Submitted:
13 August 2025
Posted:
14 August 2025
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Materials and Methods
2.1. Sample Collection
2.2. Genomic DNA Extraction
2.3. Primer and Probe Synthesis and SNP Verification
2.4. Development and Optimization of the RPA-LFD Assay
2.5. Establishment of Duplex TaqMan-MGB qPCR Assay and Standard Curves
2.6. Preparation of Plasmid DNA Standards
2.7. Specificity Testing
2.8. Limit of Detection (LOD) Determination
2.9. Validation with Samples of Known Origin
3. Results
3.1. Validation of Primers and SNP Genotyping
3.2. Development and Optimization of the RPA-LFD Assay
3.3. Specificity and Sensitivity Analysis of the RPA-LFD Assay
3.4. Establishment of the Duplex TaqMan-MGB qPCR Standard Curve
3.5. Sensitivity Analysis of the Duplex TaqMan-MGB qPCR Assay
3.6. Specificity Analysis of the Duplex TaqMan-MGB qPCR Assay
3.7. Validation Using Samples of Known Origin
4. Discussion
Funding information
Author Contributions
Conflicts of Interest
References
- Froese R, Pauly D. FishBase. World Wide Web electronic publication. [EB/OL] 2015., http://www.fishbase.org.
- Kan, Y., Zhong Y., Jawad M., et al. Establishment of a Coilia nasus Gonadal Somatic Cell Line Capable of Sperm Induction In Vitro [J]. Biology, 2022, 11(7).
- Gao, J., Xu G., Xu P. Whole-genome resequencing of three Coilia nasus population reveals genetic variations in genes related to immune, vision, migration, and osmoregulation [J]. BMC Genomics, 2021, 22(1).
- Yuan, C.M., Qin A.L. Ecological Habits And Distribution Of Coilia Along The Chinese Coast And Its Changes Of Output [J]. Marine Sciences, 1984, 05: 35-7.
- Tang, W., Ye S., Qin S., et al. Habitat for Coilia nasus in southern Zhejiang Province, China, based on a maximum entropy model [J]. Sci Rep, 2024, 14(1): 19254.
- Xu, G., Bian C., Nie Z., et al. Genome and population sequencing of a chromosome-level genome assembly of the Chinese tapertail anchovy (Coilia nasus) provides novel insights into migratory adaptation [J]. GigaScience, 2020, 9(1).
- Gao, J., Nie Z., Xu G., et al. Genome-wide identification of the NHE gene family in Coilia nasus and its response to salinity challenge and ammonia stress [J]. BMC Genomics, 2022, 23(1).
- Cheng, F., Wang Q., Maisano Delser P., et al. Multiple freshwater invasions of the tapertail anchovy (Clupeiformes: Engraulidae) of the Yangtze River [J]. Ecology and Evolution, 2019, 9(21): 12202-15.
- Zhang, S., Xu Z., Luo L., et al. Genetic Diversity and Population Structure of Coilia nasus Revealed by 2b-RAD Sequencing [J]. Biology, 2023, 12(4).
- Liu, Y.B., Li R.D., LI C.H. Scenarios Simulation Of Coupling System Between Urbanization And Eco-Environment In Jiangsu Province Based On System Dynamics Model [J]. Chinese Geographical Science, 2005, (03): 29-36.
- Foo, C.L., Dinesh K.R., Lim T.M., et al. Inheritance of RAPD markers in the guppy fish, Poecilia reticulata [J]. Zoological science, 1995, 12(5): 535-41.
- Chen, W., He S. Isolation and characterization of microsatellite markers in a highland fish, Pareuchiloglanis sinensis (Siluriformes: Sisoridae) by next-generation sequencing [J]. Journal of genetics, 2018, 97(5): e111-e6.
- Cao, W., Li Y., Chen X., et al. Species identification and quantification of silver pomfret using the droplet digital PCR assay [J]. Food Chem, 2020, 302: 125331.
- Yu, Z., Ito S.I., Wong M.K., et al. Comparison of species-specific qPCR and metabarcoding methods to detect small pelagic fish distribution from open ocean environmental DNA [J]. PLoS One, 2022, 17(9): e0273670.
- Shen, Y., Guan L., Wang D., et al. DNA barcoding and evaluation of genetic diversity in Cyprinidae fish in the midstream of the Yangtze River [J]. Ecol Evol, 2016, 6(9): 2702-13.
- Piepenburg, O., Haber J., Williams C.H., et al. DNA Detection Using Recombination Proteins [J]. PLoS Biology, 2006, 4(7).
