Preprint
Article

This version is not peer-reviewed.

Behavioral Balance in Tryptophan Turmoil: Regional Metabolic Rewiring in Kynurenine Aminotransferase II Knockout Mice

A peer-reviewed version of this preprint was published in:
Cells 2025, 14(21), 1711. https://doi.org/10.3390/cells14211711

Submitted:

07 October 2025

Posted:

08 October 2025

Read the latest preprint version here

Abstract

Background: Cognitive, emotional, and social dysfunctions pervade neuropsychiatric disorders; dysregulated tryptophan (Trp)–kynurenine signaling, notably kynurenic acid (KYNA) from kynurenine aminotransferases (KATs), is implicated in Alzheimer’ disease, Parkinson’s disease, depression, and post-traumatic stress disorder (PTSD), among others. In novel CRISPR/Cas9-generated KAT II knockout (aadat-/- aka. kat2-/-) mice, we observed despair-linked depression-like behavior with peripheral excitotoxicity and oxidative stress. KAT II’s role and its crosstalk with serotonin, indole-pyruvate, and tyrosine (Tyr)–dopamine remain unclear. It is unknown whether deficits extend to cognitive, emotional, motor, and social domains or whether brain tissues mirror peripheral stress. Objectives: Delineate domain-wide behaviors, brain oxidative/excitotoxic profiles, and pathway interactions attributable to KAT II. Results: Behavior was unchanged across strains. kat2-/- deletion remodeled Trp metabolic pathways: 3-hydroxykynurenine increased, xanthurenic acid decreased, KYNA fell in cortex and hippocampus but rose in striatum, quinaldic acid (QAA) decreased in cerebellum and brainstem. Such spatially restricted shifts delineate metabolic stress as a core transdiagnostic liability, converging with increased oxidative burden and amplified excitotoxic mechanisms. Conclusion: Here we show kat2 deletion reshapes regional Trp metabolism while reinforcing despair-linked emotional bias, this study highlights novel metabolic signatures as stratification biomarkers. These insights may foster double-hit animal models to dissect the convergence of depression and PTSD, ultimately informing targeted therapeutic approaches.

Keywords: 
;  ;  ;  ;  ;  ;  ;  ;  ;  

1. Introduction

Cognitive dysfunction, emotional dysregulation, motor impairment, and atypical social behavior represent core clinical features across a broad spectrum of neuropsychiatric and neurodegenerative disorders, including Alzheimer’s disease, Parkinson’s disease, schizophrenia (SCZ), and autism spectrum disorder (ASD) [1,2,3,4,5]. As the incidence of these conditions continues to rise globally, their cumulative impact on public health infrastructure, caregivers, and society becomes increasingly profound [2,3,6,7,8]. These growing challenges underscore the urgent need for elucidating the molecular and cellular mechanisms that drive these complex disorders [1,4,9,10]. Among the neurobiological systems under investigation, the metabolism of tryptophan (Trp)—an essential amino acid and a biochemical precursor to numerous neuroactive compounds—has garnered substantial attention in recent years [9,11,12,13,14].
Trp metabolism plays a pivotal role in modulating central nervous system (CNS) functions, particularly those related to cognitive abilities, mood regulation, and social behavior [15,16,17,18,19]. Dysregulation within these metabolic pathways has been increasingly linked to the pathophysiology of diseases marked by cognitive decline and deficits in social functioning [15,16,17,20,21]. The kynurenine (KYN) pathway is the principal route for Trp catabolism, accounting for approximately 90% of total metabolic flux [15,16,21,22,23] (Figure 1). This pathway produces a variety of bioactive metabolites with diverse effects on CNS function [15,16,18,24,25]. Among these, kynurenic acid (KYNA) stands out due to its ability to modify excitatory neurotransmission through its action on multiple receptors, including N-methyl-D-aspartate (NMDA), α7-nicotinic acetylcholine, α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA), and kainate receptors [24,26,27,28,29,30]. KYNA is synthesized via the irreversible transamination of KYN by kynurenine aminotransferase enzymes (KATs), with the KAT II isoform being particularly prominent in the brain [19,25,28,31,32]. In contrast, another KYN pathway metabolite, 3-hydroxykynurenine (3-HK), contributes to neurotoxicity by promoting oxidative stress through the generation of reactive oxygen species [17,20,22,33,34]. While historically KYNA and 3-HK were categorized as strictly neuroprotective and neurotoxic, respectively, emerging evidence reveals more complex, context-dependent functions that vary based on concentration, receptor expression patterns, and disease-specific factors [15,24,33,35,36].
In addition to the KYN pathway, several alternative routes for Trp metabolism significantly influence CNS homeostasis [15,37,38,39,40]. One such pathway is the 5-HT–melatonin (MEL) system [15,37,40,41,42]. 5-HT, synthesized from Trp, is a critical neurotransmitter involved in mood regulation, affective balance, and social cognition. Its downstream metabolite, MEL, regulates circadian rhythms and sleep architecture—factors integrally linked to learning, memory consolidation, and executive functioning [39,42,43,44]. Perturbations in this pathway are associated with a wide range of psychiatric disorders, including major depressive disorder (MDD), generalized anxiety disorder (GAD), and disturbances in sleep and circadian regulation [12,39,41,45,46]. Here, we quantify regional 5-HT and 5-hydroxyindoleacetic acid (5-HIAA) to estimate serotonergic turnover in vivo and relate these indices to KYN-pathway shifts.
Another prominent route is the indole–pyruvate pathway, primarily driven by the gut microbiota [47,48,49,50,51]. In this pathway, microbial enzymes convert Trp into several indole derivatives through distinct enzymatic reactions [47,48,49,51,52]. These indole metabolites are capable of crossing the intestinal barrier and influencing the CNS by modulating neuroinflammatory processes, maintaining gut epithelial integrity, and regulating blood-brain barrier (BBB) permeability [47,48,51,53,54]. This bidirectional communication along the gut-brain axis has been implicated in the pathophysiology of mood disorders, ASD, and other conditions characterized by social and emotional dysregulation [48,52,55,56,57]. We therefore profile brain-region levels of indole-3-acetic acid (IAA) and indole-3-carboxaldehyde (ICA) as sentinel markers of gut-brain indole signaling in KAT II knockout mice.
Additionally, Trp metabolism exerts regulatory effects on dopaminergic neurotransmission via its influence on the tyrosine (Tyr)–dopamine (DA) pathway [37,58,59,60,61]. Specifically, Trp availability impacts the synthesis of tetrahydrobiopterin (BH4), a critical cofactor required by tyrosine hydroxylase—the rate-limiting enzyme in DA production [37,58,59,62,63]. Given DA’s fundamental role in mediating reward processing, attentional control, and social engagement, this intersection further emphasizes the extensive reach of Trp metabolism in orchestrating complex behavioral and cognitive outcomes [39,59,64,65,66]. To capture this crosstalk, we quantify Tyr, levodopa (L-DOPA), DA, and downstream metabolites alongside the pterin pool (BH4, dihydrobiopterin [BH2], and biopterin [BIO]).
In earlier research, we examined the interrelationships between affective disorders—such as MDD, GAD, and post-traumatic stress disorder—and systemic alterations in Trp and its downstream metabolites in kat2-/- mice model [67]. Although traditionally conceptualized as mood disorders, these conditions also encompass profound cognitive impairments, including deficits in memory, sustained attention, and executive functioning [68,69,70,71,72]. Such impairments frequently manifest early in the course of illness and may persist independently of affective symptoms [68,70,72,73,74]. Notably, MDD has emerged as a significant risk factor for the subsequent development of neurodegenerative conditions like AD [68,70,75,76,77]. In parallel, individuals suffering from MDD and GAD often exhibit marked social dysfunction, including social withdrawal, blunted affect, and reduced emphatic capacity [68,69,71,72,78]. These features closely parallel behavioral phenotypes observed in ASD and SCZ, further complicating differential diagnosis and therapeutic decision-making [68,71,78,79,80,81]. A mechanistic understanding of the molecular pathways that underlie these shared features is therefore of paramount importance [68,75,81,82,83].
To probe the contributions of Trp metabolic dysregulation to these behavioral phenotypes, we utilized a genetically engineered mouse model deficient in KAT II (kat2-/-) [67]. This knockout model disrupts the biosynthetic pathway for KYNA, allowing for detailed investigation of downstream metabolic consequences. Targeted metabolomic profiling of urine and plasma revealed a pronounced decrease in KYNA levels accompanied by elevated concentrations of 3-HK. These findings reinforce the essential role of KAT II in modulating the balance between neuroprotective and neurotoxic metabolites within the KYN pathway. Building directly on this peripheral signature, the current study extends metabolomics to five brain regions (striatum [STR], cortex [CTX], hippocampus [HIPP], cerebellum [CER], brainstem [STEM]) to resolve central, region-specific consequences of KAT II deletion.
Despite inherent limitations in modeling human psychiatric and neurodegenerative diseases in rodents—especially with regard to complex cognitive processes and nuanced social behaviors—this genetic model affords a valuable platform for dissecting the neurochemical substrates of behavior [84,85,86,87,88]. In the present study, we aimed to systematically evaluate cognitive function and social behavior in kat2-/- mutant mice, with a particular focus on mapping these behavioral parameters to region-specific changes in the concentrations of Trp and its metabolites within the brain. This integrative approach offers a robust framework for uncovering potential neurochemical signatures that underlie cognitive and social impairments. Accordingly, our prespecified objectives were to (i) map region-resolved Trp metabolism across the KYN, 5-HT, and indole axes; (ii) quantify the Tyr to L-DOPA to DA cascade and its enzymatic and cofactor milieu (BH4, BH2, BIO); (iii) infer pathway activities using product-substrate ratios (for example, KMO and KAT fluxes, monoamine oxidase [MAO] and aldehyde dehydrogenase [ALDH] turnover) and derive oxidative-stress and excitotoxicity indices; (iv) link these neurochemical states to a broadened behavioral battery encompassing cognition (novel object recognition, object-based attention, Y-maze), motor coordination (rotarod), emotion (marble burying), and sociability (three-chamber); and (v) test concordance between brain and peripheral metabolic signatures. By coupling this expanded behavioral panel with multi-region neurochemical profiling, we aim to delineate how KAT II loss reshapes a KYN-tilted, cofactor-constrained, and indole-modulated milieu, and to determine whether such biochemical disequilibria necessarily generalize to global cognitive or social dysfunction, thereby informing pathway-targeted therapeutic strategies across neuropsychiatric spectra.

2. Materials and Methods

2.1. Ethical Approval

The Department of Nature Conservation of the Ministry of Agriculture authorized the use of genetically modified organisms in a level 2 biosafety closed system (permit number: TMF/43-20/2015). The import of genetically modified animals was approved by the Department of Biodiversity and Gene Conservation of the Ministry of Agriculture (permit number: BGMF/37-5/2020). The investigations were conducted in accordance with the Ethical Codex for Animal Experiments and were approved by the Ethics Committee of the Faculty of Medicine at the University of Szeged, as well as by the National Food Chain Safety Office, under permission number CS/I01/00084-2/2025 and XI./1008/2025.

2.2. Animals

The C57BL/6N wild-type (WT) strain was originally sourced from Charles River Germany. The kat2-/- strain was provided by our collaboration partners at Kyushu University (Fukuoka, Japan). A comprehensive description of the generation of the genetically modified strain can be found in our previously published article [67]. The animals were housed in groups of 4-5 per cage in polycarbonate enclosures (530 cm2 floor area) under specific pathogen-free conditions at the Animal Facility of the Department of Neurology, University of Szeged. Environmental parameters were stringently controlled, with ambient temperature maintained at 24 ± 1 °C and 45-55% relative humidity under a 12:12 hours light:dark cycle. Throughout the duration of the investigation, mice had unrestricted access to standard rodent food and water.

2.3. Genotyping with Taqman Allelic Discrimination Assay

All animals were genotyped in advance, ensuring verification before the subsequent experimental studies. Mice were anesthetized with 2% isoflurane, and following local analgesia with 5% lidocaine ointment, a 3 mm fragment of the tail was excised using sterile instruments under aseptic conditions. Tissue samples were stored at -80 °C until further processing. For DNA extraction, 75 µl of a freshly prepared lysis buffer containing equal volumes of 25 mM NaOH and 0.2 mM disodium EDTA was added to each sample. After incubation at 95 °C for 30 minutes, the suspension was cooled to 4 °C and then neutralized with 75 µl of 40 mM TRIS-HCl buffer. This method was adapted from the HotSHOT protocol and consistently yields DNA suitable for reliable genotyping, as previously demonstrated by Truett et al.. DNA concentration and purity were assessed using a NanoDrop spectrophotometer (MaestroGen, Taipei, Taiwan). The resulting DNA extracts were stored at -20 °C until analysis [89].
Genotyping was performed using a fluorescence-labeled TaqMan allelic discrimination assay. The forward primer sequence was 5′–TAACAGTGCATCCCGAGTGA–3′, the reverse primer sequence was 5′–GAGGGCTCTGGCTTTGTTTT–3′, while probe 1 and probe 2 sequences were 5′–6-FAM-CAACGAGCCTGGCCAGAA-BHQ-1–3′ and 5′–HEX-TGCAACGACTGGCCAGAAAG-BHQ-1–3′, respectively (Metabion, Steinkirchen / Planegg, Germany). For each reaction, the PCR was assembled using the following reagents: PCR Master Mix (5 µl; PCRBiosystems, London, UK), forward primer (1 µl), reverse primer (1 µl), probe 1 (0.5 µl), probe 2 (0.5 µl), DNA template (1 µl), and water (1 µl). Non-template control reactions contained water instead of DNA. Reaction mixtures were aliquoted into 96-well plates. PCR amplification and allelic discrimination were performed in single-plex reactions using a CFX Opus 96 Real-Time PCR System (Bio-Rad Laboratories, Hercules, California, USA) according to the manufacturer’s instructions. The amplification protocol consisted of an initial denaturation at 95 °C for 10 min, followed by 40 cycles of 92 °C for 15 sec and 60 °C for 1 min. Fluorescence data were analyzed with CFX Maestro software.
This approach ensured that all mutant animals included in the experiments were confirmed to carry the targeted genetic modification, and wild-type mice were correctly identified as controls.

2.4. Behavioral Tests

Cognitive, emotional, motor, and social domains were assayed with novel object recognition for recognition memory, Y-maze spontaneous alternation for working memory, marble burying test (MBT), the accelerating rotarod for motor coordination, and the automated three-chamber task for sociability. The behavioral experiments were performed on 8-week-old male mice of the C57BL/6N and kat2-/- strains, with n = 8-12 animals included per group. To minimize stress, the animals were habituated to handling by the experimenters for one week prior to testing. To ensure comparability of the results, all tests were conducted between 8:00 a.m. and 12:00 p.m. Prior to testing, animals were transferred to the experimental laboratory one hour in advance, allowing sufficient time for acclimatization to the environmental conditions. All test sessions were recorded using a video tracking system (Basler ace Classic acA1300-60 gm, Basler AG, Ahrensburg, Germany) in combination with behavioral analysis software (EthoVision XT14, Noldus Information Technology BV, Wageningen, the Netherlands).

2.4.1. Novel Object Recognition Test (NORT)

The Novel Object Recognition Test (NORT) has become an established and widely employed approach for investigating various phases of learning and non-spatial object memory in rodents [90,91,92,93,94]. For the NORT, behavioral assessments were conducted in a 60 x 60 x 60 cm open-field arena. Three distinct objects—different in color and shape but matched in size and scale relative to the animals—were utilized. The test was carried out across three consecutive days. On the habituation day, each animal was placed in the empty arena for a duration of 10 minutes to facilitate acclimatization to the new environment. On the second day (training session), animals were allowed to explore two of the three objects for 10 minutes, enabling the encoding of object-related information. Animals that failed to exhibit any interaction with the object designated as the familiar object during the training phase were excluded from further analysis in the experiment. On the third day (test session), one of the familiar objects from the training phase was substituted with the previously unencountered third object. This unfamiliar item functioned as the novel object, whereas the remaining object served as the familiar object for the purpose of evaluating recognition memory. During NORT we measured the following parameters: 1) time spent with the training object in training phase, 2) time spent with the familiar object in training phase, 3) time spent with the familiar object in testing phase, 4) time spent with the novel object in testing phase.
During both NORT and OBAT, the duration of investigation directed toward the novel and familiar objects was systematically recorded. To assess object recognition and novelty preference, two normalized metrics were employed: the discrimination index (DI) and the preference index (PI). The DI quantifies the relative preference for the novel object compared to the familiar one, while the PI expresses the proportion of total exploration time that the animal allocated to the novel object. Both indices account for individual variability in total investigation time and were computed using the following formulas (Eq. 1, Eq. 2).
d i s c r i m i n a t i o n i n d e x D I = T n o v e l T f a m i l i a r T n o v e l + T f a m i l i a r
p r e f e r e n c e i n d e x P I = T n o v e l T n o v e l + T f a m i l i a r × 100

2.4.2. Object-Based Attention Test (OBAT)

Attention deficits constitute a hallmark feature of cognitive dysfunction commonly observed across various neuropsychiatric conditions. The object-based attention test (OBAT), originally developed by Wulaer and colleagues [95,96,97,98,99], represents a validated behavioral paradigm for evaluating attentional performance in rodents. This method is conceptually analogues to object-based visual attention assessments employed in human cognitive research. Similar to the NORT, the OBAT leverages the rodent’s intrinsic exploratory drive and preference for novelty. The experimental setup comprises a two-compartment arena with dimensions of 40 x 40 x 40 cm (larger compartment) and 20 x 40 x 40 cm (smaller compartment), and utilizes six distinct objects. These objects differ in color and shape but are comparable in size. The procedure consists of two sequential phases: a training phase and a testing phase. During the training phase, the animal is introduced into the larger compartment containing five distinct objects and is allowed a 3-minute exploration period to become familiar with them. Animals that did not engage in any interaction with the object assigned as the familiar object during the training phase were excluded from subsequent experimental analysis. Subsequently, one of these previously encountered objects, along with a sixth, novel object is placed in the smaller compartment for the 3-minute test phase. The novel item serves as the novel object, while the reintroduced item functions as the familiar object. Healthy animals typically exhibit a clear preference for the novel object, indicative of intact attentional and recognition processes. Animals that did not engage with the object later serving as the familiar stimulus during the training phase were systematically excluded from subsequent experimental evaluation.
The following parameters were assessed during the NORT: 1) duration of interaction with the training objects during the training phase, 2) duration of interaction with the familiar object during the training phase, 3) time spent exploring the familiar object during the testing phase, and 4) time spent interacting with the novel object during the testing phase.

2.4.3. Y-Maze Test

The Y-maze represents a widely utilized paradigm for evaluating short-term memory function in rodents. Spontaneous alternation behavior—considered a robust index of spatial working memory—can be assessed by permitting animals unrestricted access to all three arms of the apparatus [100,101,102,103]. This exploratory pattern is guided by the rodent’s innate tendency to investigate novel, previously unvisited environments. Rodents exhibiting intact working memory capacity, and thereby preserved prefrontal cortical function, are capable of recalling which arms have been recently explored and display a preferential inclination of enter the arm that has not been visited in the most recent sequence. At the onset of the trial, the animal is positioned at the distal end of the longest arm of the Y-maze, oriented toward the central zone. Thereafter, it is granted an eight-minute period to freely explore the maze. The spontaneous alternation rate was determined according to the following formula (Eq. 3).
s p o n t a n e o u s a l t e r n a t i o n % = n u m b e r o f s p o n t a n e o u s a l t e r n a t i o n s t o t a l n u m b e r o f a r m e n t r i e s 2 × 100
During the Y-maze test, we measured spontaneous alternation behavior as well as the total number of entries into all three arms.

2.4.4. Marble Burying Test (MBT)

The marble burying test (MBT) is primarily employed to evaluate compulsive and anxiety-related behaviors, especially in models of generalized anxiety and obsessive-compulsive disorder [104,105,106,107,108]. Nonetheless, certain studies suggest that it may also be used indirectly to assess aspects of social behavior and cognitive functioning, or to provide supplementary insights in these domains. Elevated levels of compulsive behavior are frequently accompanied by social deficits. In animal models exhibiting impaired sociability, intensified marble burying may reflect increased behavioral rigidity and social withdrawal. Although MBT is not classified as a cognitive test, the presence of repetitive, inflexible actions may signal cognitive rigidity, potentially associated with dysfunctions in the frontal CTX.
The animals were individually placed in a transparent plastic arena measuring 40 x 24 x 18 cm. The base of the apparatus was filled with a 5 cm deep layer of fresh bedding material. To allow adequate ventilation while preventing escape. The enclosure was covered with a transparent plastic lid (40 x 24 cm, 1 cm thick) featuring six circular perforations, each 1 cm in diameter. At one end of the arena, sixteen glass marbles (each with dimensions of 1 x 1 x 1 cm3) were positioned on the bedding in a regular square grid formation. The outermost marbles were placed 3.5 cm from the arena walls, with 5 cm spacing between adjacent marbles. Each mouse was allowed to explore the arena freely for a period of 30 minutes. The marbles were categorized based on their status: intact, displaced, partially buried (0-75%), or fully buried (75-100%). These measurements were subsequently analyzed and compared across experimental groups.

2.4.5. Three Chamber Test (3CT)

Deficits in reciprocal social interactions—characterized by diminished interest in conspecifics and impaired ability to maintain social engagement—constitute core features in the diagnostic criteria of social neuropsychiatric disorders, such as autism spectrum disorder and SCZ. Sociability is operationally defined as the propensity of the test mouse to spend a greater proportion of time in the compartment containing a novel conspecific, as opposed to the compartment housing a novel inanimate object. A supplementary and confirmatory metric involves the quantification of time spent engaging in olfactory investigation of the novel conspecific relative to the novel object, thereby providing an index of direct social interaction. Additionally, the number of transitions between compartments serves as an intrinsic control parameter for assessing exploratory locomotor activity [109,110,111,112,113].
A rectangular three-chambered apparatus was employed for the 3CT. Each compartment measured 20 x 40.5 x 22 cm. The chambers were divided by opaque gray plastic walls, each containing manually operated doors (7.5 x 5 cm) to allow controlled access between compartments. Cylindrical wire-mesh enclosures (15 cm in height, 7 cm in diameter) were positioned in both lateral chambers. The mesh structure, composed of bars spaced 1 cm apart, permitted adequate airflow between the interior and exterior of the cylinder while simultaneously preventing direct physical contact between the test subject and the stimulus animal or object placed within. This configuration allowed for the assessment of social preference and investigatory behavior while minimizing confounding factors related to tactile interaction [109,114,115,116,117]. The test protocol consisted of three distinct phases. During the habituation phase, the subject mouse was confined to the center chamber of the apparatus for a period of 10 minutes with all doors closed, allowing acclimatization to the environment. In the sociability phase, the doors to the lateral chambers were opened, and the test mouse, starting from the center chamber, was allowed to freely explore all three compartments for 10 minutes. One lateral chamber contained an empty wire-mesh enclosure, while the other housed a wire cage enclosing a novel conspecific that was matched to the test animal in sex, age, and body weight. The social novelty preference phase followed a similar structure: the subject animal started from the center chamber and was given 10 minutes to explore the entire apparatus. In this phase, the previously encountered conspecific from the sociability phase served as the familiar animal, while a non-familiar, sex-, age- and weight-matched conspecific was introduced into the formerly empty cage, serving as the novel animal.
During the sociability phase, we quantified 1) time spent in the social chamber, 2) time spent in the non-social chamber, 3) time spent in the center chamber, 4) time spent sniffing the social cage, 5) time spent sniffing the non-social cage, 6) number of entries to the social chamber, 7) number of entries to the non-social chamber, 8) number of entries to both chambers. In the social novelty preference phase, we measured the 1) time spent in the novel chamber, 2) time spent in the familiar chamber, 3) time spent in the center chamber, 4) time spent sniffing the novel animal’s cage, 5) time spent sniffing the familiar animal’s cage, 6) number of entries to the novel chamber, 7) number of entries to the familiar animal’s chamber, 8) number of entries to both chambers.

