Submitted:
18 August 2025
Posted:
19 August 2025
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Materials and Methods
2.1. Sample Collection
2.2. RNA Extraction and cDNA Synthesis
2.3. Amplification of the SVA Genome and Sequencing
2.4. Sequence Identity and Phylogenetic Analysis
2.5. Epitope Sequencec Analysis
2.6. Serological Surveillance
2.7. Anti-SVA Neutralizing Anitibody Assay
2.8. Statistical Analysis
3. Results
3.1. Phylogenetic Analysis of Full-Length Sequence in Taiwanese SVA Strains
3.1.1. Full-Length Sequence Analysis
3.1.2. Structural Protein Sequence Analysis
3.1.3. Epitope Sequence Analysis
3.2. Seroprevalence of SVA in Nursery and Finishing Stages
3.2.1. Herd and Animal Level Seroprevalence in Nursery Swine
3.1.2. Herd and Animal Level Seroprevalence in Finisher Swine
3.1.3. Comparison of Seroprevalence Between Nursery and Finisher Stages
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Houston, E.; Giménez-Lirola, L.G.; Magtoto, R.; Mora-Díaz, J.C.; Baum, D.; Piñeyro, P.E. Seroprevalence of Senecavirus A in Sows and Nursery-Finisher Pigs in Major Swine Producing-States in the United States. Prev. Vet. Med. 2019, 165, 1–7. [CrossRef]
- Hales, L.M.; Knowles, N.J.; Reddy, P.S.; Xu, L.; Hay, C.; Hallenbeck, P.L. Complete Genome Sequence Analysis of Seneca Valley Virus-001, a Novel Oncolytic Picornavirus. J. Gen. Virol. 2008, 89, 1265–1275. [CrossRef]
- Houston, E.; Temeeyasen, G.; Piñeyro, P.E. Comprehensive Review on Immunopathogenesis, Diagnostic and Epidemiology of Senecavirus A. Virus Res. 2020, 286, 198038. [CrossRef]
- Arzt, J.; Bertram, M.R.; Vu, L.T.; Pauszek, S.J.; Hartwig, E.J.; Smoliga, G.R.; Palinski, R.; Stenfeldt, C.; Fish, I.H.; Hoang, B.H.; et al. First Detection and Genome Sequence of Senecavirus A in Vietnam. Microbiol. Resour. Announc. 2019, 8, e01247-18. [CrossRef]
- Joshi, L.R.; Mohr, K.A.; Gava, D.; Kutish, G.; Buysse, A.S.; Vannucci, F.A.; Piñeyro, P.E.; Crossley, B.M.; Schiltz, J.J.; Jenkins-Moore, M.; et al. Genetic Diversity and Evolution of the Emerging Picornavirus Senecavirus A. J. Gen. Virol. 2020, 101, 175–187. [CrossRef]
- Leme, R.A.; Zotti, E.; Alcântara, B.K.; Oliveira, M. V.; Freitas, L.A.; Alfieri, A.F.; Alfieri, A.A. Senecavirus A: An Emerging Vesicular Infection in Brazilian Pig Herds. Transbound. Emerg. Dis. 2015, 62, 603–611. [CrossRef]
- Sun, D.; Vannucci, F.; Knutson, T.P.; Corzo, C.; Marthaler, D.G. Emergence and Whole-Genome Sequence of Senecavirus A in Colombia. Transbound. Emerg. Dis. 2017, 64, 1346–1349. [CrossRef]
- Hause, B.M.; Myers, O.; Duff, J.; Hesse, R.A. Senecavirus A in Pigs, United States, 2015. Emerg. Infect. Dis. 2016, 22, 1323–1325. [CrossRef]
- Joshi, L.R.; Fernandes, M.H.V.; Clement, T.; Lawson, S.; Pillatzki, A.; Resende, T.P.; Vannucci, F.A.; Kutish, G.F.; Nelson, E.A.; Diel, D.G. Pathogenesis of Senecavirus a Infection in Finishing Pigs. J. Gen. Virol. 2016, 97, 3267–3279. [CrossRef]
- Paton, D.J.; Gubbins, S.; King, D.P. Understanding the Transmission of Foot-and-Mouth Disease Virus at Different Scales. Curr. Opin. Virol. 2018, 28, 85–91. [CrossRef]
