Submitted:
16 July 2025
Posted:
17 July 2025
You are already at the latest version
Abstract

Keywords:
1. Introduction
2. Materials and Methods
3. Results
3.1. T. cruzi Dm28c Trypomastigotes Establish a Mild, Non Lethal Infection in BALB/c Mice Allowing to Follow the Progression of a Low Virulence Chagas Disease Model
3.1.1. Parasitemia in Dm28c Infected Mice Showed a Peak at 14 Days Post-Infection and Become Undetectable by Day 56
3.1.2. Amastigote Nests and Myocarditis Signs Were Visible During the Acute Infection
3.1.3. Splenomegaly Induced by Dm28c Infection Paired the Parasitemia Profile
3.2. Splenic Pro- and Anti-Inflammatory Cytokine Gene Expression Patterns May Influence Infection Progression
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| dpi | days post-infection |
| DTU | Discrete Typing Unit |
| FCS | Fetal calf serum |
| IFN-γ | Interferon gamma |
| IL-10 | Interleukin-10/ human cytokine synthesis inhibitory factor |
| IL-1β | Interleukin-1 beta |
| mRNA | Message RNA |
| PBS | Phosphate-buffered saline |
| TGF-β | Transforming growth factor β |
| TNF-α | Tumoral necrosis factor alfa |
References
- Nunes, M.C.P.; Dones, W.; Morillo, C.A.; Encina, J.J.; Ribeiro, A.L. Chagas Disease. Journal of the American College of Cardiology 2013, 62, 767–776. [Google Scholar] [CrossRef] [PubMed]
- Word Health Organization (WHO) Chagas Disease (Also Known as American Trypanosomiasis).
- Zingales, B. Trypanosoma Cruzi Genetic Diversity: Something New for Something Known about Chagas Disease Manifestations, Serodiagnosis and Drug Sensitivity. Acta Tropica 2018, 184, 38–52. [Google Scholar] [CrossRef] [PubMed]
- Zingales, B.; Bartholomeu, D.C. Trypanosoma Cruzi Genetic Diversity: Impact on Transmission Cycles and Chagas Disease. Memorias do Instituto Oswaldo Cruz 2022, 117. [Google Scholar] [CrossRef] [PubMed]
- Zingales, B.; Macedo, A.M. Zingales, B.; Macedo, A.M. Fifteen Years after the Definition of Trypanosoma Cruzi DTUs: What Have We Learned? 2023. [CrossRef]
- Velásquez-Ortiz, N.; Herrera, G.; Hernández, C.; Muñoz, M.; Ramírez, J.D. Discrete Typing Units of Trypanosoma Cruzi: Geographical and Biological Distribution in the Americas. Scientific Data 2022, 9. [Google Scholar] [CrossRef] [PubMed]
- Revollo, S.; Oury, B.; Vela, A.; Tibayrenc, M.; Sereno, D. In Vitro Benznidazole and Nifurtimox Susceptibility Profile of Trypanosoma Cruzi Strains Belonging to Discrete Typing Units TcI, TcII, and TcV. Pathogens 2019, 8, 197. [Google Scholar] [CrossRef] [PubMed]
- Talvani, A.; Teixeira, M.M. Experimental Trypanosoma Cruzi Infection and Chagas Disease—A Word of Caution. Microorganisms 2023, 11, 1613. [Google Scholar] [CrossRef] [PubMed]
- BRENER, Z. Therapeutic Activity and Criterion of Cure on Mice Experimentally Infected with Trypanosoma Cruzi. Revista do Instituto de Medicina Tropical de São Paulo 1962, 4, 389–396. [Google Scholar] [PubMed]
- Pérez, A.R.; Lambertucci, F.; González, F.B.; Roggero, E.A.; Bottasso, O.A.; Meis, J. de; Ronco, M.T.; Villar, S.R. Death of Adrenocortical Cells during Murine Acute T. Cruzi Infection Is Not Associated with TNF-R1 Signaling but Mostly with the Type II Pathway of Fas-Mediated Apoptosis. Brain, behavior, and immunity 2017, 65, 284–295. [Google Scholar] [CrossRef] [PubMed]