2.4.6. Rotarod Test

The rotarod test is a widely established behavioral assay for evaluating motor coordination and balance in rodents. The classical accelerating rotarod paradigm primarily assesses maximal motor performance under progressively increasing demand [118,119,120,121,122]. The apparatus comprised a rotating rod equipped with an automated fall-detection system at the base, which interfaced with TSE RotaRod V4.2.6 system (TSE Laboratory, Germany) to automatically terminate the timer upon the animal’s fall. Animals underwent a two-day habituation and training protocol. On Day 1, each mouse was placed individually on the rotating rod, which was maintained at a constant speed of five revolutions per minute (rpm) for a duration of three minutes. Should the animal have fallen before the allotted time elapses, it was promptly repositioned on the rod. Following the initial session, the animal was returned to its home-cage, and the procedure was repeated twice more at 30-minute intervals. On Day 2, the training procedure was repeated, with the rotation speed increased to a constant 10 rpm, thereby introducing a higher motoric challenge and reinforcing task familiarity. The testing phase was conducted on Day 3. During this phase, animals were placed on the rod, which now accelerated linearly from 5 to 40 rpm over a 3-minute period. Each animal underwent three test trials, with a 30-minute inter-trial interval. Unlike during training, animals were not returned to the rod after falling. The latency to fall—defined as the time the animal remained on the rod before falling—was recorded automatically via the tracking software. The average latency across the three test trials served as the composite performance score for each subject, reflecting overall motor coordination and skill retention under increasing demands.

2.5. Ultra-High-Performance Liquid Chromatography with Tandem Mass Spectrometry (UHPLC-MS/MS)

2.5.1. Brain Samples

We used a randomized, blinded, region-resolved design that integrates targeted liquid chromatography with tandem mass spectrometry (LC-MS/MS) metabolomics with a standardized behavioral battery in kat2 knockout and WT mice, and we report procedures according to ARRIVE 2.0 to maximize reproducibility. Regarding the brain samples, following the determination of tissue weights, the samples were homogenized using an ultrasonic homogenizer (UP100H, Hielscher Ultrasound Technology, Germany) set to 100% amplitude and a 0.5 cycle setting. Homogenization was performed in threefold volumes of ice-cooled LC-MS grade water relative to tissue mass (e.g., 90 µl of water was added to 30.0 mg of tis-sue). We quantified Trp-KYN, serotonergic, and indole metabolites, plus catecholamine intermediates and selected cofactors, using previously published multiplex LC-MS/MS methods and protocols [123,124]. For PA, the MRM transition was 124.0 → 106.0 m/z, with a retention time of 1.21 min, using a declustering potential of 75 V and a collision energy of 13 V. For ICA, the MRM transition was 146.1 → 118.0 m/z, with a retention time of 12.40 min, using a declustering potential of 50 V and a collision energy of 19 V. For IPA, the MRM transition was 190.1 → 130.1 m/z, with a retention time of 13.00 min, using a declustering potential of 50 V and a collision energy of 19 V. For ILA, the MRM transition was 206.1 → 188.1 m/z, with a retention time of 12.00 min, using a declustering potential of 50 V and a collision energy of 13 V. For INS, the MRM transition was 211.9 → 131.9 m/z, with a retention time of 11.80 min, using a declustering potential of -50 V and a collision energy of -25 V. For pCS, the MRM transition was 186.9 → 107.0 m/z, with a retention time of 12.70 min, using a declustering potential of -50 V and a collision energy of -26 V. All reagents and chemicals were of analytical or liquid chromatography–mass spectrometry grade. Trp and its metabolites, and their deuterated forms: d4-serotonin, d5-tryptophan, d4-kynurenine, d5-kynurenic acid, d4-xanthurenic acid, d5-5-hydroxyindole-acetic acid, d3-3-hydroxyanthranilic acid, d4-picolinic acid, and d3-quinolinic acid were purchased from Toronto Research Chemicals (Toronto, ON, Canada). d3-3-hydroxykynurenine was obtained from Buchem B. V. (Apeldoorn, The Netherlands). Acetonitrile (ACN) was provided by Molar Chemicals (Halásztelek, Hungary). Methanol (MeOH) was purchased from LGC Standards (Wesel, Germany). Formic acid (FA) and water were obtained from VWR Chemicals (Monroeville, PA, USA). The UHPLC-MS/MS system consisted of a PerkinElmer Flexar UHPLC system (two FX-10 binary pumps, solvent manager, autosampler and thermostatic oven; all PerkinElmer Inc. (Waltham, MA, USA)), coupled to an AB SCIEX QTRAP 5500 MS/MS triple quadrupole mass spectrometer and controlled by Analyst 1.7.1 software (both AB Sciex, Framingham, MA, USA).

2.5.2. Plasma and Urine Samples

Plasma and urine samples were collected, prepared and measured according to previously published methodologies [67,123,124].

2.6. The Enzyme Activities of Tryptophan (Trp) Metabolism

The enzyme activity of Trp metabolism was estimated by calculating the ratio of the product-to-substrate concentration ratio.

2.7. Oxidative Stress and Excitotoxicity Indices

The oxidative stress index was derived by calculating the ratio between the concentration of the presumed pro-oxidant metabolite 3-HK and the combined concentrations of the putative antioxidant metabolites KYNA, anthranilic acid (AA), and xanthurenic acid (XA) (Eq. 4).
O x i d a t i v e s t r e s s i n d e x = [ 3 h y d r o x y k y n u r e n i n e ] K y n u r e n i c a c i d + A n t h r a n i l i c a c i d + [ X a n t h u r e n i c a c i d ]
The excitotoxicity index was determined by computing the ratio of quinolinic acid (QA), an NMDA receptor agonist, to KYNA, an endogenous NMDA receptor antagonist (Eq. 5).
E x c i t o t o x i c i t y i n d e x = [ Q u i n o l i n i c a c i d ] K y n u r e n i c a c i d

2.8. Statistical Analysis

We performed statistical analyses using IBM SPSS Statistics version 28.0.0.0 (IBM Corp., Armonk, NY, USA). The normality of data distribution was assessed with the Shapiro-Wilk test, and Q-Q plots were additionally employed to evaluate whether two datasets originated from the same distribution.
In the statistical evaluation of the NORT, OBAT and Y-maze, 3CT and rotarod test, inter-strain comparisons were performed using the independent samples t-test for normally distributed data, whereas the non-parametric Mann-Whitney U test was employed in cases where the assumption of normality was violated. Intra-strain comparisons of individual parameters were carried out using the paired samples t-test when data conformed to a normal distribution, and the Wilcoxon signed-rank test was applied for non-normally distributed datasets.
For the MBT, a mixed ANOVA model was used, followed by the Tamhane post-hoc test.
Regarding the UHPLC-MS/MS measurements, the normality of the variables was checked using the Kolmogorov-Smirnov test and visually checked using quantile-quantile plots, and the equality of variances was examined using Welch’s F-test. Outliers were identified using Grubbs’s test. Comparisons between the two groups were conducted using an independent samples t-test.
Values p < 0.05 were considered statistically significant. Our data are reported as means ± standard deviations (SD) for all parameters and experimental groups.

3. Results

3.1. Behavioral Tests

3.1.1. Novel Object Recognition Test (NORT)

During the NORT, both WT and kat2-/- animals spent significantly more time interacting with the novel object compared to the familiar one. However, no significant differences were detected between the strains (Figure 2, Table 1, Table 2).

3.1.2. Object-Based Attention Test (OBAT)

In the OBAT, no statistically significant differences were detected between the strains in terms of overall object interaction time. Nonetheless, animals from the kat2-/- strain exhibited a marked preference for the novel object, spending significantly more time engaging with it compared to the familiar object during testing phase (Figure 2, Table 1, Table 2).

3.1.3. Three Chamber Test (3CT)

During the 3CT, both examined strains spent significantly less time in the lateral chambers compared to the central starting chamber in both the second and third phases of the test. Apart from this difference, no other significant variations were observed (Figure 2, Table 1, Table 2).

3.1.4. Other Behavioral Tests

No significant differences were observed between the strains or within strains in the Y-maze, MBT, and rotarod tests (Figure 2, Table 1).

3.2. Ultra-High-Performance Liquid Chromatography with Tandem Mass Spectrometry (UHPLC-MS/MS)

Several differences were observed between the WT and mutant strains in the various brain regions eamined during the chemical analytical measurements (Figure 3, Figure 4, Figure 5, Table 3). The most prominent difference was observed in the level of 3-HK, which was uniformly and significantly increased in all examined brain regions of the kat2-/- strain compared to the WT. In a similar pattern, xanthurenic acid (XA) levels were reduced across all analyzed regions relative to the WT. In contrast, the concentration of KYNA, whose alteration was most strongly anticipated, exhibited a significant reduction only in the CTX and HIPP; however, the level of KYNA is increased in the STR. Interestingly, the level of its downstream metabolite, quinaldic acid (QAA), remained unaltered in these same areas, while a marked decrease was observed in the CRB and STEM.
In addition to the detailed concentration values presented above, a region- and matrix-integrated overview of metabolite alterations is provided (Table 3). Consistent across all examined brain regions, 3-HK was significantly elevated, whereas XA showed a uniform reduction, underscoring a shift toward an oxidative and excitotoxic milieu. KYNA exhibited a divergent pattern, being decreased in the CTX and HIPP yet elevated in the STR, while QAA was selectively reduced in the CER and STEM. Within the serotonergic pathway, 5-hydroxytryptophan (5-HTP) declined in CTX and CER, whereas 5-HT increased in CTX and urine, indicating altered turnover. Further changes included decreased Tyrin CTX and HIPP and selective reductions in pterins. Peripheral findings in plasma and urine, previously published, are integrated here for comparison, emphasizing the concordance between central and systemic metabolic rewiring.
Complementing our previous measurements of Trp metabolite levels in plasma and urine, we also measured the concentrations of additional metabolites from the indole-pyruvate and TYR-DA pathways; however, we observed significant changes only in 3-methoxy-4-hydroxyphenylglycol sulphate (MHPGS) levels compared to WT (Table 4, Figure 5).

3.3. Enzyme Activities

Enzyme activity ratios revealed pronounced remodeling of tryptophan metabolic fluxes in kat2−/− mice (Figure 6, Table 5). As expected, KAT activity (KYN/Trp) displayed a selective reduction in the STR, consistent with the genetic deletion of KAT II. Conversely, KMO activity (3-HK/KYN) was markedly elevated across STR, CTX, HIPP, CER, and STEM, indicating enhanced pro-oxidant pressure through 3-HK production. KYNU activity (3-HAA/3-HK) showed a modest yet significant increase in the HIPP, while KAT III activity (XA/3-HK) was consistently reduced in CTX, HIPP, CER, and STEM, reinforcing the loss of protective XA formation. Within the serotonergic arm, tryptophan hydroxylase (TPH) activity (5-HTP/Trp) was reduced in CTX and CER, whereas aromatic L-amino acid decarboxylase (AADC) activity (5-HT/5-HTP) was elevated in STR, CTX, and HIPP, suggesting compensatory 5-HT turnover. MAO/ALDH activity (5-HIAA/5-HT) was decreased only in CTX, while TMO activity (IAA/Trp) was reduced in CTX, HIPP, and CER. Collectively, these shifts highlight a pathway-specific reorganization, with KMO dominance, curtailed XA buffering, and altered 5-HT–indole dynamics shaping the kat2−/− metabolic phenotype.

3.4. Oxidative Stress and Ecitotoxicity Indices

To further evaluate the balance between oxidative pressure and excitotoxic potential, we calculated composite indices from key KYN metabolites (Figure 7, Table 6). The oxidative stress index, defined as 3-HK/(KYNA+AA+XA), was significantly elevated in multiple brain regions of kat2−/− mice. Compared to wild-type controls, the CTX, HIPP, CER, and STEM all exhibited marked increases, with the HIPP and STEM showing the most robust elevations. This pattern reflects the combined impact of increased 3-HK and reduced antioxidant metabolites, underscoring a shift toward pro-oxidant load. In contrast, the excitotoxicity index, measured as QA/KYNA, showed a more selective profile. While values remained unchanged in STR, CTX, and CER, a significant increase emerged in the HIPP, where diminished KYNA coincided with elevated QA. A similar trend, though nonsignificant, was observed in the STEM. Taken together, these data indicate that KAT II deficiency imposes a dual burden of oxidative stress and region-specific excitotoxic vulnerability, with the HIPP emerging as a particularly sensitive locus of metabolic imbalance.
Results begin with region-resolved metabolomics across STR, CTX, HIPP, CER, and STEM, followed by enzyme-ratio proxies, cofactor mapping, and alignment with behavioral outcomes. A convergent central signature emerges: 3-HK increases and XA decreases pan-regionally, KYNA reduction localizes to CTX and HIPP, KMO activity indices rise while KAT III flux falls, and oxidative-stress measures increase broadly, with a hippocampal-specific rise in the excitotoxicity index. Cofactor analyses identify BIO depletion in CER and STEM and BH2 loss in CER. Gut–brain and serotonergic markers also shift, with hippocampal IAA reduction, cortical and cerebellar ICA elevation, and reduced cortical 5-HT turnover, yet cognition, sociability, and coordination remain intact. Consistent with region-specific rewiring rather than a uniform kat2 effect, we note a paradoxical pattern: striatal KYNA elevation likely reflects compensatory KAT isoforms or astrocyte-mediated KYN shunting; forebrain bias toward AA aligns with oxidative-stress–driven KMO→KYNU flux that diverts 3-HK from KYNA. In sum, findings delineate a KMO-tilted, pterin-constrained, indole-modulated milieu that selectively burdens affective and motor subdomains while sparing core cognitive and social functions.

4. Discussion

The metabolism of Trp has emerged as a central hub in the neurobiology of cognition, mood, and social behavior, with imbalances along its KYN, 5-HT, indole, and DA branches increasingly linked to neuropsychiatric and neurodegenerative disorders [15,16,22,28,39]. Within this network, KAT II has been considered the dominant enzymatic source of KYNA, a metabolite long viewed as neuroprotective through NMDA, α7-nAChR, AMPA, and kainate antagonism [20,67,125,126,127,128,129,130]. Yet, earlier reports of global KAT II inhibition or genetic deletion left unresolved how local shifts in KYNA and related metabolites shape functional brain states [20,28,67,126,129,131]. By combining region-resolved metabolomics with behavioral phenotyping, our study addresses this gap, asking whether neurochemical disequilibria in KAT II deficiency necessarily translate into overt cognitive, motor, or social dysfunction [20,22,67,132,133].
The metabolic profile emerging from kat2/ brains reveals a striking shift toward a pro-oxidant milieu, characterized by pan-regional accumulation of 3-HK and consistent loss of XA, with an additional region-selective reduction of KYNA in CTX and HIPP. Such changes converge on a biochemical signature that indicates heightened KMO activity alongside impaired KAT II flux, effectively tilting the KYN pathway toward neurotoxic branch products [35,67,134]. The imbalance between reduced antioxidant buffering (XA, KYNA) and sustained excitatory drive amplifies oxidative-stress indices across regions, with the HIPP exhibiting a peak excitotoxicity signal. This constellation suggests that, although behavioral performance remained intact, the HIPP in particular resides in a precarious metabolic state, vulnerable to secondary insults [135]. Thus, the observed disequilibrium highlights a latent central risk architecture, in which KAT II deficiency may predispose selective circuits to degeneration under stress or aging.
The selective decline of KYNA in HIPP and CTX is particularly consequential, as these structures form the backbone of glutamatergic integration underlying memory, attentional control, and affective regulation [126,136,137,138,139,140]. Lower KYNA levels in these regions imply diminished tonic antagonism at NMDA and α7-nicotinic receptors, a state that can facilitate plasticity yet simultaneously heighten vulnerability to excitotoxic cascades. Such changes resonate with the well-documented link between KYN pathway imbalance and affective or cognitive disturbances. In contrast, the cerebellar and STEM pattern, where QAA and related metabolites decline, speaks to circuits subserving motor coordination and arousal [126,136,137,141]. Here, altered metabolic buffering could subtly recalibrate sensorimotor integration and vigilance states, aligning with CER–STEM contributions to motor timing and autonomic tone. Together, these region-specific shifts underscore circuit-level rebalancing rather than global disruption.
The consistent elevation of 3-HK across regions, paralleled by a decline in XA, underscores a shift toward a redox-imbalanced milieu that favors oxidative stress [142,143,144]. This pro-oxidant tilt is further amplified when considered in the context of derived indices, where the 3-HK–to–antioxidant ratio signals a vulnerability state rather than an immediate injury [142,143,144]. In parallel, the excitotoxicity index, weighted by QA/KYNA balance, delineates selective windows in which NMDA drive may outweigh intrinsic antagonism [142,143,145]. These biochemical loads, however, need not manifest uniformly as behavioral deficits at baseline. Instead, they may represent latent liabilities, poised to surface under developmental, aging, or environmental stressors, thereby marking a hidden susceptibility rather than an overt phenotype [15,143,144].
Region-specific perturbations in the pterin pool highlight a subtle but consequential layer of metabolic vulnerability [146,147,148]. In kat2−/− hindbrain, the concurrent depletion of BIO and loss of BH2 suggest an erosion of the redox-cycling capacity that normally safeguards BH4 availability [146,147,148]. Because BH4 is indispensable for tyrosine hydroxylase activity, even modest shifts in this cofactor equilibrium may attenuate DA biosynthesis and, secondarily, compromise broader monoaminergic tone [146,147,148,149]. These alterations could reverberate into nitric oxide biology, given that endothelial and neuronal nitric oxide synthase (NOS) also require BH4, thereby coupling monoamine insufficiency to redox imbalance and impaired vasomodulation [146,147,148].
The neurochemical profile in kat2−/− mice suggests that reduced serotonergic turnover in the CTX converges with decreased hippocampal IAA and concomitant elevations of ICA in cortical and cerebellar regions to shape circuit-level excitability [150,151,152]. Lower 5-HT turnover may weaken cortical inhibitory tone, thereby amplifying the impact of indole-derived signaling [151,152]. The reduction of IAA, a ligand with protective barrier and anti-inflammatory properties, contrasts with the elevation of ICA, a potent AhR agonist capable of reprogramming microglial states [150,151,152]. Through this shift, cortical and cerebellar microglia may adopt transcriptional phenotypes that subtly recalibrate glutamatergic drive and synaptic responsiveness [150,151,152]. Such AhR-mediated modulation, in concert with altered serotonergic dynamics, delineates a mechanism by which KAT II deficiency reshapes microcircuit stability without overtly impairing cognitive or social behaviors.
The parallel remodeling of Trp metabolism across central and peripheral compartments suggests a degree of concordance that greatly enhances translational traction [15,153,154]. When brain signatures mirror those detected in plasma or urine—such as the uniform elevation of 3-HK and the consistent reduction in XA—biomarker feasibility is strengthened because measurements in accessible fluids reliably report on neurochemical states [15,153,154]. This concordance further supports longitudinal monitoring, since repeated peripheral sampling can index dynamic shifts in pathway fluxes without invasive procedures [15,153,154]. Importantly, the pattern of a KMO-tilted, pterin-constrained phenotype provides a stratification handle: individuals or models exhibiting this profile may constitute a distinct subgroup marked by heightened oxidative burden and diminished neuroprotection [15,131,153]. Thus, the central–peripheral alignment not only validates observed signatures but also operationalizes them for precision tracking and targeted intervention.
Despite a pervasive biochemical tilt toward oxidative stress and excitotoxic vulnerability, baseline cognition and sociability remain largely preserved in kat2−/− mice. This dissociation likely reflects both redundancy within cognitive and social circuits and compensatory plasticity that stabilizes performance until a higher stress threshold is breached [67,155,156]. Cortico-hippocampal KYNA loss may sensitize affective and attentional pathways, but parallel buffering via dopaminergic and indole-linked mechanisms appears sufficient to maintain recognition memory and sociability in standard tasks. In contrast, motor and affective domains, subserved by CER–STEM loops and stress-responsive hippocampal circuits, manifest early pressure, consistent with lower redundancy and higher task sensitivity. These findings underscore that metabolic disequilibria need not uniformly generalize to behavior and that endpoint detectability hinges on domain-specific thresholds. For experimental design, this argues against relying solely on cognition- or sociability-based readouts and instead favors composite panels that capture latent affective or motor liabilities, especially when probing therapeutic interventions or stress challenges.
The paradoxical distribution of metabolites across brain regions points to a region-specific metabolic rewiring rather than a uniform effect of kat2 loss [125,157]. Striatal KYNA increased, while it declined in CTX and HIPP and remained unchanged in CER and STEM. This striatal KYNA elevation in the absence of kat2 likely arises from alternative KAT isoform activity or astrocyte-mediated KYN shunting, consistent with the region’s dense dopaminergic and glial milieu [158]. In contrast, plasma and urine showed marked KYNA reductions, underscoring that regional enzymatic compensation and astrocytic buffering, rather than systemic availability, govern KYN metabolism within the brain.
Serotonergic metabolism revealed equally complex shifts. 5-HTP fell consistently in STR, CTX, and CER, suggesting precursor depletion, yet cortical 5-HT paradoxically rose. This contrast hints at selective upregulation of decarboxylase activity or altered transporter dynamics in cortical circuits. Importantly, urine samples captured a 5-HT increase, while plasma remained unaltered—underscoring a clear brain–periphery mismatch. Similarly, Trp declined in CTX and HIPP but stayed unchanged peripherally, whereas KYN itself was stable in brain yet shifted downward in plasma and upward in urine.
Other metabolites highlighted both paradoxical and stable nodes. 3-HK rose broadly across central and peripheral compartments, but its downstream metabolite XA decreased everywhere, revealing a systemic enzymatic bottleneck. AA, however, increased in CTX but decreased in HIPP and STEM, with no peripheral reflection. Several intermediates, including Tyr and 3-HAA, remained stable in most regions, pointing to strong compensatory buffering. Taken together, these findings illustrate that kat2 deletion drives a patchwork of paradoxical imbalances, where regional demands, oxidative stress, and glial density dictate divergent metabolic trajectories, while peripheral readouts capture only a partial, homogenized snapshot of these changes.
Furthermore, the single-gene kat2 knockout, which markedly reduces KYNA concentrations, exerts consequences that extend far beyond the KYN branch alone. The disruption alters the enzymatic dynamics and metabolite distribution of the Trp–KYN axis, but also propagates into parallel domains such as serotonin biosynthesis, indole-pyruvate flux, and DA turnover. These cross-pathway perturbations likely emerge from shared substrate dependencies and competitive enzymatic hierarchies, wherein the depletion of one metabolic sink amplifies pressure on adjacent routes. In particular, diminished serotonin availability can be interpreted as a direct consequence of altered Trp partitioning, whereas DA irregularities appear linked to secondary changes in redox balance and cofactor utilization. Thus, kat2 deletion should not be conceptualized merely as a KYNA-specific deficit; rather, it reshapes a broader neurochemical network in which serotonergic, dopaminergic, and indole-derived pathways become entrained into a cascade of adaptive yet destabilizing responses.
A key strength of this study lies in the methodological rigor that enabled reliable mapping of subtle, region-specific metabolic shifts. The UHPLC-MS/MS workflow was not only optimized for brain tissue matrices but was applied in a region-resolved fashion, thereby allowing contrasts across CTX, HIPP, STR, CER, and STEM rather than relying on pooled homogenates [159,160,161]. Enzyme activities were inferred through calibrated product–substrate ratios, providing functional proxies that extend beyond absolute metabolite abundance [159,161,162]. Importantly, these measurements were embedded in a multi-axis coverage that integrated KYN, serotonergic, indole-derived, and catecholamine pathways. Behavioral assays were performed with a balanced panel that minimizes habituation or training artifacts. Such a design requires a composite technical skill set—ranging from advanced metabolomics and stringent quality control pipelines to expertise in behavioral neuroscience and translational modeling—ensuring robust and reproducible interpretation.
Several limitations should be recognized when interpreting these findings. First, the study design relied on baseline-only testing, which restricts inference on developmental trajectories or dynamic responses to stressors [163,164,165]. Bulk tissue homogenates were analyzed, inevitably averaging across heterogeneous cell types and masking circuit-specific alterations [163,165,166]. The absence of cell-type resolution is particularly relevant, as astrocytic and neuronal pools may contribute divergently to KYN pathway flux [163,165,166]. Temporal resolution was also limited to a single time point, precluding assessment of circadian phase–dependent or activity-driven fluctuations [163,165,167]. Sex and age effects remain underpowered, raising the possibility that strain differences may emerge in females or in older cohorts [163,165,166]. Likewise, the microbiome context was not systematically profiled, despite its known capacity to shape Trp-indole metabolism. Finally, circadian control was standardized but not manipulated, and phase-dependent metabolic reorganization could shift interpretations [163,165,167].
The neurochemical profile observed in kat2−/− mice points toward several therapeutic avenues [67,129,143,168]. Elevated 3-HK alongside reduced XA underscores excessive KMO flux, highlighting selective KMO inhibition as a rational intervention to rebalance the neuroprotective–neurotoxic equilibrium [168,169]. At the same time, the consistent depletion of BH4 and riboflavin-sensitive cofactor pools suggests that restoring the pterin milieu could stabilize DA synthesis and restrain aberrant redox cycling [129,168]. Antioxidant strategies targeting the 3-HK–driven oxidative load may provide additional neuroprotection, particularly in regions where KYNA is diminished [55,129]. Importantly, our data emphasize the need for composite biomarker frameworks that integrate peripheral indices of KYN pathway activity with region-sensitive readouts such as KYNA/QAA ratios, thereby offering translational precision in stratifying patients [55,67,168,170]. These convergent insights open the path toward mechanism-guided interventions that cut across psychiatric and neurodegenerative spectra [55,67,168].
Moving forward, the central challenge is to shift from descriptive associations toward mechanistic causation [131,171,172]. Stable-isotope–based in vivo flux tracing could clarify how KMO and KAT activities dynamically shape regional metabolite pools under physiological and stress conditions [171,173]. Complementary pharmacologic or genetic rescue experiments, targeting either KMO suppression or KAT reconstitution, will be critical to determine reversibility and compensatory limits of the pathway [128,131,171]. Behavioral paradigms that introduce stress load or learning demands should be layered on top of biochemical profiling to reveal context-dependent vulnerabilities [172,173,174,175,176]. Spatial metabolomics, single-cell resolution analytics, and mesoscale circuit physiology offer the means to connect biochemical imbalances with cellular and network-level adaptations [171,173,176,177,178]. Finally, microbiome manipulation stands as a tractable lever to probe gut–brain indole inputs [131,171,173,179,180,181]. Integrating these platforms will close the loop from correlation to causation, refining translational targets across psychiatric and neurodegenerative disease contexts [176,182,183,184].
KAT II loss establishes a distinctive biochemical landscape marked by a KMO-driven tilt, reduced pterin support, and modulation through indole intermediates. This state disproportionately burdens affective and motor circuits, evident in elevated 3-HK, reduced XA, and region-specific KYNA/QAA shifts, while sparing cognition and sociability under baseline conditions. Such dissociation between neurochemical disequilibria and behavioral resilience highlights the selective vulnerability of motor and emotional nodes. Crucially, these pathway imbalances converge into a coherent, biomarker-ready framework that not only clarifies mechanistic underpinnings of Trp metabolism but also provides a tractable platform for targeted intervention strategies in neuropsychiatric disease contexts.