- Lv, J.Z., Deng J.H., Lin Y., et al. Development of Real-Time and Lateral Flow Dipstick Recombinase Polymerase Amplification Assays for the Rapid Field Diagnosis of MGF-505R Gene-Deleted Mutants of African Swine Fever Virus [J]. Veterinary Sciences, 2025, 12(3).
- Cai, L.L., Tian Q., Meng Q.Q., et al. Recombinase Polymerase Amplification Assay for Rapid Field Diagnosis of Stewart’s Wilt of Corn Pathogen Pantoea stewartii subsp. stewartii [J]. Agriculture, 2023, 13(10).
- Tamer, C., Benkaroun J., Kurucay H.N., et al. Development of a recombinase polymerase amplification assay for viral haemorrhagic septicemia virus [J]. Journal of fish diseases, 2022, 45(8): 1065-71.
- Chan, K., Wong P.Y., Parikh C., et al. Moving toward rapid and low-cost point-of-care molecular diagnostics with a repurposed 3D printer and RPA [J]. Analytical biochemistry, 2018, 545: 4-12.
- Daher, R.K., Stewart G., Boissinot M., et al. Recombinase Polymerase Amplification for Diagnostic Applications [J]. Clinical chemistry, 2016, 62(7): 947-58.
- Liu, Y., Huang H., Zheng Y., et al. Development of a POCT detection platform based on a locked nucleic acid-enhanced ARMS-RPA-GoldMag lateral flow assay [J]. Journal of pharmaceutical and biomedical analysis, 2023, 235: 115632.
- Han, Z.-Q., Han G., Wang Z.-Y., et al. The Possible Physical Barrier and Coastal Dispersal Strategy for Japanese Grenadier Anchovy, Coilia nasus in the East China Sea and Yellow Sea: Evidence from AFLP Markers [J]. International Journal of Molecular Sciences, 2015, 16(2): 3283-97.
- Liu, D., Guo H.-Y., Tang W.-Q., et al. Comparative Evolution of S7 Intron 1 and Ribosomal Internal Transcribed Spacer in Coilia nasus (Clupeiformes: Engraulidae) [J]. International Journal of Molecular Sciences, 2012, 13(3): 3085-100.
- Liu, Z.J., Cordes J.F. DNA marker technologies and their applications in aquaculture genetics [J]. Aquaculture, 2004, 238(1-4): 1-37.
- Zhang H., W.G., Xie P., Xu J., Zhou Q. Role of body size and temporal hydrology in the dietary shifts of short jaw tapertail anchovy Coilia nasus brachygnathus (Actinopterygii, Engraulidae) in a large floodplain lake. [J]. Hydrobiologia, 2013, 703: 247–56.
- Xie, J.Y. Genetic and morphological variation of three freshwater lake populations of Coilia ectenes (Engraulidae) [J]. Genetika, 2012, 48(10): 1200-6.
- Yang J.-Q., Hsu K.-C., Zhou X.-D., et al. New insights on geographical/ecological populations within.
- Coilia nasus (Clupeiformes: Engraulidae) based on mitochondrial DNA and microsatellites [J]. Mitochondrial DNA Part A, 2016, 29(1): 158-64.
- Yu, H.X., Tang W.Q., Li S.F. Morphological changes of silver and bighead carp in the Yangtze River over the past 50 years [J]. Dongwuxue Yanjiu, 2010, 31(6): 651-6.
- Cheng, F., Tao Z., Li C. Species identification of Coilia brachygnathus, C. nasus and C. nasus taihuensis with SNP markers [J]. Journal of Shanghai Ocean University, 2019, 28(01): 10-9.
- Wang, N., Xing R.-R., Zhou M.-Y., et al. Application of DNA barcoding and metabarcoding for species identification in salmon products [J]. Food Additives & Contaminants: Part A, 2021, 38(5): 754-68.
- Rasmussen, R.S., Morrissey M.T., Hebert P.D.N. DNA Barcoding of Commercially Important Salmon and Trout Species (Oncorhynchus and Salmo) from North America [J]. Journal of Agricultural and Food Chemistry, 2009, 57(18): 8379-85.
- Partis, L., Wells R.J. Identification of fish species using random amplified polymorphic DNA (RAPD) [J]. Molecular and cellular probes, 1996, 10(6): 435-41.
- Wang, Y., Wang Q., Bergmann S.M., et al. Development and comparative evaluation of real-time PCR and real-time RPA assays for detection of tilapia lake virus [J]. Mol Cell Probes, 2021, 60: 101776.
- Soliman, H., Saleh M., El-Matbouli M. Detection of fish pathogens by loop-mediated isothermal amplification (LAMP) technique [J]. Methods in molecular biology (Clifton, NJ), 2015, 1247: 163-73.