- Segalés, J.; Barcellos, D.; Alfieri, A.; Burrough, E.; Marthaler, D. Senecavirus A: An Emerging Pathogen Causing Vesicular Disease and Mortality in Pigs? Vet. Pathol. 2017, 54, 11–21. [CrossRef]
- Leme, R.A.; Alfieri, A.F.; Alfieri, A.A. Update on Senecavirus Infection in Pigs. Viruses 2017, 9, 170. [CrossRef]
- Fan, H.; Zhu, H.; Li, S.; Shi, M.; Zhou, E.; Wang, X.; Jiang, P.; Bai, J. Identification of Linear B Cell Epitopes on VP1 and VP2 Proteins of Senecavirus A (SVA) Using Monoclonal Antibodies. Vet. Microbiol. 2020, 247, 108753,. [CrossRef]
- Chen, M.; Chen, L.; Wang, J.; Mou, C.; Chen, Z. Identification of a B-Cell Epitope in the Vp3 Protein of Senecavirus a. Viruses 2021, 13, 2300. [CrossRef]
- Zhou, H.; Sun, M.; Su, S.; Meng, L.; Yang, W.; Yang, L.; Shi, X.; Li, X.; Wang, H.; Ma, H.; et al. Identification of a Linear B-Cell Epitope on the “Puff” Loop of the Senecavirus A VP2 Protein Involved in Receptor Binding. Front. Microbiol. 2024, 15, 1387309. [CrossRef]
- Preis, G.; Sanhueza, J.M.; Vilalta, C.; Vannucci, F.A.; Culhane, M.R., Corzo, C.A. Senecavirus A Seroprevalence and Risk Factors in United States Pig Farms. Front. Vet. Sci. 2022, 9, 1011975. [CrossRef]
- Goolia, M.; Vannucci, F.; Yang, M.; Patnayak, D.; Babiuk, S.; Nfon, C.K. Validation of a Competitive ELISA and a Virus Neutralization Test for the Detection and Confirmation of Antibodies to Senecavirus A in Swine Sera. J. Vet. Diagn. Invest. 2017, 29, 250–253. [CrossRef]
- Buckley, A.C.; Michael, D.D.; Faaberg, K.S.; Guo, B.; Yoon, K.J.; Lager, K.M. Comparison of Historical and Contemporary Isolates of Senecavirus A. Vet. Microbiol. 2021, 253, 108946. [CrossRef]
- Saeng-chuto, K.; Rodtian, P.; Temeeyasen, G.; Wegner, M.; Nilubol, D. The First Detection of Senecavirus A in Pigs in Thailand, 2016. Transbound. Emerg. Dis. 2018, 65, 285–288. [CrossRef]
- Gimenez-Lirola, L.G.; Rademacher, C.; Linhares, D.; Harmon, K.; Rotolo, M.; Sun, Y.; Baum, D.H.; Zimmerman, J.; Piñeyro, P. Serological and Molecular Detection of Senecavirus a Associated with an Outbreak of Swine Idiopathic Vesicular Disease and Neonatal Mortality. J. Clin. Microbiol. 2016, 54, 2082–2089. [CrossRef]
- Yang, F.; Zhu, Z.; Liu, H.; Cao, W.; Zhang, W.; Wei, T.; Zheng, M.; Zhang, K.; Tian, H.; Zeng, Q.; et al. Evaluation of Antibody Response in Sows after Vaccination with Senecavirus a Vaccine and the Effect of Maternal Antibody Transfer on Antibody Dynamics in Offspring. Vaccines (Basel) 2021, 9, 1066. [CrossRef]
- Houston, E.; Giménez-Lirola, L.G.; Magtoto, R.; Mora-Díaz, J.C.; Baum, D.; Piñeyro, P.E. Seroprevalence of Senecavirus A in Sows and Nursery-Finisher Pigs in Major Swine Producing-States in the United States. Prev. Vet. Med. 2019, 165, 1–7. [CrossRef]
- Preis, G.; Sanhueza, J.M.; Vilalta, C.; Vannucci, F.A.; Culhane, M.R.; Corzo, C.A. Senecavirus A Seroprevalence and Risk Factors in United States Pig Farms. Front. Vet. Sci. 2022, 9, 1011975. [CrossRef]