5. Conclusions

This work integrates region-resolved metabolomics across the STR, CTX, HIPP, CER, and STEM with enzyme-ratio proxies, cofactor mapping, and behavioral readouts. A convergent central signature emerges: 3-HK increases and XA decreases pan-regionally, KYNA reduction localizes to CTX and HIPP, KMO activity indices rise while KAT III flux falls, and oxidative-stress measures increase broadly, with a hippocampal-specific rise in the excitotoxicity index. Cofactor analyses identify BIO depletion in CER and STEM and BH2 loss in CER. Gut–brain and serotonergic markers also shift, with hippocampal IAA reduction, cortical and cerebellar ICA elevation, and reduced cortical 5-HT turnover, yet cognition, sociability, and coordination remain intact. Consistent with region-specific rewiring rather than a uniform kat2 effect, we note a paradoxical pattern: striatal KYNA elevation likely reflects compensatory KAT isoforms or astrocyte-mediated KYN shunting; forebrain bias toward AA aligns with oxidative-stress–driven KMO→KYNU flux that diverts 3-HK from KYNA. Taken together, the KAT II/kat2 loss establishes a reproducible brain–periphery signature (KYNA↓, 3-HK↑, region-tuned KMO/KAT flux) without broad baseline behavioral deficits—best interpreted as evidence of circuit rewiring that buffers output, i.e., whole-axis metabolic disturbance does not immediately translate into behavior. This framing motivates mechanism-targeted interventions (e.g., KMO inhibition, cofactor restoration, antioxidant support) and argues for biomarker-informed stratification. In sum, findings delineate a KMO-tilted, pterin-constrained, indole-modulated milieu that selectively burdens affective and motor subdomains while sparing core cognitive and social functions.

Author Contributions

Conceptualization, Á.S., Z.G., J.T., E.O., L.V., and M.T.; methodology, Á.S., Z.G., E.S., D.M., M.S., A.F-S., Á.F., K.T., K.O., H.I., S.Y., P.M.; software, Á.S., Z.G., E.S., M.S., A.F-S., Á.F., K.O., P.M.; validation, Á.S., Z.G., E.S., M.S., A.F-S., Á.F., K.T., K.O., and P.M.; formal analysis, Á.S., Z.G., E.S., M.S., A.F-S., Á.F., K.O., and P.M.; investigation, Á.S., Z.G., E.S., D.M., M.S., A.F-S., Á.F., K.T., and K.O.; resources, Á.S., Z.G., P.M. and E.O.; data curation, Á.S., Z.G., E.S., M.S., A.F-S., Á.F., K.O.; writing—original draft preparation, Á.S., Z.G., and M.T.; writing—review and editing, Á.S., Z.G., E.S., D.M., M.S., J.T., E.O., L.V., and M.T.; visualization, Á.S.; supervision, P.M., J.T., E.O., L.V., and M.T.; project administration, P.M., J.T., E.O., and L.V.; funding acquisition, P.M., J.T., E.O., L.V., and M.T. All authors have read and agreed to the published version of the manuscript. All authors contributed to editorial changes in the manuscript. All authors read and approved the final manuscript. All authors have participated sufficiently in the work and agreed to be accountable for all aspects of the work.

Funding

This work was supported by the National Research, Development, and Innovation Office (NKFIH K138125), SZTE SZAOK-KKA (No:2022/5S729), the HUN-REN Hungarian Research Network, the Ministry of Human Capacities, Hungary (grant TKP-2021-EGA-32), the ÚNKP-22-4-SZTE-166 New National Excellence Program of the Ministry for Culture and Innovation from the source of the National Research, Development and Innovation Fund, the JSPS Joint Research Projects under Bilateral Programs (Grant Number JPJSBP120203803), and the University of Szeged Open Access Fund, Grant ID: 7571.

Institutional Review Board Statement

The study was conducted in accordance with the Regulations for Animal Experiments of Kyushu University, the Fundamental Guidelines for Proper Conduct of Animal Experiments and Related Activities in Academic Research Institutions governed by the Ministry of Education, Culture, Sports, Science, and Technology of Japan, and with the approval of the Institutional Animal Experiment Committees of Kyushu University (A29-338-1 (2018), A19-090-1 (2019)), and approved by the National Food Chain Safety Office (XI./1008/2025, CS/I01/170-4/2022).

Data Availability Statement

The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding authors.

Acknowledgments

The figures were created with BioRender (https://biorender.com (accessed on 3 September 2025)).

Conflicts of Interest

The authors declare that they have no conflicts of interest and have received no payment for the preparation of their manuscript.

Abbreviations

The following abbreviations are used in this manuscript:
3-HAA 3-hydroxyanthranilic acid
3-HK 3-hydroxykynurenine
3CT three-chamber test
5-HT 5-hydroxytryptamine (serotonin)
5-HTP 5-hydroxytryptophan
5-HIAA 5-hydroxyindoleacetic acid
AA anthranilic acid
AADC aromatic L-amino acid decarboxylase
ALDH aldehyde dehydrogenase
ARRIVE animal research: reporting of in vivo experiments
ASD autism spectrum disorder
BBB blood-brain barrier
BH2 dihydrobiopterin
BH4 tetrahydrobiopterin
BIO biopterin
CER cerebellum
CNS central nervous system
CTX cortex
DA dopamine
DI discrimination index
DOPAC 3,4-dihydroxyphenylacetic acid
GAD generalized anxiety disorder
HIPP hippocampus
IAA indole-3-acetic acid
ICA indole-3-carboxylic acid
INS indoxyl sulfate
KAT kynurenine aminotransferase
KMO kynurenine 3-monooxygenase
KYN kynurenine
KYNA kynurenic acid
KYNU kynureninase
L-DOPA dihydroxyphenylalanine/levodopa
LC-MS liquid chromatography–tandem mass spectrometry
MAO monoamine oxidase
MBT marble burying test
MDD major depressive disorder
MEL melatonin
MHPGS 3-methoxy-4-hydroxyphenylglycol sulphate
NMDA N-methyl-D-aspartate
NORT novel object recognition test
OBAT object-based attention test
PI preference index
QA quinolinic acid
QAA quinaldic acid
SCZ schizophrenia
STEM brainstem
STR striatum
Trp tryptophan
TPH tryptophan hydroxylase
Tyr tyrosine
UHPLC-MS ultra-high-performance liquid chromatography–tandem mass spectrometry
VMA vanillylmandelic acid
WT wild-type
XA xanthurenic acid

