pellon, A., et al., The commensal bacterium. Gut Microbes, 2021. 13(1): p. 1939598.
- Negi, S.; Das, D.K.; Pahari, S.; Nadeem, S.; Agrewala, J.N. Potential Role of Gut Microbiota in Induction and Regulation of Innate Immune Memory. Front. Immunol. 2019, 10, 2441. [CrossRef]
- Elena, C. and B. Gabriele, THE ROLE OF INTERLEUKIN-1 IN BACTERIAL INFECTIONS. International Journal of Infection, 2022. 6(3).
- Batra, R.; Suh, M.K.; Carson, J.S.; Dale, M.A.; Meisinger, T.M.; Fitzgerald, M.; Opperman, P.J.; Luo, J.; Pipinos, I.I.; Xiong, W.; et al. IL-1β (Interleukin-1β) and TNF-α (Tumor Necrosis Factor-α) Impact Abdominal Aortic Aneurysm Formation by Differential Effects on Macrophage Polarization. Arter. Thromb. Vasc. Biol. 2018, 38, 457–463. [CrossRef]
- Frodermann, V.; Chau, T.A.; Sayedyahossein, S.; Toth, J.M.; Heinrichs, D.E.; Madrenas, J. A Modulatory Interleukin-10 Response to Staphylococcal Peptidoglycan Prevents Th1/Th17 Adaptive Immunity to Staphylococcus aureus. J. Infect. Dis. 2011, 204, 253–262. [CrossRef]
- Kaji, R.; Kiyoshima-Shibata, J.; Nagaoka, M.; Nanno, M.; Shida, K. Bacterial Teichoic Acids Reverse Predominant IL-12 Production Induced by Certain Lactobacillus Strains into Predominant IL-10 Production via TLR2-Dependent ERK Activation in Macrophages. J. Immunol. 2010, 184, 3505–3513. [CrossRef]
- Saito, S.; Okuno, A.; Cao, D.-Y.; Peng, Z.; Wu, H.-Y.; Lin, S.-H. Bacterial Lipoteichoic Acid Attenuates Toll-Like Receptor Dependent Dendritic Cells Activation and Inflammatory Response. Pathogens 2020, 9, 825. [CrossRef]
- Gómez-Llorente, C.; Muñoz, S.; Gil, A. Role of Toll-like receptors in the development of immunotolerance mediated by probiotics. Proc. Nutr. Soc. 2010, 69, 381–389. [CrossRef]
- Wang, L.X.; Zhang, S.X.; Wu, H.J.; Rong, X.L.; Guo, J. M2b macrophage polarization and its roles in diseases. J. Leukoc. Biol. 2019, 106, 345–358. [CrossRef]
- Aggarwal, B.B. Signalling pathways of the TNF superfamily: a double-edged sword. Nat. Rev. Immunol. 2003, 3, 745–756. [CrossRef]
- Couper, K.N.; Blount, D.G.; Riley, E.M. IL-10: The master regulator of immunity to infection. J. Immunol. 2008, 180, 5771–5777. [CrossRef]
- Kaji, R.; Kiyoshima-Shibata, J.; Tsujibe, S.; Nanno, M.; Shida, K. Short communication: Probiotic induction of interleukin-10 and interleukin-12 production by macrophages is modulated by co-stimulation with microbial components. J. Dairy Sci. 2018, 101, 2838–2841. [CrossRef]
- Netea, M.G.; Sutmuller, R.; Hermann, C.; Van der Graaf, C.A.A.; Van der Meer, J.W.M.; van Krieken, J.H.; Hartung, T.; Adema, G.; Kullberg, B.J. Toll-Like Receptor 2 Suppresses Immunity against Candida albicans through Induction of IL-10 and Regulatory T Cells. J. Immunol. 2004, 172, 3712–3718. [CrossRef]
