Submitted:
10 December 2025
Posted:
12 December 2025
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Materials and Methods
2.1. Animal Models and Experimental Design
2.2. Measurement of Lipid Peroxidation
2.3. Cytosolic Iron Quantification
2.4. Detection of Reactive Oxygen Species (ROS)
2.5. GPX4 Activity Assay
2.6. Histological and Immunohistochemical Analysis
2.7. Transmission Electron Microscopy (TEM)
2.8. Quantitative Real-Time PCR
2.9. Western Blotting
2.10. Statistical Analysis
3. Results
3.1. Obesity-Associated Changes in Weight, Nutrient Intake, and Glycemic Status
3.2. Enhanced Lipogenesis in the Salivary Glands of Obese Mice
3.3. Ferroptosis-associated Oxidative Stress and Iron Dysregulation

3.4. Obesity-induced Fibrosis and Inflammation in the Salivary Glands
3.5. Functional Deterioration of the Salivary Glands and Its Reversal by Ferroptosis Inhibitors
3.6. Mitochondrial Dysfunction and Selective Autophagy Imbalance in the Obese Salivary Glands
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Haslam, D.W.; James, W.P. Obesity. Lancet 2005, 366, 1197–1209. [Google Scholar] [CrossRef] [PubMed]
- Henning, R.J. Obesity and obesity-induced inflammatory disease contribute to atherosclerosis: a review of the pathophysiology and treatment of obesity. Am J Cardiovasc Dis 2021, 11, 504–529. [Google Scholar] [PubMed]
- Jin, X.; Qiu, T.; Li, L.; Yu, R.; Chen, X.; Li, C.; Proud, C.G.; Jiang, T. Pathophysiology of obesity and its associated diseases. Acta Pharm Sin B 2023, 13, 2403–2424. [Google Scholar] [CrossRef]
- Hao, Z.; Munzberg, H.; Rezai-Zadeh, K.; Keenan, M.; Coulon, D.; Lu, H.; Berthoud, H.R.; Ye, J. Leptin deficient ob/ob mice and diet-induced obese mice responded differently to Roux-en-Y bypass surgery. Int J Obes (Lond) 2015, 39, 798–805. [Google Scholar] [CrossRef]
- Zalewska, A.; Ziembicka, D.; Zendzian-Piotrowska, M.; Maciejczyk, M. The Impact of High-Fat Diet on Mitochondrial Function, Free Radical Production, and Nitrosative Stress in the Salivary Glands of Wistar Rats. Oxid Med Cell Longev 2019, 2019, 2606120. [Google Scholar] [CrossRef]
- Rojas, J.M.; Bolze, F.; Thorup, I.; Nowak, J.; Dalsgaard, C.M.; Skydsgaard, M.; Berthelsen, L.O.; Keane, K.A.; Soeborg, H.; Sjogren, I.; et al. The Effect of Diet-induced Obesity on Toxicological Parameters in the Polygenic Sprague-Dawley Rat Model. Toxicol Pathol 2018, 46, 777–798. [Google Scholar] [CrossRef]
- Jiang, X.; Stockwell, B.R.; Conrad, M. Ferroptosis: mechanisms, biology and role in disease. Nat Rev Mol Cell Biol 2021, 22, 266–282. [Google Scholar] [CrossRef]
- Dixon, S.J.; Lemberg, K.M.; Lamprecht, M.R.; Skouta, R.; Zaitsev, E.M.; Gleason, C.E.; Patel, D.N.; Bauer, A.J.; Cantley, A.M.; Yang, W.S.; et al. Ferroptosis: an iron-dependent form of nonapoptotic cell death. Cell 2012, 149, 1060–1072. [Google Scholar] [CrossRef]
- Li, J.; Cao, F.; Yin, H.L.; Huang, Z.J.; Lin, Z.T.; Mao, N.; Sun, B.; Wang, G. Ferroptosis: past, present and future. Cell Death Dis 2020, 11, 88. [Google Scholar] [CrossRef]
- Stockwell, B.R. Ferroptosis turns 10: Emerging mechanisms, physiological functions, and therapeutic applications. Cell 2022, 185, 2401–2421. [Google Scholar] [CrossRef] [PubMed]