References

  1. Gupta, R.; Advani, D.; Yadav, D.; Ambasta, R.K.; Kumar, P. Dissecting the Relationship Between Neuropsychiatric and Neurodegenerative Disorders. Mol Neurobiol 2023, 60, 6476–6529. [Google Scholar] [CrossRef]
  2. Grezenko, H.; Rodoshi, Z.N.; Mimms, C.S.; Ahmed, M.; Sabani, A.; Hlaing, M.S.; Batu, B.J.; Hundesa, M.I.; Ayalew, B.D.; Shehryar, A.; et al. From Alzheimer’s Disease to Anxiety, Epilepsy to Schizophrenia: A Comprehensive Dive Into Neuro-Psychiatric Disorders. Cureus 2024, 16, e58776. [Google Scholar] [CrossRef]
  3. Nadeem, M.S.; Hosawi, S.; Alshehri, S.; Ghoneim, M.M.; Imam, S.S.; Murtaza, B.N.; Kazmi, I. Symptomatic, Genetic, and Mechanistic Overlaps between Autism and Alzheimer’s Disease. Biomolecules 2021, 11, 1635. [Google Scholar] [CrossRef]
  4. Cummings, J. The Role of Neuropsychiatric Symptoms in Research Diagnostic Criteria for Neurodegenerative Diseases. Am J Geriatr Psychiatry 2021, 29, 375–383. [Google Scholar] [CrossRef]
  5. Peralta, V.; Cuesta, M.J. Motor Abnormalities: From Neurodevelopmental to Neurodegenerative Through “Functional” (Neuro)Psychiatric Disorders. Schizophr Bull 2017, 43, 956–971. [Google Scholar] [CrossRef]
  6. Wang, S.; Jiang, Y.; Yang, A.; Meng, F.; Zhang, J. The Expanding Burden of Neurodegenerative Diseases: An Unmet Medical and Social Need. Aging Dis 2024, 16, 2937–2952. [Google Scholar] [CrossRef] [PubMed]
  7. Aarsland, D.; Batzu, L.; Halliday, G.M.; Geurtsen, G.J.; Ballard, C.; Ray Chaudhuri, K.; Weintraub, D. Parkinson disease-associated cognitive impairment. Nat Rev Dis Primers 2021, 7, 47. [Google Scholar] [CrossRef] [PubMed]
  8. de Lima, E.P.; Tanaka, M.; Lamas, C.B.; Quesada, K.; Detregiachi, C.R.P.; Araújo, A.C.; Guiguer, E.L.; Catharin, V.; de Castro, M.V.M.; Junior, E.B.; et al. Vascular Impairment, Muscle Atrophy, and Cognitive Decline: Critical Age-Related Conditions. Biomedicines 2024, 12, 2096. [Google Scholar] [CrossRef] [PubMed]
  9. Morella, I.M.; Brambilla, R.; Morè, L. Emerging roles of brain metabolism in cognitive impairment and neuropsychiatric disorders. Neurosci Biobehav Rev 2022, 142, 104892. [Google Scholar] [CrossRef]
  10. de Lima, E.P.; Laurindo, L.F.; Catharin, V.C.S.; Direito, R.; Tanaka, M.; Jasmin Santos German, I.; Lamas, C.B.; Guiguer, E.L.; Araújo, A.C.; Fiorini, A.M.R.; et al. Polyphenols, Alkaloids, and Terpenoids Against Neurodegeneration: Evaluating the Neuroprotective Effects of Phytocompounds Through a Comprehensive Review of the Current Evidence. Metabolites 2025, 15, 124. [Google Scholar] [CrossRef]
  11. Li, D.; Yu, S.; Long, Y.; Shi, A.; Deng, J.; Ma, Y.; Wen, J.; Li, X.; Liu, S.; Zhang, Y.; et al. Tryptophan metabolism: Mechanism-oriented therapy for neurological and psychiatric disorders. Front Immunol 2022, 13, 985378. [Google Scholar] [CrossRef] [PubMed]
  12. Davidson, M.; Rashidi, N.; Nurgali, K.; Apostolopoulos, V. The Role of Tryptophan Metabolites in Neuropsychiatric Disorders. Int J Mol Sci 2022, 23, 9968. [Google Scholar] [CrossRef] [PubMed]
  13. Muneer, A. Kynurenine Pathway of Tryptophan Metabolism in Neuropsychiatric Disorders: Pathophysiologic and Therapeutic Considerations. Clin Psychopharmacol Neurosci 2020, 18, 507–526. [Google Scholar] [CrossRef] [PubMed]
  14. Gostner, J.M.; Geisler, S.; Stonig, M.; Mair, L.; Sperner-Unterweger, B.; Fuchs, D. Tryptophan Metabolism and Related Pathways in Psychoneuroimmunology: The Impact of Nutrition and Lifestyle. Neuropsychobiology 2020, 79, 89–99. [Google Scholar] [CrossRef]
  15. Huang, Y.; Zhao, M.; Chen, X.; Zhang, R.; Le, A.; Hong, M.; Zhang, Y.; Jia, L.; Zang, W.; Jiang, C.; et al. Tryptophan Metabolism in Central Nervous System Diseases: Pathophysiology and Potential Therapeutic Strategies. Aging Dis 2023, 14, 858–878. [Google Scholar] [CrossRef]
  16. Xue, C.; Li, G.; Zheng, Q.; Gu, X.; Shi, Q.; Su, Y.; Chu, Q.; Yuan, X.; Bao, Z.; Lu, J.; et al. Tryptophan metabolism in health and disease. Cell Metab 2023, 35, 1304–1326. [Google Scholar] [CrossRef]
  17. Hestad, K.; Alexander, J.; Rootwelt, H.; Aaseth, J.O. The Role of Tryptophan Dysmetabolism and Quinolinic Acid in Depressive and Neurodegenerative Diseases. Biomolecules 2022, 12, 998. [Google Scholar] [CrossRef]
  18. Cervenka, I.; Agudelo, L.Z.; Ruas, J.L. Kynurenines: Tryptophan’s metabolites in exercise, inflammation, and mental health. Science 2017, 357, aaf9794. [Google Scholar] [CrossRef]
  19. Kennedy, P.J.; Cryan, J.F.; Dinan, T.G.; Clarke, G. Kynurenine pathway metabolism and the microbiota-gut-brain axis. Neuropharmacology 2017, 112, 399–412. [Google Scholar] [CrossRef]
  20. Lovelace, M.D.; Varney, B.; Sundaram, G.; Lennon, M.J.; Lim, C.K.; Jacobs, K.; Guillemin, G.J.; Brew, B.J. Recent evidence for an expanded role of the kynurenine pathway of tryptophan metabolism in neurological diseases. Neuropharmacology 2017, 112, 373–388. [Google Scholar] [CrossRef]
  21. Maddison, D.C.; Giorgini, F. The kynurenine pathway and neurodegenerative disease. Semin Cell Dev Biol 2015, 40, 134–141. [Google Scholar] [CrossRef] [PubMed]
  22. Tanaka, M.; Tóth, F.; Polyák, H.; Szabó, Á.; Mándi, Y.; Vécsei, L. Immune Influencers in Action: Metabolites and Enzymes of the Tryptophan-Kynurenine Metabolic Pathway. Biomedicines 2021, 9, 734. [Google Scholar] [CrossRef]
  23. Dehhaghi, M.; Kazemi Shariat Panahi, H.; Guillemin, G.J. Microorganisms, Tryptophan Metabolism, and Kynurenine Pathway: A Complex Interconnected Loop Influencing Human Health Status. Int J Tryptophan Res 2019, 12, 1178646919852996. [Google Scholar] [CrossRef]
  24. Stone, T.W.; Williams, R.O. Tryptophan metabolism as a ‘reflex’ feature of neuroimmune communication: Sensor and effector functions for the indoleamine-2, 3-dioxygenase kynurenine pathway. J Neurochem 2024, 168, 3333–3357. [Google Scholar] [CrossRef]
  25. Badawy, A.A. Kynurenine Pathway of Tryptophan Metabolism: Regulatory and Functional Aspects. Int J Tryptophan Res 2017, 10, 1178646917691938. [Google Scholar] [CrossRef]
  26. Sathyasaikumar, K.V.; Notarangelo, F.M.; Kelly, D.L.; Rowland, L.M.; Hare, S.M.; Chen, S.; Mo, C.; Buchanan, R.W.; Schwarcz, R. Tryptophan Challenge in Healthy Controls and People with Schizophrenia: Acute Effects on Plasma Levels of Kynurenine, Kynurenic Acid and 5-Hydroxyindoleacetic Acid. Pharmaceuticals 2022, 15, 1003. [Google Scholar] [CrossRef]
  27. Hasegawa, M.; Kunisawa, K.; Wulaer, B.; Kubota, H.; Kurahashi, H.; Sakata, T.; Ando, H.; Fujigaki, S.; Fujigaki, H.; Yamamoto, Y.; et al. Chronic stress induces behavioural changes through increased kynurenic acid by downregulation of kynurenine-3-monooxygenase with microglial decline. Br J Pharmacol 2025, 182, 1466–1486. [Google Scholar] [CrossRef]
  28. Fujigaki, H.; Yamamoto, Y.; Saito, K. L-Tryptophan-kynurenine pathway enzymes are therapeutic target for neuropsychiatric diseases: Focus on cell type differences. Neuropharmacology 2017, 112, 264–274. [Google Scholar] [CrossRef]
  29. Martos, D.; Tuka, B.; Tanaka, M.; Vécsei, L.; Telegdy, G. Memory Enhancement with Kynurenic Acid and Its Mechanisms in Neurotransmission. Biomedicines 2022, 10, 849. [Google Scholar] [CrossRef] [PubMed]
  30. Stone, T.W. Does kynurenic acid act on nicotinic receptors? An assessment of the evidence. J Neurochem 2020, 152, 627–649. [Google Scholar] [CrossRef] [PubMed]
  31. Rossi, F.; Miggiano, R.; Ferraris, D.M.; Rizzi, M. The Synthesis of Kynurenic Acid in Mammals: An Updated Kynurenine Aminotransferase Structural KATalogue. Front Mol Biosci 2019, 6, 7. [Google Scholar] [CrossRef]
  32. Nematollahi, A.; Sun, G.; Jayawickrama, G.S.; Church, W.B. Kynurenine Aminotransferase Isozyme Inhibitors: A Review. Int J Mol Sci 2016, 17, 946. [Google Scholar] [CrossRef]
  33. Mor, A.; Tankiewicz-Kwedlo, A.; Krupa, A.; Pawlak, D. Role of Kynurenine Pathway in Oxidative Stress during Neurodegenerative Disorders. Cells 2021, 10, 1603. [Google Scholar] [CrossRef]
  34. Castellano-Gonzalez, G.; Jacobs, K.R.; Don, E.; Cole, N.J.; Adams, S.; Lim, C.K.; Lovejoy, D.B.; Guillemin, G.J. Kynurenine 3-Monooxygenase Activity in Human Primary Neurons and Effect on Cellular Bioenergetics Identifies New Neurotoxic Mechanisms. Neurotox Res 2019, 35, 530–541. [Google Scholar] [CrossRef] [PubMed]
  35. Juhász, L.; Spisák, K.; Szolnoki, B.Z.; Nászai, A.; Szabó, Á.; Rutai, A.; Tallósy, S.P.; Szabó, A.; Toldi, J.; Tanaka, M.; et al. The Power Struggle: Kynurenine Pathway Enzyme Knockouts and Brain Mitochondrial Respiration. J Neurochem 2025, 169, e70075. [Google Scholar] [CrossRef] [PubMed]
  36. Tanaka, M.; Szabó, Á.; Vécsei, L. Redefining Roles: A Paradigm Shift in Tryptophan-Kynurenine Metabolism for Innovative Clinical Applications. Int J Mol Sci 2024, 25, 12767. [Google Scholar] [CrossRef]
  37. Comai, S.; Bertazzo, A.; Brughera, M.; Crotti, S. Tryptophan in health and disease. Adv Clin Chem 2020, 95, 165–218. [Google Scholar] [CrossRef] [PubMed]
  38. Roth, W.; Zadeh, K.; Vekariya, R.; Ge, Y.; Mohamadzadeh, M. Tryptophan Metabolism and Gut-Brain Homeostasis. Int J Mol Sci 2021, 22, 2973. [Google Scholar] [CrossRef]
  39. Höglund, E.; Øverli, Ø.; Winberg, S. Tryptophan Metabolic Pathways and Brain Serotonergic Activity: A Comparative Review. Front Endocrinol (Lausanne) 2019, 10, 158. [Google Scholar] [CrossRef]
  40. Platten, M.; Nollen, E.A.A.; Röhrig, U.F.; Fallarino, F.; Opitz, C.A. Tryptophan metabolism as a common therapeutic target in cancer, neurodegeneration and beyond. Nat Rev Drug Discov 2019, 18, 379–401. [Google Scholar] [CrossRef]
  41. Correia, A.S.; Vale, N. Tryptophan Metabolism in Depression: A Narrative Review with a Focus on Serotonin and Kynurenine Pathways. Int J Mol Sci 2022, 23. [Google Scholar] [CrossRef]
  42. Gibson, E.L. Tryptophan supplementation and serotonin function: genetic variations in behavioural effects. Proc Nutr Soc 2018, 77, 174–188. [Google Scholar] [CrossRef]
  43. Ribeiro, R.F.N.; Santos, M.R.; Aquino, M.; de Almeida, L.P.; Cavadas, C.; Silva, M.M.C. The Therapeutic Potential of Melatonin and Its Novel Synthetic Analogs in Circadian Rhythm Sleep Disorders, Inflammation-Associated Pathologies, and Neurodegenerative Diseases. Med Res Rev 2025, 45, 1515–1539. [Google Scholar] [CrossRef]
  44. Vasey, C.; McBride, J.; Penta, K. Circadian Rhythm Dysregulation and Restoration: The Role of Melatonin. Nutrients 2021, 13. [Google Scholar] [CrossRef]
  45. Kholghi, G.; Eskandari, M.; Shokouhi Qare Saadlou, M.S.; Zarrindast, M.R.; Vaseghi, S. Night shift hormone: How does melatonin affect depression? Physiol Behav 2022, 252, 113835. [Google Scholar] [CrossRef]
  46. Kałużna-Czaplińska, J.; Gątarek, P.; Chirumbolo, S.; Chartrand, M.S.; Bjørklund, G. How important is tryptophan in human health? Crit Rev Food Sci Nutr 2019, 59, 72–88. [Google Scholar] [CrossRef]
  47. Zhou, Y.; Chen, Y.; He, H.; Peng, M.; Zeng, M.; Sun, H. The role of the indoles in microbiota-gut-brain axis and potential therapeutic targets: A focus on human neurological and neuropsychiatric diseases. Neuropharmacology 2023, 239, 109690. [Google Scholar] [CrossRef] [PubMed]
  48. Generoso, J.S.; Giridharan, V.V.; Lee, J.; Macedo, D.; Barichello, T. The role of the microbiota-gut-brain axis in neuropsychiatric disorders. Braz J Psychiatry 2021, 43, 293–305. [Google Scholar] [CrossRef] [PubMed]
  49. Tran, S.M.; Mohajeri, M.H. The Role of Gut Bacterial Metabolites in Brain Development, Aging and Disease. Nutrients 2021, 13. [Google Scholar] [CrossRef] [PubMed]
  50. Gao, K.; Mu, C.L.; Farzi, A.; Zhu, W.Y. Tryptophan Metabolism: A Link Between the Gut Microbiota and Brain. Adv Nutr 2020, 11, 709–723. [Google Scholar] [CrossRef]
  51. Ma, Q.; Xing, C.; Long, W.; Wang, H.Y.; Liu, Q.; Wang, R.F. Impact of microbiota on central nervous system and neurological diseases: the gut-brain axis. J Neuroinflammation 2019, 16, 53. [Google Scholar] [CrossRef]
  52. Jaglin, M.; Rhimi, M.; Philippe, C.; Pons, N.; Bruneau, A.; Goustard, B.; Daugé, V.; Maguin, E.; Naudon, L.; Rabot, S. Indole, a Signaling Molecule Produced by the Gut Microbiota, Negatively Impacts Emotional Behaviors in Rats. Front Neurosci 2018, 12, 216. [Google Scholar] [CrossRef]
  53. Ahmed, H.; Leyrolle, Q.; Koistinen, V.; Kärkkäinen, O.; Layé, S.; Delzenne, N.; Hanhineva, K. Microbiota-derived metabolites as drivers of gut-brain communication. Gut Microbes 2022, 14, 2102878. [Google Scholar] [CrossRef]
  54. Giau, V.V.; Wu, S.Y.; Jamerlan, A.; An, S.S.A.; Kim, S.Y.; Hulme, J. Gut Microbiota and Their Neuroinflammatory Implications in Alzheimer’s Disease. Nutrients 2018, 10. [Google Scholar] [CrossRef]
  55. Chen, C.Y.; Wang, Y.F.; Lei, L.; Zhang, Y. Impacts of microbiota and its metabolites through gut-brain axis on pathophysiology of major depressive disorder. Life Sci 2024, 351, 122815. [Google Scholar] [CrossRef] [PubMed]
  56. Wang, Q.; Yang, Q.; Liu, X. The microbiota-gut-brain axis and neurodevelopmental disorders. Protein Cell 2023, 14, 762–775. [Google Scholar] [CrossRef] [PubMed]
  57. Figueiredo Godoy, A.C.; Frota, F.F.; Araújo, L.P.; Valenti, V.E.; Pereira, E.; Detregiachi, C.R.P.; Galhardi, C.M.; Caracio, F.C.; Haber, R.S.A.; Fornari Laurindo, L.; et al. Neuroinflammation and Natural Antidepressants: Balancing Fire with Flora. Biomedicines 2025, 13. [Google Scholar] [CrossRef] [PubMed]
  58. Ichinose, H.; Aida, R.; Nago-Iwashita, Y.; Moriya, Y.; Ide, S.; Ikeda, K. MODULATION OF THE DOPAMINERGIC NEUROTRANSMISSION BY CONTROLLING THE ACTIVITY OF TYROSINE HYDROXYLASE. International Journal of Neuropsychopharmacology 2025, 28. [Google Scholar] [CrossRef]
  59. Speranza, L.; di Porzio, U.; Viggiano, D.; de Donato, A.; Volpicelli, F. Dopamine: The Neuromodulator of Long-Term Synaptic Plasticity, Reward and Movement Control. Cells 2021, 10. [Google Scholar] [CrossRef]
  60. Oakes, M.; Law, W.J.; Komuniecki, R. Cannabinoids Stimulate the TRP Channel-Dependent Release of Both Serotonin and Dopamine to Modulate Behavior in C. elegans. J Neurosci 2019, 39, 4142–4152. [Google Scholar] [CrossRef]
  61. Marcos, J.; Renau, N.; Valverde, O.; Aznar-Laín, G.; Gracia-Rubio, I.; Gonzalez-Sepulveda, M.; Pérez-Jurado, L.A.; Ventura, R.; Segura, J.; Pozo, O.J. Targeting tryptophan and tyrosine metabolism by liquid chromatography tandem mass spectrometry. J Chromatogr A 2016, 1434, 91–101. [Google Scholar] [CrossRef]
  62. Ney, D.M.; Murali, S.G.; Stroup, B.M.; Nair, N.; Sawin, E.A.; Rohr, F.; Levy, H.L. Metabolomic changes demonstrate reduced bioavailability of tyrosine and altered metabolism of tryptophan via the kynurenine pathway with ingestion of medical foods in phenylketonuria. Mol Genet Metab 2017, 121, 96–103. [Google Scholar] [CrossRef] [PubMed]
  63. Ma, Z.; Stork, T.; Bergles, D.E.; Freeman, M.R. Neuromodulators signal through astrocytes to alter neural circuit activity and behaviour. Nature 2016, 539, 428–432. [Google Scholar] [CrossRef] [PubMed]
  64. Baik, J.H. Stress and the dopaminergic reward system. Exp Mol Med 2020, 52, 1879–1890. [Google Scholar] [CrossRef] [PubMed]
  65. Maleeva, G.; Matera, C.; Roda, S.; Colleoni, A.; De Amici, M.; Gorostiza, P. Molecular Tools to Study and Control Dopaminergic Neurotransmission With Light. Med Res Rev 2025, 45, 1407–1422. [Google Scholar] [CrossRef]
  66. Tanaka, M.; He, Z.; Han, S.; Battaglia, S. Editorial: Noninvasive brain stimulation: a promising approach to study and improve emotion regulation. Front Behav Neurosci 2025, 19, 1633936. [Google Scholar] [CrossRef]
  67. Szabó, Á.; Galla, Z.; Spekker, E.; Szűcs, M.; Martos, D.; Takeda, K.; Ozaki, K.; Inoue, H.; Yamamoto, S.; Toldi, J.; et al. Oxidative and Excitatory Neurotoxic Stresses in CRISPR/Cas9-Induced Kynurenine Aminotransferase Knockout Mice: A Novel Model for Despair-Based Depression and Post-Traumatic Stress Disorder. Front Biosci (Landmark Ed) 2025, 30, 25706. [Google Scholar] [CrossRef]
  68. Li, Y.T.; Zhang, C.; Han, J.C.; Shang, Y.X.; Chen, Z.H.; Cui, G.B.; Wang, W. Neuroimaging features of cognitive impairments in schizophrenia and major depressive disorder. Ther Adv Psychopharmacol 2024, 14, 20451253241243290. [Google Scholar] [CrossRef]
  69. Luo, W.; Luo, L.; Wang, Q.; Li, Y.; Zhang, Y.; Hu, Y.; Yu, Y.; Yu, S.; Lu, F.; Chen, J.; et al. Disorder-specific impaired neurocognitive function in major depression and generalized anxiety disorder. J Affect Disord 2022, 318, 123–129. [Google Scholar] [CrossRef]
  70. Rhee, T.G.; Shim, S.R.; Manning, K.J.; Tennen, H.A.; Kaster, T.S.; d’Andrea, G.; Forester, B.P.; Nierenberg, A.A.; McIntyre, R.S.; Steffens, D.C. Neuropsychological Assessments of Cognitive Impairment in Major Depressive Disorder: A Systematic Review and Meta-Analysis with Meta-Regression. Psychother Psychosom 2024, 93, 8–23. [Google Scholar] [CrossRef]
  71. Bora, E. Peripheral inflammatory and neurotrophic biomarkers of cognitive impairment in schizophrenia: a meta-analysis. Psychol Med 2019, 49, 1971–1979. [Google Scholar] [CrossRef] [PubMed]
  72. MacQueen, G.M.; Memedovich, K.A. Cognitive dysfunction in major depression and bipolar disorder: Assessment and treatment options. Psychiatry Clin Neurosci 2017, 71, 18–27. [Google Scholar] [CrossRef] [PubMed]
  73. Martin, D.M.; Wollny-Huttarsch, D.; Nikolin, S.; McClintock, S.M.; Alonzo, A.; Lisanby, S.H.; Loo, C.K. Neurocognitive subgroups in major depressive disorder. Neuropsychology 2020, 34, 726–734. [Google Scholar] [CrossRef]
  74. Ramos-Chávez, L.A.; Roldán-Roldán, G.; García-Juárez, B.; González-Esquivel, D.; Pérez de la Cruz, G.; Pineda, B.; Ramírez-Ortega, D.; García Muñoz, I.; Jiménez Herrera, B.; Ríos, C.; et al. Low Serum Tryptophan Levels as an Indicator of Global Cognitive Performance in Nondemented Women over 50 Years of Age. Oxid Med Cell Longev 2018, 2018, 8604718. [Google Scholar] [CrossRef] [PubMed]
  75. Hammar, Å.; Ronold, E.H.; Rekkedal, G. Cognitive Impairment and Neurocognitive Profiles in Major Depression-A Clinical Perspective. Front Psychiatry 2022, 13, 764374. [Google Scholar] [CrossRef] [PubMed]
  76. Barbalho, S.M.; Laurindo, L.F.; de Oliveira Zanuso, B.; da Silva, R.M.S.; Gallerani Caglioni, L.; Nunes Junqueira de Moraes, V.B.F.; Fornari Laurindo, L.; Dogani Rodrigues, V.; da Silva Camarinha Oliveira, J.; Beluce, M.E.; et al. AdipoRon’s Impact on Alzheimer’s Disease-A Systematic Review and Meta-Analysis. Int J Mol Sci 2025, 26. [Google Scholar] [CrossRef]
  77. Nunes, Y.C.; Mendes, N.M.; Pereira de Lima, E.; Chehadi, A.C.; Lamas, C.B.; Haber, J.F.S.; Dos Santos Bueno, M.; Araújo, A.C.; Catharin, V.C.S.; Detregiachi, C.R.P.; et al. Curcumin: A Golden Approach to Healthy Aging: A Systematic Review of the Evidence. Nutrients 2024, 16. [Google Scholar] [CrossRef]
  78. Gebreegziabhere, Y.; Habatmu, K.; Mihretu, A.; Cella, M.; Alem, A. Cognitive impairment in people with schizophrenia: an umbrella review. Eur Arch Psychiatry Clin Neurosci 2022, 272, 1139–1155. [Google Scholar] [CrossRef]
  79. van Hal, R.; Geurts, D.; van Eijndhoven, P.; Kist, J.; Collard, R.M.; Tendolkar, I.; Vrijsen, J.N. A transdiagnostic view on MDD and ADHD: shared cognitive characteristics? J Psychiatr Res 2023, 165, 315–324. [Google Scholar] [CrossRef]
  80. Martos, D.; Lőrinczi, B.; Szatmári, I.; Vécsei, L.; Tanaka, M. Decoupling Behavioral Domains via Kynurenic Acid Analog Optimization: Implications for Schizophrenia and Parkinson’s Disease Therapeutics. Cells 2025, 14. [Google Scholar] [CrossRef]
  81. Dounay, A.B.; Tuttle, J.B.; Verhoest, P.R. Challenges and Opportunities in the Discovery of New Therapeutics Targeting the Kynurenine Pathway. J Med Chem 2015, 58, 8762–8782. [Google Scholar] [CrossRef] [PubMed]
  82. Li, S.; Chen, Y.; Chen, G. Cognitive disorders: Potential astrocyte-based mechanism. Brain Research Bulletin 2025, 220, 111181. [Google Scholar] [CrossRef]
  83. Tanaka, M.; Szatmári, I.; Vécsei, L. Quinoline Quest: Kynurenic Acid Strategies for Next-Generation Therapeutics via Rational Drug Design. Pharmaceuticals (Basel) 2025, 18. [Google Scholar] [CrossRef]
  84. Yang, W.; Chen, X.; Li, S.; Li, X.J. Genetically modified large animal models for investigating neurodegenerative diseases. Cell Biosci 2021, 11, 218. [Google Scholar] [CrossRef] [PubMed]
