Submitted:
12 September 2025
Posted:
15 September 2025
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Results
2.1. Expression and Purification of NSP12(P323L/G671S) and RNA Aptamer Selection by SELEX
2.2. Grouping and Comparative Binding Evaluation of SELEX-Enriched Aptamers
2.3. Affinity and Specific Binding of Selected RNA Aptamers
2.4. Inhibition of NSP12(P323L/G671S) Replication Activity by Selected RNA Aptamers
2.5. Binding to NSP12 Variants and Inhibition of Their Replication Activity by the Selected RNA Aptamers

3. Discussion
4. Materials and Methods
4.1. NSP12 protein purification
4.2. NSP7and NSP8 protein purification
4.3. In vitro transcription and purification of 2’-OH and 2-F RNA libraries
4.4. SELEX procedure
4.5. qRT-PCR-Based binding assay for NSP12(P323L/G671S)
4.6. RNA-protein pull-down assay
4.7. Competition assay
4.8. Dissociation constant(Kd) analysis
4.9. Primer extension assay
4.10. Mutagenesis
4.11. Statistics
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Hui, D.S.; I Azhar, E.; Madani, T.A.; Ntoumi, F.; Kock, R.; Dar, O.; Ippolito, G.; Mchugh, T.D.; Memish, Z.A.; Drosten, C.; et al. The Continuing 2019-nCoV Epidemic Threat of Novel Coronaviruses to Global Health — The Latest 2019 Novel Coronavirus Outbreak in Wuhan, China. Int. J. Infect. Dis. 2020, 91, 264–266. [CrossRef]
- Statement on the Fifteenth Meeting of the IHR (2005) Emergency Committee on the COVID-19 Pandemic Available online: https://www.who.int/news/item/05-05-2023-statement-on-the-fifteenth-meeting-of-the-international-health-regulations-(2005)-emergency-committee-regarding-the-coronavirus-disease-(covid-19)-pandemic (accessed on 15 July 2025).
- Hu, B.; Guo, H.; Zhou, P.; Shi, Z.-L. Characteristics of SARS-CoV-2 and COVID-19. Nat. Rev. Microbiol. 2021, 19, 141–154. [CrossRef]
- Brant, A.C.; Tian, W.; Majerciak, V.; Yang, W.; Zheng, Z.-M. SARS-CoV-2: From Its Discovery to Genome Structure, Transcription, and Replication. Cell Biosci. 2021, 11, 136. [CrossRef]
- Romano, M.; Ruggiero, A.; Squeglia, F.; Maga, G.; Berisio, R. A Structural View of SARS-CoV-2 RNA Replication Machinery: RNA Synthesis, Proofreading and Final Capping. Cells 2020, 9, 1267. [CrossRef]
- O’Leary, V.B.; Dolly, O.J.; Höschl, C.; Černa, M.; Ovsepian, S.V. Unpacking Pandora from Its Box: Deciphering the Molecular Basis of the SARS-CoV-2 Coronavirus. Int. J. Mol. Sci. 2021, 22, 386. [CrossRef]
- Peng, Q.; Peng, R.; Yuan, B.; Zhao, J.; Wang, M.; Wang, X.; Wang, Q.; Sun, Y.; Fan, Z.; Qi, J.; et al. Structural and Biochemical Characterization of the Nsp12-Nsp7-Nsp8 Core Polymerase Complex from SARS-CoV-2. Cell Rep. 2020, 31, 107774. [CrossRef]
- Minskaia, E.; Hertzig, T.; Gorbalenya, A.E.; Campanacci, V.; Cambillau, C.; Canard, B.; Ziebuhr, J. Discovery of an RNA Virus 3′→5′ Exoribonuclease That Is Critically Involved in Coronavirus RNA Synthesis. Proc. Natl. Acad Sci. USA 2006, 103, 5108–5113. [CrossRef]
- Denison, M.R.; Graham, R.L.; Donaldson, E.F.; Eckerle, L.D.; Baric, R.S. Coronaviruses: An RNA Proofreading Machine Regulates Replication Fidelity and Diversity. RNA Biol. 2011, 8, 270–279. [CrossRef]
- Tracking SARS-CoV-2 Variants Available online: https://www.who.int/activities/tracking-SARS-CoV-2-variants (accessed on 16 July 2025).