- Silvestrini, M.M.A.; Alessio, G.D.; Frias, B.E.D.; Sales Júnior, P.A.; Araújo, M.S.S.; Silvestrini, C.M.A.; Brito Alvim De Melo, G.E.; Martins-Filho, O.A.; Teixeira-Carvalho, A.; Martins, H.R. New Insights into Trypanosoma Cruzi Genetic Diversity, and Its Influence on Parasite Biology and Clinical Outcomes. Front. Immunol. 2024, 15, 1342431. [Google Scholar] [CrossRef] [PubMed]
- Roggero, E.; Perez, A.; Tamae-Kakazu, M.; Piazzon, I.; Nepomnaschy, I.; Wietzerbin, J.; Serra, E.; Revelli, S.; Bottasso, O. Differential Susceptibility to Acute Trypanosoma Cruzi Infection in BALB/c and C57BL/6 Mice Is Not Associated with a Distinct Parasite Load but Cytokine Abnormalities. Clinical and Experimental Immunology 2002, 128, 421–428. [Google Scholar] [CrossRef] [PubMed]
- Marinho, C.R.F.; Nuñez-Apaza, L.N.; Bortoluci, K.R.; Bombeiro, A.L.; Bucci, D.Z.; Grisotto, M.G.; Sardinha, L.R.; Jorquera, C.E.; Lira, S.; D’Império Lima, M.R.; et al. Infection by the Sylvio X10/4 Clone of Trypanosoma Cruzi: Relevance of a Low-Virulence Model of Chagas’ Disease. Microbes and Infection 2009, 11, 1037–1045. [Google Scholar] [CrossRef] [PubMed]
- Cruz, L.; Vivas, A.; Montilla, M.; Hernández, C.; Flórez, C.; Parra, E.; Ramírez, J.D. Comparative Study of the Biological Properties of Trypanosoma Cruzi I Genotypes in a Murine Experimental Model. Infection, Genetics and Evolution 2015, 29. [Google Scholar] [CrossRef] [PubMed]
- Marinho, C.R.F.; Bucci, D.Z.; Dagli, M.L.Z.; Bastos, K.R.B.; Grisotto, M.G.; Sardinha, L.R.; Baptista, C.R.G.M.; Penha Gonçalves, C.; Lima, M.R.D.; Álvarez, J.M. Pathology Affects Different Organs in Two Mouse Strains Chronically Infected by a Trypanosoma Cruzi Clone: A Model for Genetic Studies of Chagas’ Disease. Infect Immun 2004, 72, 2350–2357. [Google Scholar] [CrossRef] [PubMed]
- Calvet, C.M.; Meuser, M.; Almeida, D.; Meirelles, M.N.L.; Pereira, M.C.S. Trypanosoma Cruzi–Cardiomyocyte Interaction: Role of Fibronectin in the Recognition Process and Extracellular Matrix Expression in Vitro and in Vivo. Experimental Parasitology 2004, 107, 20–30. [Google Scholar] [CrossRef] [PubMed]
- Henriques, C.; Henriques-Pons, A.; Meuser-Batista, M.; Ribeiro, A.S.; De Souza, W. In Vivo Imaging of Mice Infected with Bioluminescent Trypanosoma Cruzi Unveils Novel Sites of Infection. Parasites Vectors 2014, 7, 89. [Google Scholar] [CrossRef] [PubMed]




| Target | Forward (5’-3’) | Reverse (5’-3’) | Annealing temperature |
|---|---|---|---|
| TNF-α | TGTGGCTTCGACCTCTACCTC | GCCGAGAAAGGCTGCTTG | 60°C |
| IFN-γ | GGTGACATGAAAATCCTGCAG | CCTCAAACTTGGCAATACTCATGA | 60°C |
| IL-1β | TTGACGGACCCCAAAAGATG | AGAAGGTGCTCATGTCCTCA | 55°C |
| TGF-β | GCTGATCCCGTTGATTTCCA | GTGGCTGAACCAAGGAGACG | 60°C |
| IL-10 | GGTTGCCAAGCCTTATCGGA | ACCTGCTCCACTGCCTTGCT | 62°C |
| RPLP0 | CTCTCGCTTTCTGGAGGGTG | ACGCGCTTGTACCCATTGAT | 60°C |
| Group | Inflammation Score | Amastigote nests |
|---|---|---|
| Uninfected control | Absence | Absence |
| 7 dpi | Mild | Absence |
| 10 dpi | Moderate | Presence |
| 14 dpi | Severe | Presence |
| 21 dpi | Severe | Presence |
| 56 dpi | Mild | Absence |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).