  85. Verbitsky, A.; Dopfel, D.; Zhang, N. Rodent models of post-traumatic stress disorder: behavioral assessment. Transl Psychiatry 2020, 10, 132. [Google Scholar] [CrossRef]
  86. Pan, M.-T.; Zhang, H.; Li, X.-J.; Guo, X.-Y. Genetically modified non-human primate models for research on neurodegenerative diseases. Zoological Research 2024, 45, 263. [Google Scholar] [CrossRef]
  87. Tanaka, M. From Serendipity to Precision: Integrating AI, Multi-Omics, and Human-Specific Models for Personalized Neuropsychiatric Care. Biomedicines 2025, 13. [Google Scholar] [CrossRef]
  88. Tanaka, M. Beyond the boundaries: Transitioning from categorical to dimensional paradigms in mental health diagnostics. Adv Clin Exp Med 2024, 33, 1295–1301. [Google Scholar] [CrossRef]
  89. Truett, G.E.; Heeger, P.; Mynatt, R.L.; Truett, A.A.; Walker, J.A.; Warman, M.L. Preparation of PCR-quality mouse genomic DNA with hot sodium hydroxide and tris (HotSHOT). Biotechniques 2000, 29, 52–54. [Google Scholar] [CrossRef]
  90. Lueptow, L.M. Novel Object Recognition Test for the Investigation of Learning and Memory in Mice. J Vis Exp 2017. [Google Scholar] [CrossRef] [PubMed]
  91. Grayson, B.; Leger, M.; Piercy, C.; Adamson, L.; Harte, M.; Neill, J.C. Assessment of disease-related cognitive impairments using the novel object recognition (NOR) task in rodents. Behav Brain Res 2015, 285, 176–193. [Google Scholar] [CrossRef]
  92. Cohen, S.J.; Stackman, R.W., Jr. Assessing rodent hippocampal involvement in the novel object recognition task. A review. Behav Brain Res 2015, 285, 105–117. [Google Scholar] [CrossRef]
  93. Denninger, J.K.; Smith, B.M.; Kirby, E.D. Novel Object Recognition and Object Location Behavioral Testing in Mice on a Budget. J Vis Exp 2018. [Google Scholar] [CrossRef] [PubMed]
  94. Chao, O.Y.; Nikolaus, S.; Yang, Y.M.; Huston, J.P. Neuronal circuitry for recognition memory of object and place in rodent models. Neurosci Biobehav Rev 2022, 141, 104855. [Google Scholar] [CrossRef]
  95. Wulaer, B.; Kunisawa, K.; Kubota, H.; Suento, W.J.; Saito, K.; Mouri, A.; Nabeshima, T. Prefrontal cortex, dorsomedial striatum, and dentate gyrus are necessary in the object-based attention test in mice. Molecular brain 2020, 13, 171. [Google Scholar] [CrossRef]
  96. Wulaer, B.; Kunisawa, K.; Kubota, H.; Suento, W.J.; Saito, K.; Mouri, A.; Nabeshima, T. Prefrontal cortex, dorsomedial striatum, and dentate gyrus are necessary in the object-based attention test in mice. Mol Brain 2020, 13, 171. [Google Scholar] [CrossRef] [PubMed]
  97. Thiele, A.; Bellgrove, M.A. Neuromodulation of Attention. Neuron 2018, 97, 769–785. [Google Scholar] [CrossRef] [PubMed]
  98. Věchetová, G.; Nikolai, T.; Slovák, M.; Forejtová, Z.; Vranka, M.; Straková, E.; Teodoro, T.; Růžička, E.; Edwards, M.J.; Serranová, T. Attention impairment in motor functional neurological disorders: a neuropsychological study. J Neurol 2022, 269, 5981–5990. [Google Scholar] [CrossRef] [PubMed]
  99. Barone, V.; van Dijk, J.P.; Debeij-van Hall, M.; van Putten, M. A Potential Multimodal Test for Clinical Assessment of Visual Attention in Neurological Disorders. Clin EEG Neurosci 2023, 54, 512–521. [Google Scholar] [CrossRef] [PubMed]
  100. Kraeuter, A.-K.; Guest, P.C.; Sarnyai, Z. The Y-maze for assessment of spatial working and reference memory in mice. In Pre-clinical models: Techniques and protocols; Springer, 2018; pp. 105–111. [Google Scholar]
  101. Kraeuter, A.K.; Guest, P.C.; Sarnyai, Z. The Y-Maze for Assessment of Spatial Working and Reference Memory in Mice. Methods Mol Biol 2019, 1916, 105–111. [Google Scholar] [CrossRef]
  102. Prieur, E.A.K.; Jadavji, N.M. Assessing Spatial Working Memory Using the Spontaneous Alternation Y-maze Test in Aged Male Mice. Bio Protoc 2019, 9, e3162. [Google Scholar] [CrossRef] [PubMed]
  103. Melbiarta, R.R.; Kalanjati, V.P.; Herawati, L.; Salim, Y.; Othman, Z. Analysis of spatial working memory using the Y-maze on rodents treated with high-calorie diet and moderate-intensity exercise. Folia Medica Indonesiana 2022, 59, 40–45. [Google Scholar] [CrossRef]
  104. Dixit, P.V.; Sahu, R.; Mishra, D.K. Marble-burying behavior test as a murine model of compulsive-like behavior. Journal of pharmacological and toxicological methods 2020, 102, 106676. [Google Scholar] [CrossRef] [PubMed]
  105. Dixit, P.V.; Sahu, R.; Mishra, D.K. Marble-burying behavior test as a murine model of compulsive-like behavior. J Pharmacol Toxicol Methods 2020, 102, 106676. [Google Scholar] [CrossRef]
  106. Taylor, G. Marble burying as compulsive behaviors in male and female mice. Acta Neurobiologiae Experimentalis 2017, 77, 254–260. [Google Scholar] [CrossRef]
  107. de Brouwer, G.; Wolmarans, W. Back to basics: A methodological perspective on marble-burying behavior as a screening test for psychiatric illness. Behav Processes 2018, 157, 590–600. [Google Scholar] [CrossRef]
  108. Langer, E.; Einat, H.; Stukalin, Y. Similarities and dissimilarities in the effects of benzodiazepines and specific serotonin reuptake inhibitors (SSRIs) in the defensive marble burying test: A systematic review and meta-analysis. Eur Neuropsychopharmacol 2020, 36, 38–49. [Google Scholar] [CrossRef]
  109. Yang, M.; Silverman, J.L.; Crawley, J.N. Automated three-chambered social approach task for mice. Curr Protoc Neurosci, 2011; 8, Unit 8.26. [Google Scholar] [CrossRef]
  110. Oliver, L.D.; Moxon-Emre, I.; Lai, M.C.; Grennan, L.; Voineskos, A.N.; Ameis, S.H. Social Cognitive Performance in Schizophrenia Spectrum Disorders Compared With Autism Spectrum Disorder: A Systematic Review, Meta-analysis, and Meta-regression. JAMA Psychiatry 2021, 78, 281–292. [Google Scholar] [CrossRef]
  111. Fernandes, J.M.; Cajão, R.; Lopes, R.; Jerónimo, R.; Barahona-Corrêa, J.B. Social Cognition in Schizophrenia and Autism Spectrum Disorders: A Systematic Review and Meta-Analysis of Direct Comparisons. Front Psychiatry 2018, 9, 504. [Google Scholar] [CrossRef]
  112. Morrison, K.E.; Pinkham, A.E.; Penn, D.L.; Kelsven, S.; Ludwig, K.; Sasson, N.J. Distinct profiles of social skill in adults with autism spectrum disorder and schizophrenia. Autism Res 2017, 10, 878–887. [Google Scholar] [CrossRef]
  113. Pinkham, A.E.; Morrison, K.E.; Penn, D.L.; Harvey, P.D.; Kelsven, S.; Ludwig, K.; Sasson, N.J. Comprehensive comparison of social cognitive performance in autism spectrum disorder and schizophrenia. Psychol Med 2020, 50, 2557–2565. [Google Scholar] [CrossRef]
  114. Arakawa, H. Revisiting sociability: Factors facilitating approach and avoidance during the three-chamber test. Physiol Behav 2023, 272, 114373. [Google Scholar] [CrossRef]
  115. Kaidanovich-Beilin, O.; Lipina, T.; Vukobradovic, I.; Roder, J.; Woodgett, J.R. Assessment of social interaction behaviors. J Vis Exp 2011. [Google Scholar] [CrossRef]
  116. Rein, B.; Ma, K.; Yan, Z. A standardized social preference protocol for measuring social deficits in mouse models of autism. Nat Protoc 2020, 15, 3464–3477. [Google Scholar] [CrossRef]
  117. Moy, S.S.; Nadler, J.J.; Perez, A.; Barbaro, R.P.; Johns, J.M.; Magnuson, T.R.; Piven, J.; Crawley, J.N. Sociability and preference for social novelty in five inbred strains: an approach to assess autistic-like behavior in mice. Genes Brain Behav 2004, 3, 287–302. [Google Scholar] [CrossRef]
  118. Lubrich, C.; Giesler, P.; Kipp, M. Motor behavioral deficits in the cuprizone model: validity of the rotarod test paradigm. International journal of molecular sciences 2022, 23, 11342. [Google Scholar] [CrossRef] [PubMed]
  119. Shan, H.M.; Maurer, M.A.; Schwab, M.E. Four-parameter analysis in modified Rotarod test for detecting minor motor deficits in mice. BMC Biol 2023, 21, 177. [Google Scholar] [CrossRef] [PubMed]
  120. Lubrich, C.; Giesler, P.; Kipp, M. Motor Behavioral Deficits in the Cuprizone Model: Validity of the Rotarod Test Paradigm. Int J Mol Sci 2022, 23. [Google Scholar] [CrossRef] [PubMed]
  121. Keane, S.P.; Chadman, K.K.; Gomez, A.R.; Hu, W. Pros and cons of narrow- versus wide-compartment rotarod apparatus: An experimental study in mice. Behav Brain Res 2024, 463, 114901. [Google Scholar] [CrossRef] [PubMed]
  122. Cording, K.R.; Bateup, H.S. Altered motor learning and coordination in mouse models of autism spectrum disorder. Front Cell Neurosci 2023, 17, 1270489. [Google Scholar] [CrossRef]
  123. Galla, Z.; Rajda, C.; Rácz, G.; Grecsó, N.; Baráth, Á.; Vécsei, L.; Bereczki, C.; Monostori, P. Simultaneous determination of 30 neurologically and metabolically important molecules: A sensitive and selective way to measure tyrosine and tryptophan pathway metabolites and other biomarkers in human serum and cerebrospinal fluid. J Chromatogr A 2021, 1635, 461775. [Google Scholar] [CrossRef]
  124. Galla, Z.; Rácz, G.; Grecsó, N.; Baráth, Á.; Kósa, M.; Bereczki, C.; Monostori, P. Improved LC-MS/MS method for the determination of 42 neurologically and metabolically important molecules in urine. J Chromatogr B Analyt Technol Biomed Life Sci 2021, 1179, 122846. [Google Scholar] [CrossRef] [PubMed]
  125. Fathi, M.; Vakili, K.; Yaghoobpoor, S.; Tavasol, A.; Jazi, K.; Hajibeygi, R.; Shool, S.; Sodeifian, F.; Klegeris, A.; McElhinney, A.; et al. Dynamic changes in metabolites of the kynurenine pathway in Alzheimer’s disease, Parkinson’s disease, and Huntington’s disease: A systematic Review and meta-analysis. Front Immunol 2022, 13, 997240. [Google Scholar] [CrossRef] [PubMed]
  126. Tanaka, M.; Bohár, Z.; Vécsei, L. Are Kynurenines Accomplices or Principal Villains in Dementia? Maintenance of Kynurenine Metabolism. Molecules 2020, 25. [Google Scholar] [CrossRef] [PubMed]
  127. Kim, Y.K.; Jeon, S.W. Neuroinflammation and the Immune-Kynurenine Pathway in Anxiety Disorders. Curr Neuropharmacol 2018, 16, 574–582. [Google Scholar] [CrossRef]
  128. Imbeault, S.; Gubert Olivé, M.; Jungholm, O.; Erhardt, S.; Wigström, H.; Engberg, G.; Jardemark, K. Blockade of KAT II Facilitates LTP in Kynurenine 3-Monooxygenase Depleted Mice. Int J Tryptophan Res 2021, 14, 11786469211041368. [Google Scholar] [CrossRef]
  129. Blanco Ayala, T.B.; Ramírez Ortega, D.R.; Ovalle Rodríguez, P.O.; Pineda, B.; Pérez de la Cruz, G.P.; González Esquivel, D.G.; Schwarcz, R.; Sathyasaikumar, K.V.; Jiménez Anguiano, A.J.; Pérez de la Cruz, V.P. Subchronic N-acetylcysteine Treatment Decreases Brain Kynurenic Acid Levels and Improves Cognitive Performance in Mice. Antioxidants (Basel) 2021, 10. [Google Scholar] [CrossRef]
  130. Ovalle Rodríguez, P.; Ramírez Ortega, D.; Blanco Ayala, T.; Roldán Roldán, G.; Pérez de la Cruz, G.; González Esquivel, D.F.; Gómez-Manzo, S.; Sánchez Chapul, L.; Salazar, A.; Pineda, B.; et al. Modulation of Kynurenic Acid Production by N-acetylcysteine Prevents Cognitive Impairment in Adulthood Induced by Lead Exposure during Lactation in Mice. Antioxidants (Basel) 2023, 12. [Google Scholar] [CrossRef]
  131. Bai, M.Y.; Lovejoy, D.B.; Guillemin, G.J.; Kozak, R.; Stone, T.W.; Koola, M.M. Galantamine-Memantine Combination and Kynurenine Pathway Enzyme Inhibitors in the Treatment of Neuropsychiatric Disorders. Complex Psychiatry 2021, 7, 19–33. [Google Scholar] [CrossRef]
  132. Nikolaus, S.; Fazari, B.; Chao, O.Y.; Almeida, F.R.; Abdel-Hafiz, L.; Beu, M.; Henke, J.; Antke, C.; Hautzel, H.; Mamlins, E.; et al. 2,5-Dimethoxy-4-iodoamphetamine and altanserin induce region-specific shifts in dopamine and serotonin metabolization pathways in the rat brain. Pharmacol Biochem Behav 2024, 242, 173823. [Google Scholar] [CrossRef]
  133. Tanaka, M.; Battaglia, S.; Liloia, D. Navigating Neurodegeneration: Integrating Biomarkers, Neuroinflammation, and Imaging in Parkinson’s, Alzheimer’s, and Motor Neuron Disorders. Biomedicines 2025, 13. [Google Scholar] [CrossRef]
  134. Qin, Y.; Hu, X.; Zhao, H.-L.; Kurban, N.; Chen, X.; Yi, J.-K.; Zhang, Y.; Cui, S.-Y.; Zhang, Y.-H. Inhibition of indoleamine 2, 3-dioxygenase exerts antidepressant-like effects through distinct pathways in prelimbic and infralimbic cortices in rats under intracerebroventricular injection with streptozotocin. International Journal of Molecular Sciences 2024, 25, 7496. [Google Scholar] [CrossRef]
  135. Barbalho, S.M.; Leme Boaro, B.; da Silva Camarinha Oliveira, J.; Patočka, J.; Barbalho Lamas, C.; Tanaka, M.; Laurindo, L.F. Molecular Mechanisms Underlying Neuroinflammation Intervention with Medicinal Plants: A Critical and Narrative Review of the Current Literature. Pharmaceuticals (Basel) 2025, 18. [Google Scholar] [CrossRef]
  136. Nicosia, N.; Giovenzana, M.; Misztak, P.; Mingardi, J.; Musazzi, L. Glutamate-Mediated Excitotoxicity in the Pathogenesis and Treatment of Neurodevelopmental and Adult Mental Disorders. Int J Mol Sci 2024, 25. [Google Scholar] [CrossRef] [PubMed]
  137. Pastor, V.; Medina, J.H. α7 nicotinic acetylcholine receptor in memory processing. Eur J Neurosci 2024, 59, 2138–2154. [Google Scholar] [CrossRef] [PubMed]
  138. Pocivavsek, A.; Baratta, A.M.; Mong, J.A.; Viechweg, S.S. Acute Kynurenine Challenge Disrupts Sleep-Wake Architecture and Impairs Contextual Memory in Adult Rats. Sleep 2017, 40. [Google Scholar] [CrossRef] [PubMed]
  139. Young, K.D.; Drevets, W.C.; Dantzer, R.; Teague, T.K.; Bodurka, J.; Savitz, J. Kynurenine pathway metabolites are associated with hippocampal activity during autobiographical memory recall in patients with depression. Brain Behav Immun 2016, 56, 335–342. [Google Scholar] [CrossRef]
  140. Savitz, J.; Dantzer, R.; Wurfel, B.E.; Victor, T.A.; Ford, B.N.; Bodurka, J.; Bellgowan, P.S.; Teague, T.K.; Drevets, W.C. Neuroprotective kynurenine metabolite indices are abnormally reduced and positively associated with hippocampal and amygdalar volume in bipolar disorder. Psychoneuroendocrinology 2015, 52, 200–211. [Google Scholar] [CrossRef]
  141. Chmiel-Perzyńska, I.; Perzyński, A.; Olajossy, B.; Gil-Kulik, P.; Kocki, J.; Urbańska, E.M. Losartan Reverses Hippocampal Increase of Kynurenic Acid in Type 1 Diabetic Rats: A Novel Procognitive Aspect of Sartan Action. J Diabetes Res 2019, 2019, 4957879. [Google Scholar] [CrossRef]
  142. Sánchez Chapul, L.; Pérez de la Cruz, G.; Ramos Chávez, L.A.; Valencia León, J.F.; Torres Beltrán, J.; Estrada Camarena, E.; Carillo Mora, P.; Ramírez Ortega, D.; Baños Vázquez, J.U.; Martínez Nava, G. Characterization of redox environment and tryptophan catabolism through kynurenine pathway in military divers’ and swimmers’ serum samples. Antioxidants 2022, 11, 1223. [Google Scholar] [CrossRef]
  143. Ostapiuk, A.; Urbanska, E.M. Kynurenic acid in neurodegenerative disorders—unique neuroprotection or double--edged sword? CNS neuroscience & therapeutics 2022, 28, 19–35. [Google Scholar]
  144. Jomova, K.; Raptova, R.; Alomar, S.Y.; Alwasel, S.H.; Nepovimova, E.; Kuca, K.; Valko, M. Reactive oxygen species, toxicity, oxidative stress, and antioxidants: chronic diseases and aging. Archives of toxicology 2023, 97, 2499–2574. [Google Scholar]
  145. Kubota, H.; Kunisawa, K.; Niijima, M.; Hirakawa, M.; Mori, Y.; Hasegawa, M.; Fujigaki, S.; Fujigaki, H.; Yamamoto, Y.; Saito, K. Deficiency of kynurenine 3-monooxygenase exacerbates impairment of prepulse inhibition induced by phencyclidine. Biochemical and Biophysical Research Communications 2022, 629, 142–151. [Google Scholar] [CrossRef]
  146. Fanet, H.; Capuron, L.; Castanon, N.; Calon, F.; Vancassel, S. Tetrahydrobioterin (BH4) pathway: from metabolism to neuropsychiatry. Current neuropharmacology 2021, 19, 591–609. [Google Scholar]
  147. Vasquez-Vivar, J.; Shi, Z.; Tan, S. Tetrahydrobiopterin in cell function and death mechanisms. Antioxidants & redox signaling 2022, 37, 171–183. [Google Scholar]
  148. Feng, Y.; Feng, Y.; Gu, L.; Liu, P.; Cao, J.; Zhang, S. The critical role of tetrahydrobiopterin (BH4) metabolism in modulating radiosensitivity: BH4/NOS axis as an angel or a devil. Frontiers in Oncology 2021, 11, 720632. [Google Scholar] [CrossRef] [PubMed]
  149. Tanaka, M.; Battaglia, S. Dualistic Dynamics in Neuropsychiatry: From Monoaminergic Modulators to Multiscale Biomarker Maps. Biomedicines 2025, 13. [Google Scholar] [CrossRef]
  150. Sun, J.; Zhang, Y.; Kong, Y.; Ye, T.; Yu, Q.; Kumaran Satyanarayanan, S.; Su, K.P.; Liu, J. Microbiota-derived metabolite Indoles induced aryl hydrocarbon receptor activation and inhibited neuroinflammation in APP/PS1 mice. Brain Behav Immun 2022, 106, 76–88. [Google Scholar] [CrossRef] [PubMed]
  151. Czapski, G.A.; Strosznajder, J.B. Glutamate and GABA in Microglia-Neuron Cross-Talk in Alzheimer’s Disease. Int J Mol Sci 2021, 22. [Google Scholar] [CrossRef]
  152. Basilico, B.; Ferrucci, L.; Ratano, P.; Golia, M.T.; Grimaldi, A.; Rosito, M.; Ferretti, V.; Reverte, I.; Sanchini, C.; Marrone, M.C.; et al. Microglia control glutamatergic synapses in the adult mouse hippocampus. Glia 2022, 70, 173–195. [Google Scholar] [CrossRef]
  153. Li, C.C.; Jiang, N.; Gan, L.; Zhao, M.J.; Chang, Q.; Liu, X.M.; Pan, R.L. Peripheral and cerebral abnormalities of the tryptophan metabolism in the depression-like rats induced by chronic unpredicted mild stress. Neurochem Int 2020, 138, 104771. [Google Scholar] [CrossRef] [PubMed]
  154. Peng, Y.; Gao, P.; Shi, L.; Chen, L.; Liu, J.; Long, J. Central and Peripheral Metabolic Defects Contribute to the Pathogenesis of Alzheimer’s Disease: Targeting Mitochondria for Diagnosis and Prevention. Antioxid Redox Signal 2020, 32, 1188–1236. [Google Scholar] [CrossRef]
  155. Correia, A.S.; Cardoso, A.; Vale, N. Oxidative Stress in Depression: The Link with the Stress Response, Neuroinflammation, Serotonin, Neurogenesis and Synaptic Plasticity. Antioxidants (Basel) 2023, 12. [Google Scholar] [CrossRef] [PubMed]
  156. Ferreira, A.; Harter, A.; Afreen, S.; Kanai, K.; Batori, S.; Redei, E.E. The WMI Rat of Premature Cognitive Aging Presents Intrinsic Vulnerability to Oxidative Stress in Primary Neurons and Astrocytes Compared to Its Nearly Isogenic WLI Control. Int J Mol Sci 2024, 25. [Google Scholar] [CrossRef]
  157. Sathyasaikumar, K.V.; Pérez de la Cruz, V.; Pineda, B.; Vázquez Cervantes, G.I.; Ramírez Ortega, D.; Donley, D.W.; Severson, P.L.; West, B.L.; Giorgini, F.; Fox, J.H.; et al. Cellular Localization of Kynurenine 3-Monooxygenase in the Brain: Challenging the Dogma. Antioxidants (Basel) 2022, 11. [Google Scholar] [CrossRef]
  158. Brown, S.J.; Brown, A.M.; Purves-Tyson, T.D.; Huang, X.F.; Shannon Weickert, C.; Newell, K.A. Alterations in the kynurenine pathway and excitatory amino acid transporter-2 in depression with and without psychosis: Evidence of a potential astrocyte pathology. J Psychiatr Res 2022, 147, 203–211. [Google Scholar] [CrossRef]
  159. Wu, P.; Wang, W.; Huang, C.; Sun, L.; Wu, X.; Xu, L.; Xiao, P. A rapid and reliable targeted LC-MS/MS method for quantitative analysis of the Tryptophan-NAD metabolic network disturbances in tissues and blood of sleep deprivation mice. Anal Chim Acta 2024, 1328, 343125. [Google Scholar] [CrossRef]
  160. Bellot, M.; Espinosa-Velasco, M.; López-Arnau, R.; Escubedo, E.; Gómez-Canela, C. Characterization of monoaminergic neurochemicals in cortex and striatum of mouse brain. J Pharm Biomed Anal 2022, 217, 114844. [Google Scholar] [CrossRef]
  161. Gomez-Gomez, A.; Olesti, E.; Montero-San-Martin, B.; Soldevila, A.; Deschamps, T.; Pizarro, N.; de la Torre, R.; Pozo, O.J. Determination of up to twenty carboxylic acid containing compounds in clinically relevant matrices by o-benzylhydroxylamine derivatization and liquid chromatography-tandem mass spectrometry. J Pharm Biomed Anal 2022, 208, 114450. [Google Scholar] [CrossRef]
  162. Patel, V.D.; Shamsi, S.A.; Miller, A.; Liu, A.; Powell, M. Simultaneous separation and detection of nine kynurenine pathway metabolites by reversed-phase liquid chromatography-mass spectrometry: Quantitation of inflammation in human cerebrospinal fluid and plasma. Anal Chim Acta 2023, 1278, 341659. [Google Scholar] [CrossRef] [PubMed]