- Pachetti, M.; Marini, B.; Benedetti, F.; Giudici, F.; Mauro, E.; Storici, P.; Masciovecchio, C.; Angeletti, S.; Ciccozzi, M.; Gallo, R.C.; et al. Emerging SARS-CoV-2 Mutation Hot Spots Include a Novel RNA-Dependent-RNA Polymerase Variant. J. Transl. Med. 2020, 18, 179. [CrossRef]
- Hogan, M.J.; Pardi, N. mRNA Vaccines in the COVID-19 Pandemic and Beyond. Annu. Rev. Med. 2022, 73, 17–39. [CrossRef]
- Goldswain, H.; Dong, X.; Penrice-Randal, R.; Alruwaili, M.; Shawli, G.T.; Prince, T.; Williamson, M.K.; Raghwani, J.; Randle, N.; Jones, B.; et al. The P323L Substitution in the SARS-CoV-2 Polymerase (NSP12) Confers a Selective Advantage during Infection. Genome Biol. 2023, 24, 47. [CrossRef]
- SARS-CoV-2 Variants - Omicron BA.2 - Stanford Coronavirus Antiviral & Resistance Database (CoVDB) Available online: https://covdb.stanford.edu/variants/omicron_xbb/ (accessed on 17 July 2025).
- Kim, S.-M.; Kim, E.-H.; Casel, M.A.B.; Kim, Y.-I.; Sun, R.; Kwak, M.-J.; Yoo, J.-S.; Yu, M.; Yu, K.-M.; Jang, S.-G.; et al. SARS-CoV-2 Variants with NSP12 P323L/G671S Mutations Display Enhanced Virus Replication in Ferret Upper Airways and Higher Transmissibility. Cell Rep. 2023, 42, 113077. [CrossRef]
- Ellington, A.D.; Szostak, J.W. In Vitro Selection of RNA Molecules That Bind Specific Ligands. Nature 1990, 346, 818–822. [CrossRef]
- Tuerk, C.; Gold, L. Systematic Evolution of Ligands by Exponential Enrichment: RNA Ligands to Bacteriophage T4 DNA Polymerase. Science 1990, 249, 505–510. [CrossRef]
- Kim, T.-H.; Lee, S.-W. Aptamers for Anti-Viral Therapeutics and Diagnostics. Int. J. Mol. Sci. 2021, 22, 4168. [CrossRef]
- Ku, T.-H.; Zhang, T.; Luo, H.; Yen, T.M.; Chen, P.-W.; Han, Y.; Lo, Y.-H. Nucleic Acid Aptamers: An Emerging Tool for Biotechnology and Biomedical Sensing. Sensors 2015, 15, 16281–16313. [CrossRef]
- Stoltenburg, R.; Reinemann, C.; Strehlitz, B. SELEX—A (r)Evolutionary Method to Generate High-Affinity Nucleic Acid Ligands. Biomol. Eng. 2007, 24, 381–403. [CrossRef]
- Dunn, M.R.; Jimenez, R.M.; Chaput, J.C. Analysis of Aptamer Discovery and Technology. Nat. Rev. Chem. 2017, 1. [CrossRef]
- Bertolin, A.P.; Weissmann, F.; Zeng, J.; Posse, V.; Milligan, J.C.; Canal, B.; Ulferts, R.; Wu, M.; Drury, L.S.; Howell, M.; et al. Identifying SARS-CoV-2 Antiviral Compounds by Screening for Small Molecule Inhibitors of Nsp12/7/8 RNA-Dependent RNA Polymerase. Biochem. J. 2021, 478, 2425–2443. [CrossRef]
- Ilmjärv, S.; Abdul, F.; Acosta-Gutiérrez, S.; Estarellas, C.; Galdadas, I.; Casimir, M.; Alessandrini, M.; Gervasio, F.L.; Krause, K.-H. Concurrent Mutations in RNA-Dependent RNA Polymerase and Spike Protein Emerged as the Epidemiologically Most Successful SARS-CoV-2 Variant. Sci. Rep. 2021, 11, 13705. [CrossRef]
- Suratekar, R.; Ghosh, P.; Niesen, M.J.M.; Donadio, G.; Anand, P.; Soundararajan, V.; Venkatakrishnan, A.J. High Diversity in Delta Variant across Countries Revealed by Genome-wide Analysis of SARS-CoV-2 beyond the Spike Protein. Mol. Syst. Biol. 2022, 18, e10673. [CrossRef]
- Abbasian, M.H.; Rahimian, K.; Mahmanzar, M.; Bayat, S.; Kuehu, D.L.; Sisakht, M.M.; Moradi, B.; Deng, Y. Comparative Atlas of SARS-CoV-2 Substitution Mutations: A Focus on Iranian Strains Amidst Global Trends. Viruses 2024, 16, 1331. [CrossRef]
