Submitted:
09 May 2025
Posted:
13 May 2025
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Materials and Methods
2.1. Study Sample
2.2. Design
2.2.1. Each Patient Enrolled Underwent:
2.2.2. Ophthalmologic Examination:
2.3. Statistical Analysis
3. Results
3.1. Patients
3.2. Audiological Assessment
3.3. Localization Test
3.4. Vestibular Examination
3.5. Ophthalmologic Examination
3.6. Vanderbilt Fatigue Scale
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Lieu, J. E. C., Kenna, M., Anne, S., & Davidson, L. (2020). Hearing Loss in Children: A Review. JAMA, 324(21), 2195–2205. [CrossRef]
- Watkin P, Baldwin M. The longitudinal follow up of a universal neonatal hearing screen: the implications for confirming deafness in childhood. Int J Audiol. 2012;51:519–28. [CrossRef]
- Wroblewska-Seniuk, K. E., Dabrowski, P., Szyfter, W., & Mazela, J. (2017). Universal newborn hearing screening: methods and results, obstacles, and benefits. Pediatric research, 81(3), 415–422. [CrossRef]
- Li MM, Tayoun AA, DiStefano M, Pandya A, Rehm HL, Robin NH, Schaefer AM, Yoshinaga-Itano C; ACMG Professional Practice and Guidelines Committee. Electronic address: documents@acmg.net. Clinical evaluation and etiologic diagnosis of hearing loss: A clinical practice resource of the American College of Medical Genetics and Genomics (ACMG). Genet Med. 2022 Jul;24(7):1392-1406. [CrossRef]
- Reiners J, Nagel-Wolfrum K, Jürgens K, Märker T, Wolfrum U. Molecular basis of human Usher syndrome: deciphering the meshes of the Usher protein network provides insights into the pathomechanisms of the Usher disease. Exp Eye Res. 2006 Jul;83(1):97-119. [CrossRef]
- Delmaghani S, El-Amraoui A. The genetic and phenotypic landscapes of Usher syndrome: from disease mechanisms to a new classification. Hum Genet. 2022 Apr;141(3-4):709-735. [CrossRef]
- Castiglione A, Möller C. Usher Syndrome. Audiol Res. 2022 Jan 11;12(1):42-65. [CrossRef]
- Wahlqvist M, Möller C, Möller K, Danermark B. Similarities and Differences in Health, Social Trust, and Financial Situation in People With Usher Syndrome, a Bio-Psychosocial Perspective. Front Psychol. 2020 Aug 28;11:1760. [CrossRef]
- Hornsby BWY, Camarata S, Cho SJ, Davis H, McGarrigle R, Bess FH. Development and Evaluation of Pediatric Versions of the Vanderbilt Fatigue Scale for Children With Hearing Loss. J Speech Lang Hear Res. 2022 Jun 8;65(6):2343-2363. [CrossRef]
- Puglisi, G. E., Warzybok, A., Hochmuth, S., Visentin, C., Astolfi, A., Prodi, N., & Kollmeier, B. (2015). An Italian matrix sentence test for the evaluation of speech intelligibility in noise. International journal of audiology, 54 Suppl 2, 44–50. [CrossRef]
- Gulli, A., Fontana F., Aruffo A., Orzan E., and Muzzi E. ‘Previous Binaural Experience Supports Compensatory Strategies in Hearing- Impaired Children’s Auditory Horizontal Localization’. PloS One 19, no. 12 (2024): e0312073. [CrossRef]
- Halmagyi GM, Chen L, MacDougall HG, Weber KP, McGarvie LA, Curthoys IS. The Video Head Impulse Test. Front Neurol. 2017 Jun 9;8:258. [CrossRef]
- Oderinlo O, Bogunjoko T, Hassan AO, Idris O, Dalley A, Oshunkoya L, Odubela T. Normal central foveal thickness in a thousand eyes of healthy patients in sub Saharan Africa using fourier domain optical coherence tomography. Niger J Clin Pract. 2023 Mar;26(3):331-335. [CrossRef]
- Pole C, Ameri H. Fundus Autofluorescence and Clinical Applications. J Ophthalmic Vis Res. 2021 Jul 29;16(3):432-461. [CrossRef]
- Amorim AM, Ramada AB, Lopes AC, Duarte Silva E, Lemos J, Ribeiro JC. Vestibulo-ocular reflex dynamics with head-impulses discriminates Usher patients type 1 and 2. Sci Rep. 2024 Feb 14;14(1):3701. [CrossRef]
- Yao L, Zhang L, Qi LS, Liu W, An J, Wang B, Xue JH, Zhang ZM. The Time Course of Deafness and Retinal Degeneration in a Kunming Mouse Model for Usher Syndrome. PLoS One. 2016 May 17;11(5):e0155619. [CrossRef]
- Guidetti G, Guidetti R, Manfredi M, Manfredi M. Vestibular pathology and spatial working memory. Acta Otorhinolaryngol Ital. 2020 Feb;40(1):72-78. [CrossRef]
- Stingl K, Kurtenbach A, Hahn G, Kernstock C, Hipp S, Zobor D, Kohl S, Bonnet C, Mohand-Saïd S, Audo I, Fakin A, Hawlina M, Testa F, Simonelli F, Petit C, Sahel JA, Zrenner E. Full-field electroretinography, visual acuity and visual fields in Usher syndrome: a multicentre European study. Doc Ophthalmol. 2019 Oct;139(2):151-160. [CrossRef]

| Patient | Age | Sex | Diagnosis | Gene | Mutation |
|---|---|---|---|---|---|
| N1 | 12 | M | USH2C | ADGRV1 (NM_032119.4) | c.13655dupT |
| N2 | 6 | M | USH1 | CDH23 (NM_022124.6) | c.9433C>T |
| N3 | 14 | M | USH2A | USH2A (NM_206933.4) | c.11864G>A |
| N4 | 12 | M | USH2A | USH2A (NM_206933.4) | c.11864G>A |
| N5 | 7 | F | USH2A | USH2A (NM_206933.2) | c.2276G>T |
| N6 | 6 | F | USH2A | USH2A (NM_206933.4) | del of exons 5-->10 |
| N7 | 16 | F | USH1B | MYO7A (NM_000260.4) | c.3719G>A |
| N8 | 8 | F | USH2C | ADGRV1 (NM_032119.4) | c.10084C>T |
| N9 | 3 | F | USH1D | CDH23 (NM_022124.6) | c.3646_3647delCT |
| N10 | 17 | M | USH2A | USH2A (NM_206933.4) | c.11864G>A |
| N11 | 15 | M | USH2A | USH2A (NM_206933.4) | c.11864G>A |
| N12 | 4 | F | USH2A | USH2A (NM_206933.4) | c.232T>G |
| N13 | 3 | F | USH2A | USH2A (NM_206933.4) | c.5199delATATGTTTCAT |
| N14 | 9 | M | USH2A | USH2A (NM_206933.4) | c.5199delATATGTTTCAT |
| N15 | 11 | F | USH2A | USH2A (NM_206933.4) | c.9270C>A |
| N16 | 9 | M | USH2A | USH2A (NM_206933.4) | c.2099_2120delGGACAGTGGATGGAGATATTAC |
| N17 | 3 | F | USH1C | USH1C (NM_005709.4) | c.711delT |
| N18 | 17 | M | USH1D | CDH23 (NM_022124.6) | c.5985C>A |
| N19 | 12 | F | USH2C | ADGRV1 (NM_032119.3) | c.13655dupT |
| N20 | 8 | M | USH2A | USH2A (NM_206933.4) | c.1055C>T |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).