  163. Herb, B.R.; Glover, H.J.; Bhaduri, A.; Colantuoni, C.; Bale, T.L.; Siletti, K.; Hodge, R.; Lein, E.; Kriegstein, A.R.; Doege, C.A.; et al. Single-cell genomics reveals region-specific developmental trajectories underlying neuronal diversity in the human hypothalamus. Sci Adv 2023, 9, eadf6251. [Google Scholar] [CrossRef]
  164. Pokhilko, A.; Handel, A.E.; Curion, F.; Volpato, V.; Whiteley, E.S.; Bøstrand, S.; Newey, S.E.; Akerman, C.J.; Webber, C.; Clark, M.B.; et al. Targeted single-cell RNA sequencing of transcription factors enhances the identification of cell types and trajectories. Genome Res 2021, 31, 1069–1081. [Google Scholar] [CrossRef] [PubMed]
  165. Steyn, C.; Mishi, R.; Fillmore, S.; Verhoog, M.B.; More, J.; Rohlwink, U.K.; Melvill, R.; Butler, J.; Enslin, J.M.N.; Jacobs, M.; et al. A temporal cortex cell atlas highlights gene expression dynamics during human brain maturation. Nat Genet 2024, 56, 2718–2730. [Google Scholar] [CrossRef] [PubMed]
  166. Zhang, P.; Omanska, A.; Ander, B.P.; Gandal, M.J.; Stamova, B.; Schumann, C.M. Neuron-specific transcriptomic signatures indicate neuroinflammation and altered neuronal activity in ASD temporal cortex. Proceedings of the National Academy of Sciences 2023, 120, e2206758120. [Google Scholar] [CrossRef]
  167. Swift, J.; Greenham, K.; Ecker, J.R.; Coruzzi, G.M.; Robertson McClung, C. The biology of time: dynamic responses of cell types to developmental, circadian and environmental cues. Plant J 2022, 109, 764–778. [Google Scholar] [CrossRef] [PubMed]
  168. Pocivavsek, A.; Schwarcz, R.; Erhardt, S. Neuroactive Kynurenines as Pharmacological Targets: New Experimental Tools and Exciting Therapeutic Opportunities. Pharmacol Rev 2024, 76, 978–1008. [Google Scholar] [CrossRef]
  169. Cheng, D.; Qin, Z.S.; Zheng, Y.; Xie, J.Y.; Liang, S.S.; Zhang, J.L.; Feng, Y.B.; Zhang, Z.J. Minocycline, a classic antibiotic, exerts psychotropic effects by normalizing microglial neuroinflammation-evoked tryptophan-kynurenine pathway dysregulation in chronically stressed male mice. Brain Behav Immun 2023, 107, 305–318. [Google Scholar] [CrossRef]
  170. Tanaka, M. Parkinson’s Disease: Bridging Gaps, Building Biomarkers, and Reimagining Clinical Translation. Cells 2025, 14. [Google Scholar] [CrossRef]
  171. Chen, Y.; Zhang, J.; Yang, Y.; Xiang, K.; Li, H.; Sun, D.; Chen, L. Kynurenine-3-monooxygenase (KMO): From its biological functions to therapeutic effect in diseases progression. J Cell Physiol 2022, 237, 4339–4355. [Google Scholar] [CrossRef]
  172. Mouri, A.; Hasegawa, M.; Kunisawa, K.; Saito, K.; Nabeshima, T. [Diagnoses and new therapeutic strategy focused on physiological alteration of tryptophan metabolism]. Nihon Yakurigaku Zasshi 2023, 158, 233–237. [Google Scholar] [CrossRef]
  173. Ramirez Ortega, D.; Ovalle Rodríguez, P.; Pineda, B.; González Esquivel, D.F.; Ramos Chávez, L.A.; Vázquez Cervantes, G.I.; Roldán Roldán, G.; Pérez de la Cruz, G.; Díaz Ruiz, A.; Méndez Armenta, M.; et al. Kynurenine Pathway as a New Target of Cognitive Impairment Induced by Lead Toxicity During the Lactation. Sci Rep 2020, 10, 3184. [Google Scholar] [CrossRef]
  174. Milosavljevic, S.; Piroli, M.V.; Sandago, E.J.; Piroli, G.G.; Smith, H.H.; Beggiato, S.; Frizzell, N.; Pocivavsek, A. Parental kynurenine 3-monooxygenase genotype in mice directs sex-specific behavioral outcomes in offspring. Biol Sex Differ 2025, 16, 22. [Google Scholar] [CrossRef]
  175. Leigh, S.J.; Uhlig, F.; Wilmes, L.; Sanchez-Diaz, P.; Gheorghe, C.E.; Goodson, M.S.; Kelley-Loughnane, N.; Hyland, N.P.; Cryan, J.F.; Clarke, G. The impact of acute and chronic stress on gastrointestinal physiology and function: a microbiota-gut-brain axis perspective. J Physiol 2023, 601, 4491–4538. [Google Scholar] [CrossRef]
  176. Kuijer, E.J.; Steenbergen, L. The microbiota-gut-brain axis in hippocampus-dependent learning and memory: current state and future challenges. Neurosci Biobehav Rev 2023, 152, 105296. [Google Scholar] [CrossRef]
  177. Huang, T.T.; Tseng, L.M.; Chen, J.L.; Chu, P.Y.; Lee, C.H.; Huang, C.T.; Wang, W.L.; Lau, K.Y.; Tseng, M.F.; Chang, Y.Y.; et al. Kynurenine 3-monooxygenase upregulates pluripotent genes through β-catenin and promotes triple-negative breast cancer progression. EBioMedicine 2020, 54, 102717. [Google Scholar] [CrossRef]
  178. Rutsch, A.; Kantsjö, J.B.; Ronchi, F. The Gut-Brain Axis: How Microbiota and Host Inflammasome Influence Brain Physiology and Pathology. Front Immunol 2020, 11, 604179. [Google Scholar] [CrossRef] [PubMed]
  179. Interino, N.; Vitagliano, R.; D’Amico, F.; Lodi, R.; Porru, E.; Turroni, S.; Fiori, J. Microbiota-Gut-Brain Axis: Mass-Spectrometry-Based Metabolomics in the Study of Microbiome Mediators-Stress Relationship. Biomolecules 2025, 15. [Google Scholar] [CrossRef] [PubMed]
  180. Deng, Y.; Zhou, M.; Wang, J.; Yao, J.; Yu, J.; Liu, W.; Wu, L.; Wang, J.; Gao, R. Involvement of the microbiota-gut-brain axis in chronic restraint stress: disturbances of the kynurenine metabolic pathway in both the gut and brain. Gut Microbes 2021, 13, 1–16. [Google Scholar] [CrossRef] [PubMed]
  181. Góralczyk-Bińkowska, A.; Szmajda-Krygier, D.; Kozłowska, E. The Microbiota-Gut-Brain Axis in Psychiatric Disorders. Int J Mol Sci 2022, 23. [Google Scholar] [CrossRef]
  182. Tanaka, M.; Vécsei, L. Revolutionizing our understanding of Parkinson’s disease: Dr. Heinz Reichmann’s pioneering research and future research direction. J Neural Transm (Vienna) 2024, 131, 1367–1387. [Google Scholar] [CrossRef]
  183. Verma, A.; Inslicht, S.S.; Bhargava, A. Gut-Brain Axis: Role of Microbiome, Metabolomics, Hormones, and Stress in Mental Health Disorders. Cells 2024, 13. [Google Scholar] [CrossRef] [PubMed]
  184. Heidari, H.; Lawrence, D.A. An integrative exploration of environmental stressors on the microbiome-gut-brain axis and immune mechanisms promoting neurological disorders. J Toxicol Environ Health B Crit Rev 2024, 27, 233–263. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Host–microbiota co-metabolism of aromatic amino acids: tryptophan (Trp) and phenylalanine routes to neuroactive and redox-active metabolites. a) Kynurenine pathway (green): tryptophan enters the kynurenine axis via TDO/IDOs to N-formyl-L-kynurenine → kynurenine, branching through KMO to 3-hydroxykynurenine and 3-hydroxyanthranilic acid (→ quinolinic acid) or through KATs to kynurenic acid. 2-amino-3-carboxymuconic-6-semialdehyde cyclizes/oxidizes toward quinolinic acid, which is converted by QPRT → nicotinic acid mononucleotide and onward to NAD+ (via NMNAT/NAD synthetase). This pathway balances neurotoxic (3-hydroxykynurenine, quinolinic acid) and neuroprotective (kynurenic acid) signals while supplying cellular NAD+. b) Serotonin pathway (rose): tryptophan is hydroxylated by TPHs to 5-hydroxytryptophan and decarboxylated by aromatic L-amino acid decarboxylase (AADC) to serotonin. Serotonin is catabolized by MAOs/ALDH to 5-hydroxyindole-3-acetic acid, or acetylated/methylated by AANAT → N-acetylserotonin and HIOMT/ASMT → melatonin. This route links gut/brain serotonin tone with circadian signaling. c) Indole-pyruvate pathway (blue; microbiota–host): bacterial TNA converts tryptophan to indole, which is oxidized to indoxyl and sulfated in the host to indoxyl sulfate. Parallel microbial transamination/reduction/oxidation steps yield indole-3-pyruvic acid → indole-3-lactic acid/indole-3-acetic acid, indole-3-acetaldehyde, 3-indoleacrylic acid, and indole-3-propionic acid. These ligands engage AhR, fortify epithelial barriers, and shape systemic immunity. d) Tyrosine (Tyr)–dopamine pathway (yellow): phenylalanine → tyrosine (PAH) → levodopa (TH) → dopamine (AADC) → noradrenaline (DBH) → adrenaline (PNMT), with COMT/MAOs/ALDH producing 3,4-dihydroxyphenylacetic acid, 3-methoxytyramine, homovanillic acid, vanyllilmandelic acid, and 3-methoxy-4-hydroxyphenylglycol. In parallel, microbial fermentation of phenylalanine/tyrosine generates p-Hydroxyphenylacetic acid and p-Cresol, further host-conjugated to p-Cresyl sulfate—an impactful uremic/toxic metabolite. Black arrows: the host routes; red arrows: the gut microbiota routes; white arrows: host and microbiota routes with the same enzyme. 3-HAA, 3-hydroxyanthranilic acid; 3-HAO, 3-hydroxyanthranilate oxidase; 3-HK, 3-hydroxykynurenine; 3-MT, 3-methoxytyramine; 3-OMD, 3-O-methyldopa; 5-HIAA, 5-hydroxyindole-3-acetic acid; 5-HIAL, 5-hydroxyindole-3-acetaldehyde; 5-HT, 5-hydroxytryptamine/serotonin; 5-HTP, 5-hydroxytryptophan; A, adrenaline; AA, anthranilic acid; AAD, amino acid decarboxylase; AADC, aromatic L-amino acid decarboxylase; AANAT, arylalkylamine N-acetyltransferase; acdA, acyl-CoA dehydrogenase; ACMS, 2-amino-3-carboxymuconic-6-semialdehyde; ACMSD, amino-β-carboxymuconate-semialdehyde-decarboxylase; AldA, indole-3-acetaldehyde dehydrogenase; ALDH, aldehyde dehydrogenase; AMS, 2-aminomuconic-6-semialdehyde; ArAT, aromatic amino acid aminotransferase; ASMT, acetylserotonin-O-methyltransferase; COMT, catechol-O-methyltransferase; CYP2D6, cytochrome P450 2D6; CYPs, cytochrome P450 monooxygenases; DA, dopamine; DBH, dopamine β-hydroxylase; DOPAC, 3,4-dihydroxyphenylacetic acid; DOPAL, 3,4-dihydroxyphenylacetaldehyde; fldBC, phenyllactate dehydratase; fldH, indole-3-pyruvate ferredoxin oxidoreductase; FMOs, flavin-containing monooxygenases; HPAD, 4-hydroxyphenylacetate decarboxylase; HVA, homovanillic acid; IA, 3-indoleacrylic acid; IAA, indole-3-acetic acid; IaaH, indole-3-acetamide hydrolase; IAAld, indole-3-acetaldehyde; IAM, indole-3-acetamide; ICA, indole-3-carboxylic acid; IDOs, indoleamine 2,3-dioxygenases (IDO1 and IDO2); ILA, indole-3-lactic acid; INS, indoxyl sulfate; IPA, indole-3-propionic acid; IPDC, indole-3-pyruvate decarboxylase; IPyA, indole-3-pyruvic acid; KAT III, kynurenine aminotransferase III; KATs, kynurenine aminotransferases (KAT I, II, III, and IV); KFA, kynurenine formamidase; KMO, kynurenine-3-monooxygenase; KYN, kynurenine; KYNA, kynurenic acid; KYNU, kynureninase; L-DOPA, dihydroxyphenylalanine/levodopa; MAOs, monoamine oxidases (MAO-A and MAO-B); MEL, melatonin; MHPG, 3-methoxy-4-hydroxyphenylglycol; MHPGS, 3-methoxy-4-hydroxyphenylglycol sulphate; NA, noradrenaline; NAD+, nicotinamide adenine dinucleotide; NAAD, nicotinic acid adenine dinucleotide; NAS, N-acetylserotonin; NFK, N-formyl-L-kynurenine; NMN, nicotinic acid mononucleotide; NMNAT, nicotinamide mononucleotide adenylyltransferase; p-Cre, p-Cresol; p-HPA, para-hydroxyphenylacetic acid; pCS, p-Cresyl sulfate; PA, picolinic acid; PAH, phenylalanine hydroxylase; Phe, phenylalanine; PNMT, phenylethanolamine N-methyltransferase; QA, quinolinic acid; QAA, quinaldic acid; QPRT, quinolinate phosphoribosyl transferase; SULTs, sulfotransferases; TDC, tyrosine decarboxylase; TDO, tryptophan-2,3-dioxygenase; TH, tyrosine hydroxylase; TMO, tryptophan-2-monooxygenase; TNA, tryptophanase; TPHs, tryptophan hydroxylases (TPH1 and TPH2); TrD, tryptophan decarboxylase; Trp, tryptophan; Tyr, tyrosine; TYRA, tyramine; VMA, vanyllilmandelic acid; XA, xanthurenic acid; ?, unknown.
Figure 1. Host–microbiota co-metabolism of aromatic amino acids: tryptophan (Trp) and phenylalanine routes to neuroactive and redox-active metabolites. a) Kynurenine pathway (green): tryptophan enters the kynurenine axis via TDO/IDOs to N-formyl-L-kynurenine → kynurenine, branching through KMO to 3-hydroxykynurenine and 3-hydroxyanthranilic acid (→ quinolinic acid) or through KATs to kynurenic acid. 2-amino-3-carboxymuconic-6-semialdehyde cyclizes/oxidizes toward quinolinic acid, which is converted by QPRT → nicotinic acid mononucleotide and onward to NAD+ (via NMNAT/NAD synthetase). This pathway balances neurotoxic (3-hydroxykynurenine, quinolinic acid) and neuroprotective (kynurenic acid) signals while supplying cellular NAD+. b) Serotonin pathway (rose): tryptophan is hydroxylated by TPHs to 5-hydroxytryptophan and decarboxylated by aromatic L-amino acid decarboxylase (AADC) to serotonin. Serotonin is catabolized by MAOs/ALDH to 5-hydroxyindole-3-acetic acid, or acetylated/methylated by AANAT → N-acetylserotonin and HIOMT/ASMT → melatonin. This route links gut/brain serotonin tone with circadian signaling. c) Indole-pyruvate pathway (blue; microbiota–host): bacterial TNA converts tryptophan to indole, which is oxidized to indoxyl and sulfated in the host to indoxyl sulfate. Parallel microbial transamination/reduction/oxidation steps yield indole-3-pyruvic acid → indole-3-lactic acid/indole-3-acetic acid, indole-3-acetaldehyde, 3-indoleacrylic acid, and indole-3-propionic acid. These ligands engage AhR, fortify epithelial barriers, and shape systemic immunity. d) Tyrosine (Tyr)–dopamine pathway (yellow): phenylalanine → tyrosine (PAH) → levodopa (TH) → dopamine (AADC) → noradrenaline (DBH) → adrenaline (PNMT), with COMT/MAOs/ALDH producing 3,4-dihydroxyphenylacetic acid, 3-methoxytyramine, homovanillic acid, vanyllilmandelic acid, and 3-methoxy-4-hydroxyphenylglycol. In parallel, microbial fermentation of phenylalanine/tyrosine generates p-Hydroxyphenylacetic acid and p-Cresol, further host-conjugated to p-Cresyl sulfate—an impactful uremic/toxic metabolite. Black arrows: the host routes; red arrows: the gut microbiota routes; white arrows: host and microbiota routes with the same enzyme. 3-HAA, 3-hydroxyanthranilic acid; 3-HAO, 3-hydroxyanthranilate oxidase; 3-HK, 3-hydroxykynurenine; 3-MT, 3-methoxytyramine; 3-OMD, 3-O-methyldopa; 5-HIAA, 5-hydroxyindole-3-acetic acid; 5-HIAL, 5-hydroxyindole-3-acetaldehyde; 5-HT, 5-hydroxytryptamine/serotonin; 5-HTP, 5-hydroxytryptophan; A, adrenaline; AA, anthranilic acid; AAD, amino acid decarboxylase; AADC, aromatic L-amino acid decarboxylase; AANAT, arylalkylamine N-acetyltransferase; acdA, acyl-CoA dehydrogenase; ACMS, 2-amino-3-carboxymuconic-6-semialdehyde; ACMSD, amino-β-carboxymuconate-semialdehyde-decarboxylase; AldA, indole-3-acetaldehyde dehydrogenase; ALDH, aldehyde dehydrogenase; AMS, 2-aminomuconic-6-semialdehyde; ArAT, aromatic amino acid aminotransferase; ASMT, acetylserotonin-O-methyltransferase; COMT, catechol-O-methyltransferase; CYP2D6, cytochrome P450 2D6; CYPs, cytochrome P450 monooxygenases; DA, dopamine; DBH, dopamine β-hydroxylase; DOPAC, 3,4-dihydroxyphenylacetic acid; DOPAL, 3,4-dihydroxyphenylacetaldehyde; fldBC, phenyllactate dehydratase; fldH, indole-3-pyruvate ferredoxin oxidoreductase; FMOs, flavin-containing monooxygenases; HPAD, 4-hydroxyphenylacetate decarboxylase; HVA, homovanillic acid; IA, 3-indoleacrylic acid; IAA, indole-3-acetic acid; IaaH, indole-3-acetamide hydrolase; IAAld, indole-3-acetaldehyde; IAM, indole-3-acetamide; ICA, indole-3-carboxylic acid; IDOs, indoleamine 2,3-dioxygenases (IDO1 and IDO2); ILA, indole-3-lactic acid; INS, indoxyl sulfate; IPA, indole-3-propionic acid; IPDC, indole-3-pyruvate decarboxylase; IPyA, indole-3-pyruvic acid; KAT III, kynurenine aminotransferase III; KATs, kynurenine aminotransferases (KAT I, II, III, and IV); KFA, kynurenine formamidase; KMO, kynurenine-3-monooxygenase; KYN, kynurenine; KYNA, kynurenic acid; KYNU, kynureninase; L-DOPA, dihydroxyphenylalanine/levodopa; MAOs, monoamine oxidases (MAO-A and MAO-B); MEL, melatonin; MHPG, 3-methoxy-4-hydroxyphenylglycol; MHPGS, 3-methoxy-4-hydroxyphenylglycol sulphate; NA, noradrenaline; NAD+, nicotinamide adenine dinucleotide; NAAD, nicotinic acid adenine dinucleotide; NAS, N-acetylserotonin; NFK, N-formyl-L-kynurenine; NMN, nicotinic acid mononucleotide; NMNAT, nicotinamide mononucleotide adenylyltransferase; p-Cre, p-Cresol; p-HPA, para-hydroxyphenylacetic acid; pCS, p-Cresyl sulfate; PA, picolinic acid; PAH, phenylalanine hydroxylase; Phe, phenylalanine; PNMT, phenylethanolamine N-methyltransferase; QA, quinolinic acid; QAA, quinaldic acid; QPRT, quinolinate phosphoribosyl transferase; SULTs, sulfotransferases; TDC, tyrosine decarboxylase; TDO, tryptophan-2,3-dioxygenase; TH, tyrosine hydroxylase; TMO, tryptophan-2-monooxygenase; TNA, tryptophanase; TPHs, tryptophan hydroxylases (TPH1 and TPH2); TrD, tryptophan decarboxylase; Trp, tryptophan; Tyr, tyrosine; TYRA, tyramine; VMA, vanyllilmandelic acid; XA, xanthurenic acid; ?, unknown.
Preprints 179819 g001
Figure 2. Behavioral assessment of wild-type (WT) and kat2/ mice in object recognition and social interaction paradigms. a) Time spent sniffing familiar vs. novel objects in the novel object recognition test (NORT). During the NORT, both WT and kat2-/- animals spent significantly more time exploring the novel object. b) Time spent sniffing familiar vs. novel objects in the object-based attention test (OBAT). In the OBAT, the mutant strain spent more time with the novel object. c) Time spent in the center, social, and non-social chambers during the three-chamber test (3CT, Phase 2). Both WT and kat2-/- mice spent more time in the side chambers than in the center chamber. d) Time spent in the center, novel animal’s, and familiar animal’s chambers during the 3CT (Phase 3). Both WT and kat2-/- mice spent more time in the side chambers than in the center chamber. Wild-type mice (light green); kat2/ mice (dark green). Data are presented as mean ± SD. ●, outlier. *, p < 0.05; **, p < 0.01; ***, p < 0.001. The figure was created with LabPlot 2.9.0 (KDE, Berlin, Germany) and BioRender.com. 3CT, three-chamber test; kat2−/−, kynurenine aminotransferase II knockout mice; NORT, novel object recognition test; OBAT, object-based attention test; WT, wild-type mice.
Figure 2. Behavioral assessment of wild-type (WT) and kat2/ mice in object recognition and social interaction paradigms. a) Time spent sniffing familiar vs. novel objects in the novel object recognition test (NORT). During the NORT, both WT and kat2-/- animals spent significantly more time exploring the novel object. b) Time spent sniffing familiar vs. novel objects in the object-based attention test (OBAT). In the OBAT, the mutant strain spent more time with the novel object. c) Time spent in the center, social, and non-social chambers during the three-chamber test (3CT, Phase 2). Both WT and kat2-/- mice spent more time in the side chambers than in the center chamber. d) Time spent in the center, novel animal’s, and familiar animal’s chambers during the 3CT (Phase 3). Both WT and kat2-/- mice spent more time in the side chambers than in the center chamber. Wild-type mice (light green); kat2/ mice (dark green). Data are presented as mean ± SD. ●, outlier. *, p < 0.05; **, p < 0.01; ***, p < 0.001. The figure was created with LabPlot 2.9.0 (KDE, Berlin, Germany) and BioRender.com. 3CT, three-chamber test; kat2−/−, kynurenine aminotransferase II knockout mice; NORT, novel object recognition test; OBAT, object-based attention test; WT, wild-type mice.
Preprints 179819 g002
Figure 3. Regional distribution of kynurenine (KYN) pathway metabolites in wild-type (WT) and kat2−/− mouse brains. a) Tryptophan (Trp), b) Kynurenic acid (KYNA), c) Quinaldic acid (QAA), d) Anthranilic acid (AA), e) 3-hydroxykynurenine (3-HK), f) Xanthurenic acid (XA), and g) 3-Hydroxyanthranilic acid (3-HAA) concentrations measured in striatum (STR), cortex (CTX), hippocampus (HIPP), cerebellum (CER), and brainstem (STEM). Trp was significantly lower in STR, CTX, and HIPP. While KYNA increased in STR, its concentration lowered in CTX and HIPP. QAA’s concentration was significantly lower in CER and STEM. The level of AA was higher in CTX. Concentration of 3-HK increased in every brain region. XA decreased in CTX, HIPP, CER and STEM. The level of 3-HAA increased in CTX. Wild-type (WT, light green) and kat2/ (dark green) groups are shown. Data are expressed as mean ± SD. ●, outlier.*, p < 0.05; **, p < 0.01; ***, p < 0.001. The figure was created with LabPlot 2.9.0 (KDE, Berlin, Germany) and BioRender.com. 3-HAA, 3-hydroxyanthranilic acid; 3-HK, 3-hydroxykynurenine; AA, anthranilic acid; CER, cerebellum; CTX, cortex; HIPP, hippocampus; KYNA, kynurenic acid; QAA, quinaldic acid; STEM, brainstem; STR, striatum; Trp, tryptophan; WT, wild-type mice; kat2/, kynurenine aminotransferase II knockout mice; XA, xanthurenic acid.