- Liu, Z.; Dong, L.; Zheng, Z.; Liu, S.; Gong, S.; Meng, L.; Xin, Y.; Jiang, X. Mechanism, Prevention, and Treatment of Radiation-Induced Salivary Gland Injury Related to Oxidative Stress. Antioxidants (Basel) 2021, 10. [Google Scholar] [CrossRef] [PubMed]
- Kwon, H.K.; Kim, J.M.; Shin, S.C.; Sung, E.S.; Kim, H.S.; Park, G.C.; Cheon, Y.I.; Lee, J.C.; Lee, B.J. The mechanism of submandibular gland dysfunction after menopause may be associated with the ferroptosis. Aging (Albany NY) 2020, 12, 21376–21390. [Google Scholar] [CrossRef]
- Kim, J.M.; Shin, S.C.; Cheon, Y.I.; Kim, H.S.; Park, G.C.; Kim, H.K.; Han, J.; Seol, J.E.; Vasileva, E.A.; Mishchenko, N.P.; et al. Effect of Echinochrome A on Submandibular Gland Dysfunction in Ovariectomized Rats. Mar Drugs 2022, 20. [Google Scholar] [CrossRef]
- Cheon, Y.I.; Kim, J.M.; Shin, S.C.; Kim, H.S.; Lee, J.C.; Park, G.C.; Sung, E.S.; Lee, M.; Lee, B.J. Effect of deferoxamine and ferrostatin-1 on salivary gland dysfunction in ovariectomized rats. Aging (Albany NY) 2023, 15, 2418–2432. [Google Scholar] [CrossRef]
- Park, G.C.; Bang, S.Y.; Kim, J.M.; Shin, S.C.; Cheon, Y.I.; Park, H.; Suh, S.; Cho, J.H.; Sung, E.S.; Lee, M.; et al. Ferrostatin-1 Prevents Salivary Gland Dysfunction in an Ovariectomized Rat Model by Suppressing Mitophagy-Driven Ferroptosis. Antioxidants (Basel) 2025, 14. [Google Scholar] [CrossRef]
- Kim, J.M.; Park, G.C.; Lee, H.W.; Bang, S.Y.; Kim, D.H.; Kim, W.T.; Shin, S.C.; Cheon, Y.I.; Lee, B.J. Amifostine and melatonin attenuate radiation-induced oxidative stress, inflammation, and fibrotic remodeling in the vocal folds and subglottic glands of rats. Biomed Pharmacother 2025, 192, 118658. [Google Scholar] [CrossRef]
- Park, G.C.; Bang, S.Y.; Kim, J.M.; Shin, S.C.; Cheon, Y.I.; Kim, K.M.; Park, H.; Sung, E.S.; Lee, M.; Lee, J.C.; et al. Inhibiting Ferroptosis Prevents the Progression of Steatotic Liver Disease in Obese Mice. Antioxidants (Basel) 2024, 13. [Google Scholar] [CrossRef]
- Garbowska, M.; Lukaszuk, B.; Miklosz, A.; Wroblewski, I.; Kurek, K.; Ostrowska, L.; Chabowski, A.; Zendzian-Piotrowska, M.; Zalewska, A. Sphingolipids metabolism in the salivary glands of rats with obesity and streptozotocin induced diabetes. J Cell Physiol 2017, 232, 2766–2775. [Google Scholar] [CrossRef]
- Yamamoto, Y.; Morozumi, T.; Takahashi, T.; Saruta, J.; Sakaguchi, W.; To, M.; Kubota, N.; Shimizu, T.; Kamata, Y.; Kawata, A.; et al. Effect of High Fat and Fructo-Oligosaccharide Consumption on Immunoglobulin A in Saliva and Salivary Glands in Rats. Nutrients 2021, 13. [Google Scholar] [CrossRef] [PubMed]
- Chang, K.; Luo, P.; Guo, Z.; Yang, L.; Pu, J.; Han, F.; Cai, F.; Tang, J.; Wang, X. Lipid Metabolism: An Emerging Player in Sjogren's Syndrome. Clin Rev Allergy Immunol 2025, 68, 15. [Google Scholar] [CrossRef] [PubMed]
- Tang, D.; Chen, X.; Kang, R.; Kroemer, G. Ferroptosis: molecular mechanisms and health implications. Cell Res 2021, 31, 107–125. [Google Scholar] [CrossRef] [PubMed]
- Zhao, L.; Zhou, X.; Xie, F.; Zhang, L.; Yan, H.; Huang, J.; Zhang, C.; Zhou, F.; Chen, J.; Zhang, L. Ferroptosis in cancer and cancer immunotherapy. Cancer Commun (Lond) 2022, 42, 88–116. [Google Scholar] [CrossRef]