- Danda, M.; Klimešová, A.; Kušková, K.; Dostálková, A.; Pagáčová, A.; Prchal, J.; Kapisheva, M.; Ruml, T.; Rumlová, M. Biochemical Characterization of Naturally Occurring Mutations in SARS-CoV-2 RNA-Dependent RNA Polymerase. Protein Sci. 2024, 33, e5103. [CrossRef]
- Gandhi, S.; Klein, J.; Robertson, A.J.; Peña-Hernández, M.A.; Lin, M.J.; Roychoudhury, P.; Lu, P.; Fournier, J.; Ferguson, D.; Mohamed Bakhash, S.A.K.; et al. De Novo Emergence of a Remdesivir Resistance Mutation during Treatment of Persistent SARS-CoV-2 Infection in an Immunocompromised Patient: A Case Report. Nat. Commun. 2022, 13, 1547. [CrossRef]
- Lopez, U.M.; Hasan, Md.M.; Havranek, B.; Islam, S.M. SARS-CoV-2 Resistance to Small Molecule Inhibitors. Curr. Clin. Microbio. Rep. 2024, 11, 127–139. [CrossRef]
- Iriyama, C.; Ichikawa, T.; Tamura, T.; Takahata, M.; Ishio, T.; Ibata, M.; Kawai, R.; Iwata, M.; Suzuki, M.; Adachi, H.; et al. Clinical and Molecular Landscape of Prolonged SARS-CoV-2 Infection with Resistance to Remdesivir in Immunocompromised Patients. PNAS Nexus 2025, 4, pgaf085. [CrossRef]
- Zhang, J.; Wang, D.; Kwok, C.; Xu, L.; Famulok, M. Aptamer-Engaged Nanotherapeutics against SARS-CoV-2. Discov. Nano. 2025, 20, 71. [CrossRef]
- Huang, Y.; Chen, X.; Zhang, J.; Tian, W.; Liu, S.; Chun-Yee Tam, R.; Yang, C.; Song, Y. Aptamer-Based Strategies against SARS-CoV-2 Viruses. BMEMat 2023, 1, e12024. [CrossRef]
- Kratschmer, C.; Levy, M. Effect of Chemical Modifications on Aptamer Stability in Serum. Nucleic Acid Ther. 2017, 27, 335–344. [CrossRef]
- Layzer, J.M.; McCaffrey, A.P.; Tanner, A.K.; Huang, Z.; Kay, M.A.; Sullneger, B.A. In Vivo Activity of Nuclease-Resistant siRNAs. RNA 2004, 10, 766–771. [CrossRef]
- Valero, J.; Civit, L.; Dupont, D.M.; Selnihhin, D.; Reinert, L.S.; Idorn, M.; Israels, B.A.; Bednarz, A.M.; Bus, C.; Asbach, B.; et al. A Serum-Stable RNA Aptamer Specific for SARS-CoV-2 Neutralizes Viral Entry. Proc. Natl. Acad. Sci. USA 2021, 118, e2112942118. [CrossRef]
- Hillen, H.S.; Kokic, G.; Farnung, L.; Dienemann, C.; Tegunov, D.; Cramer, P. Structure of Replicating SARS-CoV-2 Polymerase. Nature 2020, 584, 154–156. [CrossRef]






| group | Selected sequence of 2’-F RNA pools | |
| CV-F1 (3) | 5′- CCTTACTATAATCTCTACGCTTATCTTATAGTACTGACCCAC -3′ | |
| CV-F2 (27) | 5′- CCAATACTGTCATATTTTGGAATTGTTATGGAACCGCTATTC -3′ | |
| CV-F3 (2) | 5′- CCTTTATGTGTTGTTACTCTCGATTGTTGAATATTTTTGCCTC -3′ | |
| CV-F4 (2) | 5′- CCCTTTATCATAGTCCCAGATTAAGTGATAACTGTAGTCCAC -3′ | |
| CV-F5-1 (1) CV-F5-2 (1) |
5′- CCGTTAAGTATTCACCTCAGCTATCATTAACCTGCTTTTAGT -3′ 5′--------T---------------C---------CTAC--------3′ |
|
| Group | Selected sequence of 2’-OH RNA pools | |
| CV-OH1 (16) | 5′-CCTTGAAGTCTTTGGGACTAGCTTCACGTACACGTCTCGA-3′ | |
| CV-OH2-1 (5) CV-OH2-2 (2) |
5′-CCTTGAAGTCTTCGGGACTAGCTTCATGTACACGTATCGA-3′ 5′--------------------------T---------T-----3′ |
|
| CV-OH3-1 (2) CV-OH3-2 (2) CV-OH3-3 (1) CV-OH3-4 (1) CV-OH3-5 (1) |
5′-CCTTGAAGTCTTTGGGACTAGCTTCACGTACACGTATCGA-3′ 5′-------------C------------CT--T----CC-----3′ 5′-------------C------------CT--------------3′ 5′-------------C----------------T----CC-----3′ 5′-------------C------------CT—-T-----C-----3′ |
|
| CV-OH4 (1) | 5′-CCTTGAAGTCTTCGGGACTAGCTTCTTGTACACGTCTCGA-3′ | |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).