Figure 3. Regional distribution of kynurenine (KYN) pathway metabolites in wild-type (WT) and kat2−/− mouse brains. a) Tryptophan (Trp), b) Kynurenic acid (KYNA), c) Quinaldic acid (QAA), d) Anthranilic acid (AA), e) 3-hydroxykynurenine (3-HK), f) Xanthurenic acid (XA), and g) 3-Hydroxyanthranilic acid (3-HAA) concentrations measured in striatum (STR), cortex (CTX), hippocampus (HIPP), cerebellum (CER), and brainstem (STEM). Trp was significantly lower in STR, CTX, and HIPP. While KYNA increased in STR, its concentration lowered in CTX and HIPP. QAA’s concentration was significantly lower in CER and STEM. The level of AA was higher in CTX. Concentration of 3-HK increased in every brain region. XA decreased in CTX, HIPP, CER and STEM. The level of 3-HAA increased in CTX. Wild-type (WT, light green) and kat2/ (dark green) groups are shown. Data are expressed as mean ± SD. ●, outlier.*, p < 0.05; **, p < 0.01; ***, p < 0.001. The figure was created with LabPlot 2.9.0 (KDE, Berlin, Germany) and BioRender.com. 3-HAA, 3-hydroxyanthranilic acid; 3-HK, 3-hydroxykynurenine; AA, anthranilic acid; CER, cerebellum; CTX, cortex; HIPP, hippocampus; KYNA, kynurenic acid; QAA, quinaldic acid; STEM, brainstem; STR, striatum; Trp, tryptophan; WT, wild-type mice; kat2/, kynurenine aminotransferase II knockout mice; XA, xanthurenic acid.
Preprints 179819 g003
Figure 4. Region-specific alterations in serotonin (5-HT)-, indole-pyruvate–, and tyrosine (Tyr)-dopamine (DA)–derived metabolites in wild-type (WT) and kat2/ mice. Box plots showing concentrations of metabolites across brain regions in wild-type (WT, light green) and kat2/ (dark green) mice. a–b) Serotonin pathway: 5-HTP (5-hydroxytryptophan), 5-HT (5-hydroxytryptamine, serotonin). c–f) Indole-pyruvate pathway: Tyr, DOPAC (3,4-dihydroxyphenylacetic acid), BIO (biopterin), BH2 (dihydrobiopterin).g–j) Tryptophan-derived indole metabolites: IAA (indole-3-acetic acid), ICA (indole-3-carboxaldehyde), ILA (indole-3-lactic acid), INS (indoxyl sulfate). Brain regions: STR, striatum; CTX, cortex; HIPP, hippocampus; CER, cerebellum; STEM, brainstem. 5-HTP concentrations were reduced in the STR, CTX, and CER, whereas 5-HT levels were selectively decreased in the CTX. IAA concentrations were diminished in the HIPP, ILA, and INS within the STEM, while ICA levels were elevated in the CTX. Tyr levels were reduced in the CTX, and decreases in DOPAC, BIO, and BH2 were detected in the CER. Data are shown as mean ± SD. Symbols: •, outlier; ▲, far out. Significance: *, p < 0.05; **, p < 0.01; ***, p < 0.001. Figures created with LabPlot 2.9.0 (KDE, Berlin, Germany) and BioRender.com. 5-HT, serotonin (5-hydroxytryptamine); 5-HTP, 5-hydroxytryptophan; BH2, dihydrobiopterin; BIO, biopterin; CER, cerebellum; CTX, cortex; DOPAC, 3,4-dihydroxyphenylacetic acid; HIPP, hippocampus; ICA, indole-3-carboxaldehyde; IAA, indole-3-acetic acid; ILA, indole-3-lactic acid; INS, indoxyl sulfate; KAT2/, kynurenine aminotransferase II knockout mice; STEM, brainstem; STR, striatum; Tyr, tyrosine; WT, wild-type mice.
Figure 4. Region-specific alterations in serotonin (5-HT)-, indole-pyruvate–, and tyrosine (Tyr)-dopamine (DA)–derived metabolites in wild-type (WT) and kat2/ mice. Box plots showing concentrations of metabolites across brain regions in wild-type (WT, light green) and kat2/ (dark green) mice. a–b) Serotonin pathway: 5-HTP (5-hydroxytryptophan), 5-HT (5-hydroxytryptamine, serotonin). c–f) Indole-pyruvate pathway: Tyr, DOPAC (3,4-dihydroxyphenylacetic acid), BIO (biopterin), BH2 (dihydrobiopterin).g–j) Tryptophan-derived indole metabolites: IAA (indole-3-acetic acid), ICA (indole-3-carboxaldehyde), ILA (indole-3-lactic acid), INS (indoxyl sulfate). Brain regions: STR, striatum; CTX, cortex; HIPP, hippocampus; CER, cerebellum; STEM, brainstem. 5-HTP concentrations were reduced in the STR, CTX, and CER, whereas 5-HT levels were selectively decreased in the CTX. IAA concentrations were diminished in the HIPP, ILA, and INS within the STEM, while ICA levels were elevated in the CTX. Tyr levels were reduced in the CTX, and decreases in DOPAC, BIO, and BH2 were detected in the CER. Data are shown as mean ± SD. Symbols: •, outlier; ▲, far out. Significance: *, p < 0.05; **, p < 0.01; ***, p < 0.001. Figures created with LabPlot 2.9.0 (KDE, Berlin, Germany) and BioRender.com. 5-HT, serotonin (5-hydroxytryptamine); 5-HTP, 5-hydroxytryptophan; BH2, dihydrobiopterin; BIO, biopterin; CER, cerebellum; CTX, cortex; DOPAC, 3,4-dihydroxyphenylacetic acid; HIPP, hippocampus; ICA, indole-3-carboxaldehyde; IAA, indole-3-acetic acid; ILA, indole-3-lactic acid; INS, indoxyl sulfate; KAT2/, kynurenine aminotransferase II knockout mice; STEM, brainstem; STR, striatum; Tyr, tyrosine; WT, wild-type mice.
Preprints 179819 g004
Figure 5. Overview of region- and matrix-specific alterations in tryptophan-derived metabolites in 8-week-old male kat2−/− mice compared to wild-type (WT) controls in ultra-high-plasticity liquid chromatography with tandem mass spectrometry. This figure summarizes significant alterations in tryptophan–kynurenine, serotonin, indole-pyruvate, and tyrosine–dopamine pathway metabolites across distinct brain regions (striatum, cortex, hippocampus, cerebellum, brainstem), plasma and urine in kat2−/− mice compared to the WT. Results highlight the region- and pathway-selective metabolic rewiring induced by kat2 deletion, particularly the consistent increase of 3-hydroxykynurenine and decrease of xanthurenic acid, alongside mixed kynurenic acid responses and downstream shifts in serotonin, indole, and catecholamine derivatives. We marked significant changes with circles. Red circles mean statistically significant decrease, and green shows significant increase in the concentration compared to the WT mice. The increasing size of the circles indicates higher levels of significance (small circle: *, p < 0.05; medium circle: **, p < 0.01; large circle: ***, p < 0.001). Grey rectangle background: previously published results. Black square: no data. 3-HAA, 3-hydroxyanthranilic acid; 3-HK, 3-hydroxykynurenine; 5-HIAA, 5-hydroxyindole-3-acetic acid; 5-HT, serotonin (5-hydroxytryptamine); 5-HTP, 5-hydroxytryptophan; AA, anthranilic acid; BH2, dihydroxybiopterin; BIO, biopterin; CER, cerebellum; CTX, cortex; DOPAC, 3,4-dihydroxyphenylacetic acid; HIPP, hippocampus; IAA, indole acetic acid; ICA, indole-3-carboxaldehyde; ILA, indole-3-lactic acid; INS, indoxyl sulphate; KYN, kynurenine; KYNA, kynurenic acid; MHPGS, 3-methoxy-4-hydroxyphenylglycol sulphate; QAA, quinaldic acid; Trp, tryptophan; Tyr, tyrosine; STEM, brainstem; STR, striatum; XA, xanthurenic acid.
Figure 5. Overview of region- and matrix-specific alterations in tryptophan-derived metabolites in 8-week-old male kat2−/− mice compared to wild-type (WT) controls in ultra-high-plasticity liquid chromatography with tandem mass spectrometry. This figure summarizes significant alterations in tryptophan–kynurenine, serotonin, indole-pyruvate, and tyrosine–dopamine pathway metabolites across distinct brain regions (striatum, cortex, hippocampus, cerebellum, brainstem), plasma and urine in kat2−/− mice compared to the WT. Results highlight the region- and pathway-selective metabolic rewiring induced by kat2 deletion, particularly the consistent increase of 3-hydroxykynurenine and decrease of xanthurenic acid, alongside mixed kynurenic acid responses and downstream shifts in serotonin, indole, and catecholamine derivatives. We marked significant changes with circles. Red circles mean statistically significant decrease, and green shows significant increase in the concentration compared to the WT mice. The increasing size of the circles indicates higher levels of significance (small circle: *, p < 0.05; medium circle: **, p < 0.01; large circle: ***, p < 0.001). Grey rectangle background: previously published results. Black square: no data. 3-HAA, 3-hydroxyanthranilic acid; 3-HK, 3-hydroxykynurenine; 5-HIAA, 5-hydroxyindole-3-acetic acid; 5-HT, serotonin (5-hydroxytryptamine); 5-HTP, 5-hydroxytryptophan; AA, anthranilic acid; BH2, dihydroxybiopterin; BIO, biopterin; CER, cerebellum; CTX, cortex; DOPAC, 3,4-dihydroxyphenylacetic acid; HIPP, hippocampus; IAA, indole acetic acid; ICA, indole-3-carboxaldehyde; ILA, indole-3-lactic acid; INS, indoxyl sulphate; KYN, kynurenine; KYNA, kynurenic acid; MHPGS, 3-methoxy-4-hydroxyphenylglycol sulphate; QAA, quinaldic acid; Trp, tryptophan; Tyr, tyrosine; STEM, brainstem; STR, striatum; XA, xanthurenic acid.
Preprints 179819 g005
Figure 6. Regional enzyme activity alterations in tryptophan- and serotonin (5-HT)-associated pathways in WT and kat2−/− mice. Box plots showing enzyme activities across striatum (STR), cortex (CTX), hippocampus (HIPP), cerebellum (CER), and brainstem (STEM) in wild-type (WT, light green) and kat2−/− (dark green) mice. Activities were calculated as product-to-substrate ratios for: a) KATs (KYNA/KYN), b) KMO (3-HK/KYN), c) KYNU (3-HAA/3-HK), d) KAT III (XA/3-HK), e) TPHs (5-HTP/Trp), f) AADC (5-HT/5-HTP), g) MAOs + ALDH (5-HIAA/5-HT), h) TMO [TrD, ArAT] (IAA/Trp). Enzyme activity of KATs decreased in STR. KMO’s activity significantly increased in every brain region. KYNU’s activity decreased in HIPP. KAT III enzyme’s activity decreased in CTX, HIPP, CER, and STEM. Activity of TPH enzymes decreased in CTX and CER. AADC’s activity decreased in STR, CTX, and CER. MAOs + ALDH decreased in CTX. TMO’s activity decreased in HIPP and CER. Data are shown as mean ± SD. Symbols: •, outlier; ▲, far out. Statistical significance: *, p < 0.05; **, p < 0.01; ***, p < 0.001. Figures were created with LabPlot 2.9.0 (KDE, Berlin, Germany) and BioRender.com. 3-HAA, 3-hydroxyanthranilic acid; 3-HK, 3-hydroxykynurenine; 5-HIAA, 5-hydroxyindoleacetic acid; 5-HT, serotonin (5-hydroxytryptamine); 5-HTP, 5-hydroxytryptophan; AADC, aromatic L-amino acid decarboxylase; ALDH, aldehyde dehydrogenase; ArAT, aromatic amino acid aminotransferase; CER, cerebellum; CTX, cortex; HIPP, hippocampus; IAA, indole-3-acetic acid; KAT III, kynurenine aminotransferase III; KATs, kynurenine aminotransferases; KAT2/, kynurenine aminotransferase II knockout; KMO, kynurenine-3-monooxygenase; KYN, kynurenine; KYNU, kynureninase; MAOs, monoamine oxidases; STEM, brainstem; STR, striatum; TMO, tryptophan-2-monooxygenase; TPHs, tryptophan hydroxylases; TrD, tryptophan decarboxylase; Trp, tryptophan; WT, wild-type mice; XA, xanthurenic acid.
Figure 6. Regional enzyme activity alterations in tryptophan- and serotonin (5-HT)-associated pathways in WT and kat2−/− mice. Box plots showing enzyme activities across striatum (STR), cortex (CTX), hippocampus (HIPP), cerebellum (CER), and brainstem (STEM) in wild-type (WT, light green) and kat2−/− (dark green) mice. Activities were calculated as product-to-substrate ratios for: a) KATs (KYNA/KYN), b) KMO (3-HK/KYN), c) KYNU (3-HAA/3-HK), d) KAT III (XA/3-HK), e) TPHs (5-HTP/Trp), f) AADC (5-HT/5-HTP), g) MAOs + ALDH (5-HIAA/5-HT), h) TMO [TrD, ArAT] (IAA/Trp). Enzyme activity of KATs decreased in STR. KMO’s activity significantly increased in every brain region. KYNU’s activity decreased in HIPP. KAT III enzyme’s activity decreased in CTX, HIPP, CER, and STEM. Activity of TPH enzymes decreased in CTX and CER. AADC’s activity decreased in STR, CTX, and CER. MAOs + ALDH decreased in CTX. TMO’s activity decreased in HIPP and CER. Data are shown as mean ± SD. Symbols: •, outlier; ▲, far out. Statistical significance: *, p < 0.05; **, p < 0.01; ***, p < 0.001. Figures were created with LabPlot 2.9.0 (KDE, Berlin, Germany) and BioRender.com. 3-HAA, 3-hydroxyanthranilic acid; 3-HK, 3-hydroxykynurenine; 5-HIAA, 5-hydroxyindoleacetic acid; 5-HT, serotonin (5-hydroxytryptamine); 5-HTP, 5-hydroxytryptophan; AADC, aromatic L-amino acid decarboxylase; ALDH, aldehyde dehydrogenase; ArAT, aromatic amino acid aminotransferase; CER, cerebellum; CTX, cortex; HIPP, hippocampus; IAA, indole-3-acetic acid; KAT III, kynurenine aminotransferase III; KATs, kynurenine aminotransferases; KAT2/, kynurenine aminotransferase II knockout; KMO, kynurenine-3-monooxygenase; KYN, kynurenine; KYNU, kynureninase; MAOs, monoamine oxidases; STEM, brainstem; STR, striatum; TMO, tryptophan-2-monooxygenase; TPHs, tryptophan hydroxylases; TrD, tryptophan decarboxylase; Trp, tryptophan; WT, wild-type mice; XA, xanthurenic acid.
Preprints 179819 g006
Figure 7. Regional indices of oxidative stress and excitotoxicity in wild-type (WT) and kat2−/− mice. Box plots showing oxidative stress and excitotoxicity indices across striatum (STR), cortex (CTX), hippocampus (HIPP), cerebellum (CER), and brainstem (STEM) in WT (light green) and kat2−/− (dark green) mice. a) Oxidative stress index, calculated as the ratio 3-HK/(KYNA+AA+XA), reflecting the balance between pro-oxidant and antioxidant metabolites. The oxidative stress index significantly increased in CTX, HIPP, CER and STEM. b) Excitotoxicity index, calculated as the ratio QA/KYNA, representing the N-methyl-D-aspartate (NMDA) receptor agonist-to-antagonist balance. The excitotoxicity index increased in HIPP. Data are shown as mean ± SD. Symbols: •, outlier; ▲, far out. Statistical significance: *, p < 0.05; **, p < 0.01. Figures generated with LabPlot 2.9.0 (KDE, Berlin, Germany) and BioRender.com. 3-HK, 3-hydroxykynurenine; AA, anthranilic acid; CER, cerebellum; CTX, cortex; HIPP, hippocampus; kat2−/−, kynurenine aminotransferase II knockout mice; KYNA, kynurenic acid; QA, quinolinic acid; STEM, brainstem; STR, striatum; WT, wild-type mice; XA, xanthurenic acid.
Figure 7. Regional indices of oxidative stress and excitotoxicity in wild-type (WT) and kat2−/− mice. Box plots showing oxidative stress and excitotoxicity indices across striatum (STR), cortex (CTX), hippocampus (HIPP), cerebellum (CER), and brainstem (STEM) in WT (light green) and kat2−/− (dark green) mice. a) Oxidative stress index, calculated as the ratio 3-HK/(KYNA+AA+XA), reflecting the balance between pro-oxidant and antioxidant metabolites. The oxidative stress index significantly increased in CTX, HIPP, CER and STEM. b) Excitotoxicity index, calculated as the ratio QA/KYNA, representing the N-methyl-D-aspartate (NMDA) receptor agonist-to-antagonist balance. The excitotoxicity index increased in HIPP. Data are shown as mean ± SD. Symbols: •, outlier; ▲, far out. Statistical significance: *, p < 0.05; **, p < 0.01. Figures generated with LabPlot 2.9.0 (KDE, Berlin, Germany) and BioRender.com. 3-HK, 3-hydroxykynurenine; AA, anthranilic acid; CER, cerebellum; CTX, cortex; HIPP, hippocampus; kat2−/−, kynurenine aminotransferase II knockout mice; KYNA, kynurenic acid; QA, quinolinic acid; STEM, brainstem; STR, striatum; WT, wild-type mice; XA, xanthurenic acid.
Preprints 179819 g007
Table 1. Behavioral performance in WT and kat2−/− mice across multiple cognitive, social, and motor tests (NORT, OBAT, Y-Maze, MBT, 3CT, and Rotarod). Analyses revealed no significant inter-strain differences.
Table 1. Behavioral performance in WT and kat2−/− mice across multiple cognitive, social, and motor tests (NORT, OBAT, Y-Maze, MBT, 3CT, and Rotarod). Analyses revealed no significant inter-strain differences.
Behavioral
test
type
Number of
animals
(WT/kat2-/-)
Phase of
the test
Parameter of
the test
WT
mean ± SD
kat2-/-
mean ± SD
p-value
NORT 12/12 Testing
phase
Time spent with
familiar object (s)
17.500 ± 8.635 18.556 ± 11.886 p < 0.839
Time spent with
novel object (s)
66.250 ± 59.461 72.444 ± 38.730 p < 0.596
Discrimination
index
0.455 ± 0.321 0.592 ± 0.141 p < 0.294
Preference
index
72.760 ± 16.032 79.604 ± 7.061 p < 0.293
OBAT 12/12 Testing
phase
Time spent with
familiar object (s)
15.362 ± 7.437 10.729 ± 6.786 p < 0.905
Time spent with
novel object (s)
19.747 ± 7.820 15.796 ± 6.372 p < 0.268
Discrimination
index
0.136 ± 0.239 0.239 ± 0.287 p < 0.428
Preference
index (%)
56.802 ± 11.943 61.944 ± 14.355 p < 0.428
Y-maze 12/12 - Spontaneous
alternations (%)
52.833 ± 27.996 66.500 ± 18.880 p < 0.175
Number of
total entries
15.583 ± 11.579 18.000 ± 15.788 p < 0.954
MBT 10/13 - Buried
marbles
5.467 ± 4.207 6.133 ± 4.121 p < 0.738
Partially buried
marbles
4.267 ± 2.344 4.533 ± 2.326 p < 0.757
Displaced
marbles
1.733 ± 1.870 1.333 ± 1.345 p < 0.731
Intact
marbles
4.533 ± 3.248 4.000 ± 2.976 p < 0.643
3CT 12/12 Testing
sociability
Time in
social chamber (s)
265.717 ± 40.368 260.658 ± 54.993 p < 0.799
Time in
non-social chamber (s)
247.748 ± 25.751 247.988 ± 56.056 p < 0.989
Time in
center chamber (s)
86.536 ± 32.148 91.355 ± 28.005 p < 0.699
Sniffing
social cage (s)
145.955 ± 39.690 136.336 ± 37.149 p < 0.546
Sniffing
non-social cage (s)
114.603 ± 33.637 117.447 ± 33.452 p < 0.837
Total sniffing
time (s)
260.558 ± 38.784 253.783 ± 47.129 p < 0.704
Social chamber entries (number) 12.667 ± 3.725 13.417 ± 4.621 p < 0.666
Non-social chamber entries (number) 13.167 ± 4.174 12.833 ± 4.687 p < 0.855
Total entries (number) 25.833 ± 7.673 26.250 ± 9.245 p < 0.905
Testing
novelty
preference
Time in
novel chamber (s)
263.188 ± 60.124 253.058 ± 68.641 p < 0.704
Time in
familiar chamber (s)
238.687 ± 55.961 237.654 ± 56.502 p < 0.964
Time in
center chamber (s)
98.126 ± 40.008 109.288 ± 53.470 p < 0.568
Sniffing
novel animal’s cage (s)
129.261 ± 50.164 109.373 ± 44.085 p < 0.313
Sniffing
familiar animal’s cage (s)
95.015 ± 51.306 92.903 ± 62.090 p < 0.928
Total sniffing
time (s)
224.276 ± 75.342 202.276 ± 79.270 p < 0.493
Novel chamber entries (number) 9.917 ± 3.450 11.083 ± 3.679 p < 0.431
Familiar chamber entries (number) 10.250 ± 3.279 11.167 ± 4.764 p < 0.589
Total entries (number) 20.167 ± 6.548 22.250 ± 7.979 p < 0.492
Rotarod 12/12 - Mean time spent
on the rod
100.428 ± 35.017 89.708 ± 41.453 p < 0.501
Mean ± SD. 3CT, three-chamber test; MBT, marble burying test; NORT, novel object recognition test; OBAT, object-based attention test.
Table 2. Comparative behavioral performance of wild-type (WT) and kat2−/− mice in object recognition (NORT, OBAT) and social interaction/novelty preference (3CT). In the NORT, both WT and kat2-/- mice demonstrated a significant preference for the novel object. In the OBAT, the mutant strain exhibited greater exploration of the novel object. In the 3CT, both genotypes spent more time in the side chambers than in the center chamber during both the sociability and novelty preference phases.
Table 2. Comparative behavioral performance of wild-type (WT) and kat2−/− mice in object recognition (NORT, OBAT) and social interaction/novelty preference (3CT). In the NORT, both WT and kat2-/- mice demonstrated a significant preference for the novel object. In the OBAT, the mutant strain exhibited greater exploration of the novel object. In the 3CT, both genotypes spent more time in the side chambers than in the center chamber during both the sociability and novelty preference phases.
Test
type
Phase of the test WT kat2-/-
NORT Testing
phase
Sniffing
familiar
object (s)
Sniffing
novel
object (s)
p-value Sniffing
familiar
object (s)
Sniffing
novel
object (s)
p-value
17.500 ± 8.635 66.250 ± 59.461 p < 0.018 * 18.556 ± 11.886 72.444 ± 38.730 p < 0.001 ***
OBAT Testing
phase
Sniffing
familiar
object (s)
Sniffing
novel
object (s)
Sniffing
familiar
object (s)
Sniffing
novel
object (s)
15.362 ± 7.437 19.747 ± 7.820 p < 0.081 10.729 ± 6.786 15.796 ± 6.372 p < 0.039 *
3CT Testing
sociability
Time in
social
chamber (s)
Time in
center
chamber (s)
Time in
social
chamber (s)
Time in
center
chamber (s)
265.717 ± 40.368 86.536 ± 32.148 p < 0.001 *** 260.658 ± 54.993 91.355 ± 28.005 p < 0.001 ***
Time in
non-social
chamber (s)
Time in
center
chamber (s)
Time in
non-social
chamber (s)
Time in
center
chamber (s)
247.748 ± 25.751 86.536 ± 32.148 p < 0.001 *** 247.988 ± 56.056 91.355 ± 28.005 p < 0.001 ***
Time in
social
chamber (s)
Time in
non-social
chamber (s)
Time in
social
chamber (s)
Time in
non-social
chamber (s)
265.717 ± 40.368 247.748 ± 25.751 p < 0.319 260.658 ± 54.993 247.988 ± 56.056 p < 0.691
Sniffing
social
cage (s)
Sniffing
non-social
cage (s)
Sniffing
social
cage (s)
Sniffing
non-social