- Dee, S.; Brands, L.; Edler, R.; Schelkopf, A.; Nerem, J.; Spronk, G.; Kikuti, M.; Corzo, C.A. Further Evidence That Science-Based Biosecurity Provides Sustainable Prevention of Porcine Reproductive and Respiratory Syndrome Virus Infection and Improved Productivity in Swine Breeding Herds. Animals 2024, 14, 2530. [CrossRef]
- Maggioli, M.F.; Fernandes, M.H. V.; Joshi, L.R.; Sharma, B.; Tweet, M.M.; Noll, J.C.G.; Bauermann, F. V.; Diel, D.G. Persistent Infection and Transmission of Senecavirus A from Carrier Sows to Contact Piglets. J. Virol. 2019, 93, e00819-19. [CrossRef]


| Primer | Sequence (5′ -3′ ) | Location of MN233025(nt) |
| SVA-1F | ATGCCCAGTCCTTCCTTTCC | 18-782 |
| SVA-1R | CGAATCGTAAACACCATTGTTCACC | 18-782 |
| SVA-2F | TACTGCCTGATAGGGCGAC | 608-1408 |
| SVA-2R | CCGTTGAGGCCTCCCT | 608-1408 |
| SVA-3F | GCCATCGACAGGTGGTACA | 1290-2497 |
| SVA-3R | TAGTCACTGGGCGAGATGTAG | 1290-2497 |
| SVA-4F | ATGGCAAGAGGGAAATTCCT | 2343-3821 |
| SVA-4R | TGGAGGAGGCGGTTCTAC | 2343-3821 |
| SVA-5F | CGCTATCTAACCAAGCTTCAG | 3689-5198 |
| SVA-5R | GTTAGGCTGTTGCATTTCCAT | 3689-5198 |
| SVA-6F | AAGTACTTCTCTGGCTCTGATACA | 5049-6434 |
| SVA-6R | AGGATGGGATTGAAACTTGG | 5049-6434 |
| SVA-7F | CTACTCTGATCATGTCTTCCAAAC | 6272-7295 |
| SVA-7R | TTTTTTTTTTTTTTTTCCCTTTTCTGTCCC | 6272-7295 |
| Regions | Number of test-positive farms/Total number tested |
Herd level seroprevalence (95% CI) |
OR (95% CI) |
p-Value | Number of test-positive animals/Total number tested |
Animal level seroprevalence (95% CI) |
OR (95% CI) |
p-Value |
| Northern | 10/27 | 37.0%(19.4-57.6) | 1.0 | - | 97/405 | 24.0%(19.9-28.4) | 1.0 | - |
| Central | 58/123 | 47.2%(38.1-56.4) | 1.5(0.6-3.6) | 0.3969 | 573/1,824 | 31.4%(29.3-33.6) | 1.5(1.1-1.9) | 0.0033* |
| Southern | 88/134 | 65.7%(57.0 -73.7) | 3.3(1.4-7.7) | 0.0087 * | 931/2,009 | 46.3%(44.1-48.6) | 2.7(2.2-3.5) | <0.0001* |
| Eastern | 3/8 | 37.5%(8.5-75.5) | 1.0(0.2-5.2) | 1 | 33/120 | 27.5%(19.7-36.4) | 1.2(0.8-1.9) | 0.4702 |
| Offshore islands | 0/8 | 0.0(0.0-36.9) | - | 0.0734 | 0/150 | 0.0%(0.0-2.4) | - | <0.0001* |
| Total | 159/300 | 53.0%(47.2-58.8) | - | - | 1,634/4,508 | 36.2%(34.8-37.7) | - | - |
| Regions | Number of test-positive farms/Total number tested |
Herd level seroprevalence (95% CI) |
OR (95% CI) |
p-Value | Number of test-positive animals/Total number tested |
Animal level seroprevalence (95% CI) |
OR (95% CI) |
p-Value |
| Northern | 2/27 | 7.4%(0.9-24.3) | 1.45(0.3-7.4) | 0.6473 | 10/380 | 2.6%(1.3-4.8) | 3.5(0.5-27.7) | 0.304 |
| Central | 11/123 | 8.9%(4.6-15.4) | 1.78(0.7-4.8) | 0.3286 | 102/1667 | 6.1%(5.0-7.4) | 8.5 (1.2-61.2) | 0.0055* |
| Southern | 7/134 | 5.2%(2.1-10.5) | 1.0 | - | 78/1852 | 4.2%(3.3-5.2) | 5.7(0.8-41.4) | 0.0596 |
| Eastern | 0/8 | 0(0.0-36.9) | - | 1 | 1/115 | 0.9%(0.0-4.7) | 1.1 (0.1-18.4) | 1 |
| Offshore islands | 0/8 | 0(0.0-36.9) | - | 1 | 1/131 | 0.8%(0.0-4.2) | 1.0 | - |
| Total | 20/300 | 6.7%(4.1-10.1%) | - | - | 192/4145 | 4.6%(4.0-5.3%) | - | - |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).