- Kim, K., Maji U.J., Shim K.Y., et al. Detection of the jellyfish Chrysaora pacifica by RPA-CRISPR-Cas12a environmental DNA (eDNA) assay and its evaluation through field validation and comparative eDNA analyses [J]. The Science of the total environment, 2024, 955: 176945.
- Zhou, S., Zheng X., Yang Z., et al. Development of Two Recombinase Polymerase Amplification EXO (RPA-EXO) and Lateral Flow Dipstick (RPA-LFD) Techniques for the Rapid Visual Detection of Aeromonas salmonicida [J]. Marine biotechnology (New York, NY), 2022, 24(6): 1094-109.
- Liu, X., Cao Y., Wang J., et al. Rapid and sensitive detection of large yellow croaker iridovirus by real-time RPA and RPA-LFD [J]. Journal of fish diseases, 2024, 47(6): e13930.
- Qiao, M., Zhang L., Chang J., et al. Rapid and sensitive detection of pathogenic Elizabethkingia miricola in black spotted frog by RPA-LFD and fluorescent probe-based RPA [J]. Fish and shellfish immunology reports, 2022, 3: 100059.
- Davi, S.D., Kissenkötter J., Faye M., et al. Recombinase polymerase amplification assay for rapid detection of Monkeypox virus [J]. Diagnostic Microbiology and Infectious Disease, 2019, 95(1): 41-5.
- Babu, B., Ochoa-Corona F.M., Paret M.L. Recombinase polymerase amplification applied to plant virus detection and potential implications [J]. Analytical biochemistry, 2018, 546: 72-7.
- Sun, Y., Yu L., Liu C., et al. One-tube SARS-CoV-2 detection platform based on RT-RPA and CRISPR/Cas12a [J]. Journal of translational medicine, 2021, 19(1): 74.
- Wei, X.Y., Liu L., Hu H., et al. Ultra-sensitive detection of ecologically rare fish from eDNA samples based on the RPA-CRISPR/Cas12a technology [J]. iScience, 2023, 26(9): 107519.
- Endo, T., Fujii H., Yoshioka T., et al. TaqMan-MGB SNP genotyping assay to identify 48 citrus cultivars distributed in the Japanese market [J]. Breeding science, 2020, 70(3): 363-72.
- Schleinitz, D., Distefano J.K., Kovacs P. Targeted SNP genotyping using the TaqMan® assay [J]. Methods in molecular biology (Clifton, NJ), 2011, 700: 77-87.









| Species | sample sizes | Habitat vegetation type |
| Coilia nasus | 29 | Migratory (freshwater - brackish water) upstream during the breeding season, endangered species |
| Coilia brachygnathus | 6 | Small freshwater/brackish water (some migratory) fish, commonly found in estuaries |
| Tachysurus fulvidraco | 14 | Fresh water at the bottom, still water/slow flow |
| Pelteobagrus eupogon | 6 | Freshwater bottom layer, rivers/lakes |
| Pelteobagrus vachellii | 6 | Freshwater bottom, slow-flowing/reservoir |
| Pelteobaggrus nitidus | 6 | Freshwater bottom, stream/estuary |
| Hypophthalmichthys molitrix | 20 | The upper and middle layers of freshwater, open water areas |
| Hypophthalmichthys Nobilis | 14 | Upper and middle layers of freshwater, lakes/reservoirs |
| Mylopharyngodon piceus | 6 | Freshwater bottom, deep water area/river |
| Ctenopharyngodon Idella | 12 | The middle and lower layers of freshwater, an area rich in aquatic plants |
| Siniperca chuatsi | 14 | Freshwater bottom layer, crevices in rocks/water grass; Ambush carnivorous, high economic value |
| Siniperca knerii | 6 | Freshwater bottom layer, clear stream; Large eyes can adapt to weak light and are widely distributed |
| Culter alburnus | 14 | Upper and middle layers of freshwater, open water area; Fierce and predatory, good at jumping |