cage (s)
145.955 ± 39.690 114.603 ± 33.637 p < 0.110 136.336 ± 37.149 117.447 ± 33.452 p < 0.240
Social
chamber
entries
(number)
Non-social
chamber
entries
(number)
Social
chamber
entries
(number)
Non-social
chamber
entries
(number)
12.667 ± 3.725 13.167 ± 4.174 p < 0.389 13.417 ± 4.621 12.833 ± 4.687 p < 0.089
Testing
novelty
preference
Time in
novel
chamber (s)
Time in
center
chamber (s)
Time in
novel
chamber (s)
Time in
center
chamber (s)
263.188 ± 60.124 98.126 ± 40.008 p < 0.001 *** 253.058 ± 68.641 109.288 ± 53.470 p < 0.002 **
Time in
familiar
chamber (s)
Time in
center
chamber (s)
Time in
familiar
chamber (s)
Time in
center
chamber (s)
238.687 ± 55.961 98.126 ± 40.008 p < 0.001 *** 237.654 ± 56.502 109.288 ± 53.470 p < 0.001 ***
Time in
novel
chamber (s)
Time in
familiar
chamber (s)
Time in
novel
chamber (s)
Time in
familiar
chamber (s)
263.188 ± 60.124 238.687 ± 55.961 p < 0.453 253.058 ± 68.641 237.654 ± 56.502 p < 0.754
Sniffing
novel
animal’s
cage (s)
Sniffing
familiar
animal’s
cage (s)
Sniffing
novel
animal’s
cage (s)
Sniffing
familiar
animal’s
cage (s)
129.261 ± 50.164 95.015 ± 51.306 p < 0.109 109.373 ± 44.085 92.903 ± 62.090 p < 0.530
Novel
chamber
entries
(number)
Familiar
chamber
entries
(number)
Novel
chamber
entries
(number)
Familiar
chamber
entries
(number)
9.917 ± 3.450 10.250 ± 3.279 p < 0.474 11.083 ± 3.679 11.167 ± 4.764 p < 0.681
For each paradigm, parameters include object sniffing duration, time allocation across chambers, sniffing of social/non-social targets, and chamber entries. Statistical significance was assessed for within-group contrasts (familiar vs. novel; social vs. non-social; chamber comparisons), and p-values are reported. Asterisks denote significance levels: *, p < 0.05, **, p < 0.01, ***, p < 0.001. 3CT, three-chamber test; kat2-/-, kynurenine aminotransferase II knockout mice; NORT, novel object recognition test; OBAT, object-based attention test; WT, wild-type mice.
Table 3. Regional brain concentrations of tryptophan (Trp) and its downstream metabolites in wild-type (WT) and kat2/ mice across striatum, cortex, hippocampus, cerebellum, and brainstem.
Table 3. Regional brain concentrations of tryptophan (Trp) and its downstream metabolites in wild-type (WT) and kat2/ mice across striatum, cortex, hippocampus, cerebellum, and brainstem.
Metabolite Striatum (nM) Cortex (nM) Hippocampus (nM) Cerebellum (nM) Brainstem (nM)
Mean ± SD p-value Mean ± SD p-value Mean ± SD p-value Mean ± SD p-value Mean ± SD p-value
WT kat2-/- WT kat2-/- WT kat2-/- WT kat2-/- WT kat2-/-
Trp 25511.111 ± 5688.243 21988.889 ± 1940.647 p < 0.098 30780.000 ± 5921.674 24090.000 ± 2431.026 p < 0.004 ** 30433.333 ± 7230.664 25000.000 ± 2256.103 p < 0.047 * 29530.000 ± 6997.468 25410.000 ± 2154.814 p < 0.092 29210.000 ± 8273.579 24730.000 ± 2685.786 p < 0.121
KYN 146.444 ± 32.423 152.000 ± 45.031 p < 0.768 123.880 ± 27.763 121.230 ± 40.829 p < 0.867 126.822 ± 25.699 124.600 ± 38.033 p < 0.886 204.000 ± 173.369 129.880 ± 56.356 p < 0.215 132.130 ± 37.311 119.560 ± 41.100 p < 0.483
KYNA 1.757 ± 0.623 3.561 ± 2.124 p < 0.026 * 5.428 ± 3.032 2.963 ± 1.108 p < 0.027 * 2.683 ± 0.885 1.787 ± 0.647 p < 0.026 * 5.347 ± 0.925 4.832 ± 1.728 p < 0.417 4.315 ± 1.303 3.273 ± 0.974 p < 0.058
QAA no data no data no data 0.812 ± 0.298 0.714 ± 0.127 p < 0.349 0.765 ± 0.216 0.807 ± 0.188 p < 0.671 0.416 ± 0.210 0.249 ± 0.113 p < 0.040 * 0.469 ± 0.323 0.171 ± 0.102 p < 0.012 *
AA 2.534 ± 0.771 2.431 ± 1.145 p < 0.825 0.320 ± 0.089 0.461 ± 0.176 p < 0.036 * 0.323 ± 0.136 0.213 ± 0.077 p < 0.050 0.400 ± 0.148 0.296 ± 0.193 p < 0.192 0.554 ± 0.209 0.477 ± 0.308 p < 0.523
3-HK 43.078 ± 7.418 78.644 ± 40.163 p < 0.019 * 50.230 ± 15.967 87.210 ± 42.381 p < 0.019 * 57.667 ± 15.585 104.467 ± 41.026 p < 0.006 ** 77.460 ± 30.378 118.100 ± 51.104 p < 0.044 * 47.070 ± 12.161 83.740 ± 35.505 p < 0.006 **
XA 1.906 ± 1.161 1.342 ± 0.662 p < 0.224 7.316 ± 5.644 2.516 ± 1.631 p < 0.019 * 1.698 ± 0.800 0.885 ± 0.406 p < 0.015 * 2.402 ± 0.838 1.349 ± 0.903 p < 0.015 * 3.945 ± 2.037 1.324 ± 0.854 p < 0.001 ***
3-HAA no data no data no data 6.581 ± 2.409 10.128 ± 3.732 p < 0.021 * 3.820 ± 1.574 3.994 ± 2.532 p < 0.863 no data no data no data no data no data no data
QA 20.337 ± 11.449 32.537 ± 15.421 p < 0.075 35.650 ± 11.656 32.946 ± 20.266 p < 0.719 18.296 ± 7.872 24.667 ± 11.260 p < 0.183 27.057 ± 21.057 20.015 ± 12.182 p < 0.372 28.390 ± 16.309 30.201 ± 13.870 p < 0.792
PA 223.877 ± 45.544 233.296 ± 67.819 p < 0.734 146.707 ± 43.541 171.643 ± 46.369 p < 0.231 165.885 ± 81.710 146.251 ± 46.419 p < 0.540 213.970 ± 57.567 291.345 ± 135.202 p < 0.152 220.273 ± 63.283 246.122 ± 89.874 p < 0.467
Serotonin pathway
5-HTP 55.689 ± 11.051 37.989 ± 20.492 p < 0.037 * 80.070 ± 26.609 37.490 ± 15.897 p < 0.001 *** 48.167 ± 15.514 42.011 ± 9.346 p < 0.323 11.708 ± 4.638 6.451 ± 2.871 p < 0.007 ** 65.120 ± 19.882 65.200 ± 34.451 p < 0.995
5-HT 2854.444 ± 281.741 3087.778 ± 318.856 p < 0.119 2780.000 ± 364.722 3238.000 ± 304.478 p < 0.007 ** 3162.222 ± 368.571 3316.667 ± 482.519 p < 0.457 382.600 ± 182.449 423.500 ± 218.472 p < 0.655 3542.000 ± 426.375 3554.000 ± 334.006 p < 0.945
5-HIAA 2771.111 ± 232.886 2825.556 ± 493.739 p < 0.769 2816.000 ± 511.147 2634.000 ± 333.340 p < 0.358 3984.444 ± 640.666 3618.889 ± 412.566 p < 0.169 952.300 ± 165.692 954.100 ± 216.632 p < 0.984 3998.000 ± 733.664 4076.000 ± 651.804 p < 0.804
Indole-pyruvate pathway
IAA 263.000 ± 94.166 196.111 ± 59.711 p < 0.091 174.300 ± 46.294 160.100 ± 32.385 p < 0.437 179.000 ± 41.985 113.767 ± 30.709 p < 0.002 ** 47.260 ± 26.084 62.300 ± 18.091 p < 0.151 126.790 ± 38.684 106.450 ± 17.163 p < 0.146
ICA 52.522 ± 15.104 67.000 ± 25.999 p < 0.168 53.590 ± 10.768 85.520 ± 23.399 p < 0.001 *** 58.078 ± 12.274 48.344 ± 7.459 p < 0.059 46.850 ± 16.225 70.060 ± 31.928 p < 0.055 57.430 ± 18.870 56.190 ± 21.972 p < 0.894
IPA no data no data no data no data no data no data no data no data no data 14.509 ± 7.547 12.995 ± 6.244 p < 0.631 29.370 ± 14.081 19.479 ± 5.821 p < 0.055
ILA 88.656 ± 49.392 54.078 ± 17.784 p < 0.066 91.820 ± 24.495 74.690 ± 11.764 p < 0.062 122.067 ± 43.164 91.444 ± 23.630 p < 0.080 62.750 ± 18.591 59.500 ± 12.143 p < 0.649 106.910 ± 19.352 68.030 ± 12.774 p < 0.001 ***
INS 136.444 ± 124.642 66.144 ± 22.154 p < 0.115 181.320 ± 108.171 129.140 ± 54.474 p < 0.190 102.700 ± 93.846 48.411 ± 15.970 p < 0.106 114.680 ± 46.885 73.380 ± 32.000 p < 0.034 * 135.570 ± 66.490 86.080 ± 27.670 p < 0.043 *
pCS 22.863 ± 45.643 6.428 ± 3.057 p < 0.297 13.201 ± 15.641 6.452 ± 6.191 p < 0.221 11.421 ± 14.434 2.932 ± 1.870 p < 0.099 28.415 ± 45.171 4.284 ± 2.878 p < 0.109 5.987 ± 5.293 4.280 ± 4.371 p < 0.442
Tyrosine-dopamine pathway
Tyr 55533.333 ± 25146.620 47200.000 ± 66.11.354 p < 0.351 74760.000 ± 27036.856 55710.000 ± 9047.216 p < 0.049 * 76522.222 ± 33835.513 57944.444 ± 10032.337 p < 0.134 72320.000 ± 27354.983 57480.000 ± 6273.542 p < 0.112 67800.000 ± 25030.026 53600.000 ± 9267.026 p < 0.110
L-DOPA no data no data no data 130.840 ± 71.182 119.180 ± 91.862 p < 0.755 147.389 ± 60.587 122.400 ± 31.455 p < 0.288 97.580 ± 16.040 103.530 ± 54.909 p < 0.746 144.090 ± 139.318 118.740 ± 19.909 p < 0.576
3OMD 43.067 ± 11.017 48.467 ± 22.082 p < 0.521 42.010 ± 7.379 46.620 ± 10.305 p < 0.265 42.867 ± 13.189 41.678 ± 9.240 p < 0.828 44.220 ± 8.036 38.350 ± 6.488 p < 0.089 36.990 ± 11.834 35.540 ± 8.342 p < 0.755
DA 238805.321 ± 62124.925 226596.946 ± 85742.994 p < 0.734 11460.000 ± 4415.938 9733.000 ± 1997.838 p < 0.265 327.778 ± 184.660 301.556 ± 119.914 p < 0.726 126.260 ± 129.803 90.500 ± 32.822 p < 0.409 373.800 ± 137.416 320.700 ± 78.006 p < 0.302
3-MT 12277.778 ± 3429.001 15417.778 ± 7109.386 p < 0.250 2637.000 ± 1213.370 3510.000 ± 2184.272 p < 0.284 72.811 ± 27.012 76.333 ± 42.626 p < 0.837 48.360 ± 51.290 39.780 ± 27.131 p < 0.646 108.990 ± 55.943 100.420 ± 45.985 p < 0.713
DOPAC 9731.111 ± 2098.681 8508.889 ± 2173.571 p < 0.243 3231.000 ± 662.528 2604.000 ± 1298.026 p < 0.190 99.844 ± 31.080 119.122 ± 46.575 p < 0.317 118.510 ± 70.272 58.230 ± 22.991 p < 0.019 * 286.600 ± 83.187 269.700 ± 90.096 p < 0.668
HVA 8845.556 ± 1621.983 9957.778 ± 2933.235 p < 0.334 3219.000 ± 465.271 2994.000 ± 815.383 p < 0.458 563.667 ± 249.747 622.000 ± 272.426 p < 0.642 241.000 ± 72.399 235.410 ± 110.270 p < 0.895 512.900 ± 142.529 479.100 ± 199.441 p < 0.668
VMA no data no data no data 6.815 ± 4.531 9.876 ± 7.149 p < 0.268 4.113 ± 2.537 7.131 ± 3.580 p < 0.056 23.772 ± 34.420 34.862 ± 38.254 p < 0.504 7.121 ± 4.828 8.801 ± 6.926 p < 0.537
MHPGS 31.467 ± 15.193 33.022 ± 10.663 p < 0.805 42.420 ± 20.320 47.070 ± 7.532 p < 0.506 49.722 ± 16.118 46.011 ± 9.992 p < 0.565 23.668 ± 27.307 17.066 ± 6.494 p < 0.467 21.700 ± 9.295 22.040 ± 5.288 p < 0.921
BIO 43.611 ± 16.815 55.533 ± 18.984 p < 0.178 22.410 ± 7.193 18.823 ± 10.159 p < 0.374 15.201 ± 11.095 14.789 ± 12.229 p < 0.941 15.690 ± 3.897 9.233 ± 3.056 p < 0.001 *** 62.380 ± 19.428 41.020 ± 9.643 p < 0.006 **
BH2 514.956 ± 164.623 441.378 ± 173.194 p < 0.369 no data no data no data no data no data no data 117.947 ± 16.544 76.528 ± 22.014 p < 0.001 *** 222.409 ± 82.207 192.147 ± 59.659 p < 0.359
Mean ± SD. Asterisks indicate significance levels: *, p < 0.05; **, p < 0.01; ***, p < 0.001. 3-HAA, 3-hydroxyanthranilic acid; 3-HK, 3-hydroxykynurenine; 3-MT, 3-methoxytyramine; 5-HIAA, 5-hydroxyindoleacetic acid; 5-HT, serotonin (5-hydroxytryptamine); 5-HTP, 5-hydroxytryptophan; AA, anthranilic acid; BH2, dihydrobiopterin; BIO, biopterin; DA, dopamine; DOPAC, 3,4-dihydroxyphenylacetic acid; HVA, homovanillic acid; ICA, indole-3-carboxaldehyde; IAA, indole-3-acetic acid; ILA, indole-3-lactic acid; INS, indoxyl sulfate; IPA, indole-3-propionic acid; KYN, kynurenine; KYNA, kynurenic acid; L-DOPA, levodopa; 3OMD, 3-O-methyldopa; MHPGS, 3-methoxy-4-hydroxyphenylglycol sulfate; PA, picolinic acid; pCS, p-Cresyl sulfate; QA, quinolinic acid; QAA, quinaldic acid; Trp, tryptophan; Tyr, tyrosine; VMA, vanillylmandelic acid; XA, xanthurenic acid.
Table 4. Concentrations of indole-pyruvate and tyrosine-dopamine pathway metabolites in wild-type (WT) and kat2-/- mice in plasm and urine.
Table 4. Concentrations of indole-pyruvate and tyrosine-dopamine pathway metabolites in wild-type (WT) and kat2-/- mice in plasm and urine.
Metabolite Plasm (nM) Urine (nM)
Mean ± SD p-value Mean ± SD p-value
WT kat2-/- WT kat2-/-
Indole-pyruvate pathway
ICA no data no data no data no data no data no data
IPA no data no data no data no data no data no data
ILA no data no data no data no data no data no data
pCS 853.520 ± 961.663 1097.193 ± 1196.572 p < 0.622 9683.873 ± 15558.939 7429.639 ± 12598.662 p < 0.726
Tyrosine-dopamine pathway
Tyr 50824.432 ± 20811.617 35775.857
±16975.863
p < 0.093 9411.420 ± 2214.266 8789.288 ± 1547.575 p < 0.476
L-DOPA 36.800 ± 15.606 35.109 ± 13.708 p < 0.800 no data no data no data
3OMD 36.340 ± 5.556 31.128 ± 5.595 p < 0.051 41.828 ± 21.255 40.299 ± 17.829 p < 0.864
DA no data no data no data 671.105 ± 320.951 779.887 ± 193.877 p < 0.371
3-MT 2.653 ± 1.315 1.796 ± 0.655 p < 0.082 241.517 ± 93.336 235.939 ± 50.578 p < 0.870
DOPAC no data no data no data 370.196 ± 224.797 301.471 ± 108.291 p < 0.395
HVA no data no data no data 1120.520 ± 890.606 731.657 ± 173.621 p < 0.192
VMA no data no data no data 820.064 ± 567.571 760.459 ± 124.132 p < 0.749
MHPGS 27.657 ± 12.496 15.392 ± 6.886 p < 0.014 * 8533.153 ± 3929.104 14639.178 ± 3364.617 p < 0.002 **
BIO 68.419 ± 23.013 82.535 ± 17.725 p < 0.142 231.328 ± 80.142 221.133 ± 88.018 p < 0.790
BH2 588.898 ± 122.352 577.701 ± 178.965 p < 0.872 4508.851 ± 2655.882 4488.304 ± 2298.353 p < 0.985
Mean ± SD. Asterisks indicate significance levels: *, p < 0.05; **, p < 0.01. 3OMD, 3-O-methyldopa; 3-MT, 3-methoxytyramine; BH2, dihydroxybiopterin; BIO, biopterin; DA, dopamine; DOPAC, 3,4-dihydroxyphenylacetic acid; HVA, homovanillic acid; ICA, indole-3-carboxaldehyde; ILA, indole-3-lactic acid; IPA, 3-indolepropionic acid; kat2-/-, kynurenine aminotransferase II knockout mice; L-DOPA, levodopa; MHPGS, 3-methoxy-4-hydroxyphenylglycol sulphate; pCS, para-Cresol sulphate; SD, standard deviance; Tyr, tyrosine; VMA, vanillylmandelic acid; WT, wild-type mice.
Table 5. Ratios of tryptophan (Trp)-derived metabolites to their precursors and associated enzyme activities across brain regions in wild-type (WT) and kat2−/− mice (mean ± SD, p-values). Activities were estimated using product-to-substrate ratios for key enzymatic steps: TDO/IDOs (KYN/Trp), KATs (KYNA/KYN), KMO (3-HK/KYN), KYNU (AA/KYN; 3-HAA/3-HK), KAT III (XA/3-HK), 3-HAO (QA/3-HAA; PA/3-HAA), TPHs (5-HTP/Trp), AADC (5-HT/5-HTP), MAOs + ALDH (5-HIAA/5-HT), TMO (IAA/Trp), and TNA (INS/Trp).
Table 5. Ratios of tryptophan (Trp)-derived metabolites to their precursors and associated enzyme activities across brain regions in wild-type (WT) and kat2−/− mice (mean ± SD, p-values). Activities were estimated using product-to-substrate ratios for key enzymatic steps: TDO/IDOs (KYN/Trp), KATs (KYNA/KYN), KMO (3-HK/KYN), KYNU (AA/KYN; 3-HAA/3-HK), KAT III (XA/3-HK), 3-HAO (QA/3-HAA; PA/3-HAA), TPHs (5-HTP/Trp), AADC (5-HT/5-HTP), MAOs + ALDH (5-HIAA/5-HT), TMO (IAA/Trp), and TNA (INS/Trp).
Enzyme Product/Substrate Striatum Cortex Hippocampus Cerebellum Brainstem
Mean ± SD p-value Mean ± SD p-value Mean ± SD p-value Mean ± SD p-value Mean ± SD p-value
WT kat2-/- WT kat2-/- WT kat2-/- WT kat2-/- WT kat2-/-
TDO/IDOs KYN/Trp 0.006 ± 0.001 0.007 ± 0.002 p < 0.188 0,004 ± 0,001 0.005 ± 0.001 p < 0.212 0.004 ± 0.001 0.005 ± 0.001 p < 0.245 0.006 ± 0.004 0.005 ± 0.002 p < 0.349 0.005 ± 0.001 0.005 ± 0.002 P < 0.907
KATs KYNA/KYN 0.012 ± 0.005 0.026 ± 0.017 p < 0.035 * 0.045 ± 0.027 0.026 ± 0.012 p < 0.063 0.022 ± 0.010 0.015 ± 0.007 p < 0.099 0.036 ± 0.015 0.041 ± 0.019 p < 0.487 0.034 ± 0.011 0.032 ± 0.017 P < 0.696
KMO 3-HK/KYN 0.305 ± 0.075 0.510 ± 0.216 p < 0.002 ** 0.413 ± 0.131 0.714 ± 0.262 p < 0.001 ** 0.463 ± 0.121 0.844 ± 0.264 p < 0.001 *** 0.458 ± 0.139 0.957 ± 0.365 p < 0.001 *** 0.365 ± 0.087 0.709 ± 0.230 P < 0.001 ***
KYNU AA/KYN 0.018 ± 0.006 0.018 ± 0.009 p < 0.951 0.003 ± 0.001 0.004 ± 0.003 p < 0.208 0.003 ± 0.001 0.002 ± 0.001 p < 0.301 0.003 ± 0.001 0.003 ± 0.002 p < 0.913 0.004 ± 0.002 0.005 ± 0.004 P < 0.651
KYNU 3-HAA/3-HK no data no data no data 0.135 ± 0.040 0.125 ± 0.034 p < 0.540 0.072 ± 0.036 0.038 ± 0.020 p < 0.026 * no data no data no data no data no data no data
KAT III XA/3-HK 0.045 ± 0.027 0.022 ± 0.018 p < 0.052 0.151 ± 0.106 0.035 ± 0.027 p < 0.001 ** 0.031 ± 0.017 0.011 ± 0.009 p < 0.007 ** 0.034 ± 0.015 0.014 ± 0.015 p < 0.001 ** 0.088 ± 0.054 0.020 ± 0.017 P < 0.001 ***
3-HAO QA/3-HAA no data no data no data 5.910 ± 2.878 3.693 ± 2.022 p < 0.112 6.125 ± 4.070 10.220 ± 9.885 p < 0.508 no data no data no data no data no data no data
3-HAO + ACMSD PA/3-HAA no data no data no data 23.688 ± 7.982 20.024 ± 13.316 p < 0.082 66.477 ± 82.924 51.852 ± 33.947 p < 0.895 no data no data no data no data no data no data
TPHs 5-HTP/Trp 0.002 ± 0.000 0.002 ± 0.001 p < 0.313 0.003 ± 0.001 0.002 ± 0.001 p < 0.005 ** 0.002 ± 0.000 0.002 ± 0.000 p < 0.331 0.000 ± 0.000 0.000 ± 0.000 p < 0.003 ** 0.002 ± 0.001 0.003 ± 0.001 P < 1.000
AADC 5-HT/5-HTP 53.246 ± 12.810 110.941 ± 73.047 p < 0.015 * 37.833 ± 12.360 102.426 ± 43.532 p < 0.001 ** 72.470 ± 26.437 82.603 ± 22.339 p < 0.393 34.597 ± 17.138 74.676 ± 41.567 p < 0.004 ** 63.557 ± 38.662 68.894 ± 37.313 P < 0.496
MAOs + ALDH 5-HIAA/5-HT 0.982 ± 0.148 0.922 ± 0.180 p < 0.453 1.036 ± 0.280 0.822 ± 0.141 p < 0.044 * 1.290 ± 0.327 1.126 ± 0.285 p < 0.274 2.905 ± 1.239 2.539 ± 0.796 p < 0.442 1.150 ± 0.271 1.160 ± 0.232 P < 0.926
TMO (TrD, ArAT) IAA/Trp 0.010 ± 0.003 0.009 ± 0.002 p < 0.212 0.006 ± 0.002 0.007 ± 0.001 p < 0.054 0.006 ± 0.001 0.005 ± 0.001 p < 0.021 * 0.002 ± 0.001 0.002 ± 0.001 p < 0.026 * 0.004 ± 0.001 0.004 ± 0.001 P < 0.597
TNA INS/Trp 0.005 ± 0.003 0.003 ± 0.001 p < 0.554 0.006 ± 0.003 0.005 ± 0.002 p < 0.624 0.003 ± 0.002 0.002 ± 0.001 p < 0.161 0.004 ± 0.002 0.003 ± 0.001 p < 0.170 0.005 ± 0.003 0.003 ± 0.001 P < 0.147
Data are expressed as mean ± SD. Significance: *, p < 0.05; **, p < 0.01; ***, p < 0.001. 3-HAA, 3-hydroxyanthranilic acid; 3-HAO, 3-hydroxyanthranilate oxidase; 3-HK, 3-hydroxykynurenine; AA, anthranilic acid; AADC, aromatic L-amino acid decarboxylase; ACMSD, aminocarboxymuconate-semialdehyde decarboxylase; ALDH, aldehyde dehydrogenase; CER, cerebellum; CTX, cortex; HIPP, hippocampus; IAA, indole-3-acetic acid; IDOs, indoleamine 2,3-dioxygenases; INS, indoxyl sulfate; kat2-/-, kynurenine aminotransferase II knockout mice; KATs, kynurenine aminotransferases; KMO, kynurenine 3-monooxygenase; KYNA, kynurenic acid; KYNU, kynureninase; MAOs, monoamine oxidases; PA, picolinic acid; QA, quinolinic acid; QAA, quinolinic acid analog; STEM, brainstem; STR, striatum; TDO, tryptophan 2,3-dioxygenase; TMO, tryptophan monooxygenase; TNA, tryptophan N-acetyltransferase; TrD, tryptophan deaminase; Trp, tryptophan; Tyr, tyrosine; 5-HIAA, 5-hydroxyindoleacetic acid; 5-HT, serotonin (5-hydroxytryptamine); 5-HTP, 5-hydroxytryptophan; WT, wild-type mice; XA, xanthurenic acid.
Table 6. Ratios of oxidant/antioxidant and N-methyl-D-aspartate (NMDA) agonist/antagonist metabolites across brain regions in wild-type (WT) and kat2−/− mice (mean ± SD, p-values). Regional indices of oxidative stress and excitotoxicity in WT and kat2−/− mice. Oxidative stress was quantified using the ratio 3-HK/(KYNA+AA+XA), reflecting the balance between pro-oxidant and antioxidant metabolites, while excitotoxic potential was assessed by the ratio QA/KYNA, indicating NMDA receptor agonist/antagonist balance. Measurements were performed across striatum, cortex, hippocampus, cerebellum, and brainstem. Data are presented as mean ± SD.
Table 6. Ratios of oxidant/antioxidant and N-methyl-D-aspartate (NMDA) agonist/antagonist metabolites across brain regions in wild-type (WT) and kat2−/− mice (mean ± SD, p-values). Regional indices of oxidative stress and excitotoxicity in WT and kat2−/− mice. Oxidative stress was quantified using the ratio 3-HK/(KYNA+AA+XA), reflecting the balance between pro-oxidant and antioxidant metabolites, while excitotoxic potential was assessed by the ratio QA/KYNA, indicating NMDA receptor agonist/antagonist balance. Measurements were performed across striatum, cortex, hippocampus, cerebellum, and brainstem. Data are presented as mean ± SD.
Oxidant/antioxidant metabolites Striatum Cortex Hippocampus Cerebellum Brainstem
Mean ± SD p-value Mean ± SD p-value Mean ± SD p-value Mean ± SD p-value Mean ± SD p-value
WT kat2-/- WT kat2-/- WT kat2-/- WT kat2-/- WT kat2-/-
3-HK/(KYNA+AA+XA) 6.951 ± 2.904 10.723 ± 10.215 p < 0.627 4.700 ± 2.112 17.670 ± 13.315 p < 0.001 ** 13.509 ± 6.992 37.148 ± 15.859 p < 0.002 ** 9.667 ± 3.839 20.311 ± 9.275 p < 0.006 ** 5.740 ± 1.892 18.705 ± 9.300 p < 0.002 **
NMDA agonist/antagonist metabolites Striatum Cortex Hippocampus Cerebellum Brainstem
Mean ± SD p-value Mean ± SD p-value Mean ± SD p-value Mean ± SD p-value Mean ± SD p-value
WT kat2-/- WT kat2-/- WT kat2-/- WT kat2-/- WT kat2-/-
QA/KYNA 11.575 ± 18.379 9.138 ± 7.260 p < 0.923 9.263 ± 7.574 14.235 ± 14.254 p < 0.597 7.957 ± 5.478 16.120 ± 9.907 p < 0.046 * 5.306 ± 4.601 4.998 ± 4.789 p < 0.880 7.724 ± 7.414 10.224 ± 5.544 p < 0.096
Data are expressed as mean ± SD. Significance: *, p < 0.05; **, p < 0.01; ***, p < 0.001. 3-HK, 3-hydroxykynurenine; AA, anthranilic acid; kat2−/−, kynurenine aminotransferase II knockout mice; KYNA, kynurenic acid; NMDA. N-methyl-D-aspartate; QA, quinolinic acid; WT, wild-type mice; XA, xanthurenic acid.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.
Copyright: This open access article is published under a Creative Commons CC BY 4.0 license, which permit the free download, distribution, and reuse, provided that the author and preprint are cited in any reuse.
Prerpints.org logo

Preprints.org is a free preprint server supported by MDPI in Basel, Switzerland.

Subscribe

Disclaimer

Terms of Use

Privacy Policy

Privacy Settings

© 2026 MDPI (Basel, Switzerland) unless otherwise stated