- Ru, Q.; Li, Y.; Chen, L.; Wu, Y.; Min, J.; Wang, F. Iron homeostasis and ferroptosis in human diseases: mechanisms and therapeutic prospects. Signal Transduct Target Ther 2024, 9, 271. [Google Scholar] [CrossRef]
- Lai, W.; Wang, B.; Huang, R.; Zhang, C.; Fu, P.; Ma, L. Ferroptosis in organ fibrosis: From mechanisms to therapeutic medicines. J Transl Int Med 2024, 12, 22–34. [Google Scholar] [CrossRef]
- Hu, Y.; Huang, Y.; Zong, L.; Lin, J.; Liu, X.; Ning, S. Emerging roles of ferroptosis in pulmonary fibrosis: current perspectives, opportunities and challenges. Cell Death Discov 2024, 10, 301. [Google Scholar] [CrossRef]
- Lyu, G.; Liao, H.; Li, R. Ferroptosis and renal fibrosis: mechanistic insights and emerging therapeutic targets. Ren Fail 2025, 47, 2498629. [Google Scholar] [CrossRef] [PubMed]
- Pan, Q.; Luo, Y.; Xia, Q.; He, K. Ferroptosis and Liver Fibrosis. Int J Med Sci 2021, 18, 3361–3366. [Google Scholar] [CrossRef]
- Friedmann Angeli, J.P.; Schneider, M.; Proneth, B.; Tyurina, Y.Y.; Tyurin, V.A.; Hammond, V.J.; Herbach, N.; Aichler, M.; Walch, A.; Eggenhofer, E.; et al. Inactivation of the ferroptosis regulator Gpx4 triggers acute renal failure in mice. Nat Cell Biol 2014, 16, 1180–1191. [Google Scholar] [CrossRef]
- Wang, H.; Liu, C.; Zhao, Y.; Gao, G. Mitochondria regulation in ferroptosis. Eur J Cell Biol 2020, 99, 151058. [Google Scholar] [CrossRef] [PubMed]
- Jiang, L.; Kon, N.; Li, T.; Wang, S.J.; Su, T.; Hibshoosh, H.; Baer, R.; Gu, W. Ferroptosis as a p53-mediated activity during tumour suppression. Nature 2015, 520, 57–62. [Google Scholar] [CrossRef] [PubMed]
- Yu, F.; Zhang, Q.; Liu, H.; Liu, J.; Yang, S.; Luo, X.; Liu, W.; Zheng, H.; Liu, Q.; Cui, Y.; et al. Dynamic O-GlcNAcylation coordinates ferritinophagy and mitophagy to activate ferroptosis. Cell Discov 2022, 8, 40. [Google Scholar] [CrossRef] [PubMed]
- Liu, C.; Wu, Z.; Wang, L.; Yang, Q.; Huang, J.; Huang, J. A Mitophagy-Related Gene Signature for Subtype Identification and Prognosis Prediction of Hepatocellular Carcinoma. Int J Mol Sci 2022, 23. [Google Scholar] [CrossRef]
- Scarpellini, C.; Klejborowska, G.; Lanthier, C.; Hassannia, B.; Vanden Berghe, T.; Augustyns, K. Beyond ferrostatin-1: a comprehensive review of ferroptosis inhibitors. Trends Pharmacol Sci 2023, 44, 902–916. [Google Scholar] [CrossRef] [PubMed]
- Karbakhsh Ravari, F.; Ghasemi Gorji, M.; Rafiei, A. From iron-driven cell death to clot formation: The emerging role of ferroptosis in thrombogenesis. Biomed Pharmacother 2025, 189, 118328. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Li, X.; Wang, S.; Miao, R.; Zhong, J. Targeting Iron Metabolism and Ferroptosis as Novel Therapeutic Approaches in Cardiovascular Diseases. Nutrients 2023, 15. [Google Scholar] [CrossRef]





| GENE | Sequence (5‘-3‘) | |
|---|---|---|
| Forward | Reverse | |
| GAPDH | AGCCCAAGATGCCCTTCAGT | CCGTGTTCCTACCCCCAATG |
| SREBP-1c | ACGGAGCCATGGATTGCACA | AAGGGTGCAGGTGTCACCTT |
| ChREBP | CTGGGGACCTAAACAGGAGC | GAAGCCACCCTATAGCTCCC |
| ACC | ATGGGCGGAATGGTCTCTTTC | TGGGGACCTTGTCTTCATCAT |
| TGF-β1 | GTGTGGAGCAACATGTGGAACTCTA | TTGGTTCAGCCACTGCCGTA |
| Collagen I | CCTCAGGGTATTGCTGGACAAC | CAGAAGGACCTTGTTTGCCAGG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).