| Chanodichthys dabryi | 6 | Upper and middle layers of freshwater, slow-flowing/lake; Small fish, moving in groups |
| Chanodichthys mongolicus | 6 | The upper and middle layers of freshwater, rivers/lakes |
| Culter erythropterus | 6 | The upper and middle layers of freshwater, the edges of aquatic plants |
| Name | Sequence 5′–3′ | Product size (bp) |
| C. nasus-Fe | CTCGCCACTTTACACGGCGGCGTCATTAAATG | 103 |
| C. nasus-Rn | 5’Biotin-AGAACGATGTCAAGTGATGAGTTGGCTAGAACA | |
| C. nasus-Pn | 5’FAM-ACCCATACTGTGAGCATTAGGATTCATTTTCC [THF]ATTTACAGTAGGAGG-3’C3 Spacer | |
| Cb-Cn-F | CGCTACGCTGCTGACTGCAC |
202 |
| Cb-Cn-R | CAGCGTGGTCTGCTGGTTCAT | |
| Cb-p-FAM | 5’FAM-AGCACAGGCAGCA-3’MGB | |
| Cn-p-VIC | 5’VIC-AGCACGGGCAGCA-3’MGB |
| Number of samples | Known sample name | Detection method | Identify | ||
| RPA-LFD | Duplex Taqman-MGB qPCR | ||||
|
Coilia (+) non-Coilia (-) |
FAM-T | VIC-C | |||
| 1 | C. brachygnathus | + | 29.98 | 32.12 | C. brachygnathus |
| 2 | C. brachygnathus | + | 22.08 | 23.72 | C. brachygnathus |
| 3 | C. brachygnathus | + | 22.03 | 23.87 | C. brachygnathus |
| 4 | C. brachygnathus | + | 21.28 | 22.90 | C. brachygnathus |
| 5 | C. brachygnathus | + | 23.50 | NA | C. brachygnathus |
| 6 | C. brachygnathus | + | 23.37 | 24.45 | C. brachygnathus |
| 7 | C. nasus | + | NA | 29.15 | C. nasus |
| 8 | C. nasus | + | NA | 23.37 | C. nasus |
| 9 | C. nasus | + | NA | 24.81 | C. nasus |
| 10 | C. nasus | + | NA | 27.41 | C. nasus |
| 11 | C. nasus | + | NA | 24.48 | C. nasus |
| 12 | C. nasus | + | NA | 32.46 | C. nasus |
| 13 | C. nasus | + | NA | 24.19 | C. nasus |
| 14 | C. nasus | + | NA | 24.57 | C. nasus |
| 15 | C. nasus | + | NA | 24.86 | C. nasus |
| 16 | C. nasus | + | NA | 23.83 | C. nasus |
| 17 | C. nasus | + | NA | 25.27 | C. nasus |
| 18 | C. nasus | + | NA | 25.43 | C. nasus |
| 19 | C. nasus | + | NA | 22.08 | C. nasus |
| 20 | C. nasus | + | NA | 22.20 | C. nasus |
| 21 | C. nasus | + | NA | 24.46 | C. nasus |
| 22 | C. nasus | + | NA | 23.19 | C. nasus |
| 23 | C. nasus | + | NA | 25.10 | C. nasus |
| 24 | C. nasus | + | NA | 24.53 | C. nasus |
| 25 | C. nasus | + | NA | 23.56 | C. nasus |
| 26 | C. nasus | + | NA | 22.94 | C. nasus |
| 27 | C. nasus | + | NA | 22.11 | C. nasus |
| 28 | C. nasus | + | NA | 21.12 | C. nasus |
| 29 | C. nasus | + | NA | 22.99 | C. nasus |
| 30 | C. nasus | + | NA | 23.91 | C. nasus |
| 31 | C. nasus | + | NA | 24.06 | C. nasus |
| 32 | C. nasus | + | NA | 22.79 | C. nasus |
| 33 | C. nasus | + | NA | 23.63 | C. nasus |
| 34 | C. nasus | + | NA | 22.53 | C. nasus |
| 35 | C. nasus | + | NA | 23.74 | C. nasus |
| 36 | Tachysurus fulvidraco | - | / | / | non-Coilia |
| 37 | Pelteobagrus eupogon | - | / | / | non-Coilia |
| 38 | Pelteobagrus vachellii | - | / | / | non-Coilia |
| 39 | Pelteobaggrus nitidus | - | / | / | non-Coilia |
| 40 | Hypophthalmichthys molitrix | - | / | / | non-Coilia |
| 41 | Hypophthalmichthys Nobilis | - | / | / | non-Coilia |
| 42 | Mylopharyngodon piceus | - | / | / | non-Coilia |
| 43 | Ctenopharyngodon idella | - | / | / | non-Coilia |
| 44 | Siniperca chuatsi | - | / | / | non-Coilia |
| 45 | Siniperca knerii | - | / | / | non-Coilia |
| 46 | Culter alburnus | - | / | / | non-Coilia |
| 47 | Chanodichthys dabryi | - | / | / | non-Coilia |
| 48 | Chanodichthys mongolicus | - | / | / | non-Coilia |
| 49 | Culter erythropterus | - | / | / | non-Coilia |
| 50 | H2O | - | - | - | NA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).