- Morishita, M.; Sagayama, R.; Yamawaki, Y.; Yamaguchi, M.; Katsumi, H.; Yamamoto, A. Activation of Host Immune Cells by Probiotic-Derived Extracellular Vesicles via TLR2-Mediated Signaling Pathways. Biol. Pharm. Bull. 2022, 45, 354–359. [CrossRef]
- Kurata, A.; Kiyohara, S.; Imai, T.; Yamasaki-Yashiki, S.; Zaima, N.; Moriyama, T.; Kishimoto, N.; Uegaki, K. Characterization of extracellular vesicles from Lactiplantibacillus plantarum. Sci. Rep. 2022, 12, 1–12. [CrossRef]
- Bajic, S.S.; Cañas, M.-A.; Tolinacki, M.; Badia, J.; Sánchez, B.; Golic, N.; Margolles, A.; Baldomá, L.; Ruas-Madiedo, P. Proteomic profile of extracellular vesicles released by Lactiplantibacillus plantarum BGAN8 and their internalization by non-polarized HT29 cell line. Sci. Rep. 2020, 10, 1–12. [CrossRef]
- Jeong, D.; Kim, M.J.; Park, Y.; Chung, J.; Kweon, H.-S.; Kang, N.-G.; Hwang, S.J.; Youn, S.H.; Hwang, B.K.; Kim, D. Visualizing extracellular vesicle biogenesis in gram-positive bacteria using super-resolution microscopy. BMC Biol. 2022, 20, 1–14. [CrossRef]
- Li, M.; Mao, B.; Tang, X.; Zhang, Q.; Zhao, J.; Chen, W.; Cui, S. Lactic acid bacteria derived extracellular vesicles: emerging bioactive nanoparticles in modulating host health. Gut Microbes 2024, 16, 2427311. [CrossRef]
- Bradford, M.M., A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem, 1976. 72: p. 248-54.
- Rico, G.R.; Martínez-Castillo, M.; González-Ruíz, C.; Luna-Castro, S.; de la Garza, M. Mannheimia haemolytica A2 secretes different proteases into the culture medium and in outer membrane vesicles. Microb. Pathog. 2017, 113, 276–281. [CrossRef]
- Vanegas, M.F., et al., Capacidad antimicrobiana de bacterias ácido lácticas autóctonas aisladas de queso doble crema y quesillo colombiano. . Biotecnoloía en el Sector Agropecuario y.
- Agroindustrial, 2017. 15(1): p. 45.
- Gutiérrez, V., Evaluación in vitro del efecto inmunoestimulante de Microvesículas de Bacterias Ácido-Lácticas de Rattus norvegicus de vida libre, sobre la línea celular RAW 264.7 gamma NO (-) ATCC CRL 2278. . Tesis de maestría. Universidad Nacional Autónoma de México., 2023.
- Raymaekers, M.; Smets, R.; Maes, B.; Cartuyvels, R. Checklist for optimization and validation of real-time PCR assays. J. Clin. Lab. Anal. 2009, 23, 145–151. [CrossRef]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 29, e45. [CrossRef]





| Citokines | Secuences |
Temperature of alignment |
Expected size |
| IL-1β | Fw: GGTGTGTGACGTTCCCATTA | 62°C | 170pb |
| Rv: CGTTGCTTGGTTCTCCTTGT | |||
| TNFα | Fw: TATGGCTCAGGGTCCAACTC | 59°C | 174pb |
| Rv: CTCCCTTTGCAGAACTCAGG | |||
| IL-10 | Fw: GCCTTATCGGAAATGATCC | 56°C | 176pb |
| Rv: TCCACTGCCTTGCTCTTATT | |||
| IL-12 | Fw: ACAGCACCAGCTTCTTCATC | 57°C | 165pb |
| Rv: GCTGGATTCGAACAAAGAACT | |||
| TLR2 | Fw: CTCCCACTTCAGGCTCTTTG | 61°C | 223pb |
| Rv: GAAGTCAGGAACTGGGTGGA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.