Submitted:
11 February 2025
Posted:
11 February 2025
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Results
2.1. Identification and characteristics of HbGASA genes
2.2. Protein and gene structure of HbGASA genes
2.3. Promoter region analysis of HbGASA genes
2.4. Tissue-specific expression patterns of HbGASA genes
2.5. Expression profiles of HbGASAs under cold stress
3. Discussion
4. Materials and Methods
4.1. Plant materials and stress treatment
4.2. Identification and chromosomal distribution of HbGASA genes
4.3. Physicochemical properties of HbGASA proteins
4.4. Analysis of conserved motifs and gene structures
4.5. Analysis of promoters and phylogeny of HbGASA genes
4.6. Tissue-specific expression profiles of HbGASA genes
4.7. RNA isolation and qRT-PCR reaction
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Abbreviations
| ABA | Abscisic acid |
| MeJA | Methyl jasmonate |
| GA | Gibberellic acid |
| SA | Salicylic acid |
| GASA | Gibberellic Acid-Stimulated in Arabidopsis |
| qRT-PCR | quantitative real time PCR |
References
- Bouteraa, M.T.; Ben Romdhane, W.; Baazaoui, N.; Alfaifi, M.Y.; Chouaibi, Y.; Ben Akacha, B.; Ben Hsouna, A.; Kacániová, M.; Cavar Zeljkovic, S.; Garzoli, S.; Ben Saad R. GASA proteins: review of their unctions in plant environmental stress tolerance. Plants 2023, 12, 2045. [CrossRef]
- De la Fuente, J. I.; Amaya, I.; Castillejo, C.; Sánchez-Sevilla, J. F.; Quesada, M. A.; Botella, M. A.; Valpuestaet V. The strawberry gene FaGAST affects plant growth through inhibition of cell elongation. J. Exp. Bot. 2006, 10, 2401-2411. [CrossRef]
- Roxrud, I.; Lid, S. E.; Fletcher, J. C.; Schmidt, Ed D.L.; Opsahl-Sorteberg, H.-G. GASA4, one of the 14-member Arabidopsis GASA family of small polypeptides, regulates flowering and seed development. Plant Cell Physiol. 2007, 48(3), 471-483.
- Fan, S.; Zhang, D.; Zhang, L.; Gao, C.; Xin, M.; Tahir, M.M.; Li, Y.; Ma, J.; Han, M. Comprehensive analysis of GASA family members in the Malus domestica genome: identification, characterization, and their expressions in response to apple flower induction. BMC Genom. 2017, 18, 827. [CrossRef]
- Ben-Nissan, G.; Lee, J. Y.; Borohov, A.; Weiss, D. GIP, a Petunia hybrida GA-induced cysteine-rich protein: a possible role in shoot elongation and flowering transition. Plant J. 2004, 37(2), 229-238. [CrossRef]
- Li, W.; Zhen, W.; Xu, Y.; Joo, S.-H.; Kim, S.-K.; Xue Z.; Xu, Z.; Wang Z.; Chong K. OsGSR1 is involved in crosstalk between gibberellins and brassinosteroids in rice. Plant J. 2009, 57(3), 498-510.
- Zhong, C.; Xu, H.; Ye, S.; Wang, S.; Li, L.; Zhang, S.; Wang, X. Gibberellic acid-stimulated Arabidopsis6 serves as an integrator of gibberellin, abscisic acid, and glucose signaling during seed germination in Arabidopsis. Plant Physiol. 2015, 169, 2288-2303.
- Zhang, S.; Yang, C.; Peng, J.; Sun, S.; Wang, X. GASA5, a regulator of flowering time and stem growth in Arabidopsis thaliana. Plant Mol. Biol. 2009, 69, 745-759. [CrossRef]
- Zimmermann, R.; Sakai, H.; Hochholdinger, F. The gibberellic acid stimulated-like gene family in maize and its role in lateral root development. Plant Physiol. 2010, 152, 356-365.
- Bouteraa, M.T.; Romdhane, W.B.; Ben Hsouna, A.; Amor, F.; Ebel, C.; Ben Saad, R. Genome-wide characterization and expression profiling of GASA gene family in Triticum turgidum ssp. durum (desf.) husn. (Durum wheat) unveils its involvement in environmental stress responses. Phytochemistry 2023, 206, 113544.
- Cheng, X.; Wang, S.; Xu, D.; Liu, X.; Li, X.; Xiao, W.; Cao, J.; Jiang, H.; Min, X.; Wang, J.; Zhang, H.; Chang, C.; Lu, J.; Ma, C. Identification and analysis of the GASR gene family in common wheat (Triticum aestivum L.) and characterization of TaGASR34, a gene associated with seed dormancy and germination. Front. Genet. 2019, 10, 980.
- Herbel, V.; Sieber-Frank, J.; Wink, M. The antimicrobial peptide snakin-2 is up-regulated in the defense response of tomatoes (Solanum lycopersicum) as part of the jasmonate-dependent signaling pathway. J. Plant Physiol. 2017, 208, 1–6. [CrossRef]
- Ko, C.-B.; Woo, Y.-M.; Lee, D. J.; Lee M.-C.; Kim C.S. Enhanced tolerance to heat stress in transgenic plants expressing the GASA4 gene. Plant Physiol. Bioch. 2006, 44, 722-728. [CrossRef]
- Zhang, S.; Wang, X. Overexpression of GASA5 increases the sensitivity of Arabidopsis to heat stress. J. Plant Physiol. 2011, 168, 2093-2101. [CrossRef]
- Wang, H.; Wei, T.; Wang, X.; Zhang, L.; Yang, M.; Chen, L.; Song, W.; Wang, C.; Chen, C. Transcriptome analyses from mutant Salvia miltiorrhiza reveals important roles for SmGASA4 during plant development. Int. J. Mol. Sci. 2018, 19: 2088.
- Sun, S.; Wang, H.; Yu, H.; Zhong, C.; Zhang, X.; Peng, J.; Wang, X. GASA14 regulates leaf expansion and abiotic stress resistance by modulating reactive oxygen species accumulation. J. Exp. Bot. 2013, 64, 1637-1647. [CrossRef]
- Lee, S.-C.; Hans, S.-K.; Kim, S.-R. Salt- and ABA-inducible OsGASR1 is involved in salt tolerance. J. Plant Biol. 2015, 58, 96-101. [CrossRef]
- Li, K.-L.; Bai, X.; Li, Y.; Cai, H.; Ji, W.; Tang, L.-L.; Wen, Y.-D.; Zhu, Y.-M. GsGASA1 mediated root growth inhibition in response to chronic cold stress is marked by the accumulation of DELLAs. J. Plant Physiol. 2011, 168, 2153-2160. [CrossRef]
- Priyadarshan, P.M.; Goncalves, P.S. Hevea gene pool for breeding. Genet. Resour. Crop Evol. 2003, 50, 101-114. [CrossRef]
- Priyadarshan, P.M. Refinements to Hevea rubber breeding. Tree Genet. Genomes 2017, 13, 20. [CrossRef]
- Priyadarshan, P.M.; Hoa, T.T.T.; Huasun H.; de Gonçalves, P. S. Yielding potential of rubber (Hevea brasiliensis) in sub-optimal environments. J. Crop Improv. 2005, 14(1-2), 221-247.
- An, B.; Wang, Q.; Zhang, X.; Zhang B.; Luo, H.; He, C. Comprehensive transcriptional and functional analyses of HbGASA genes reveal their roles in fungal pathogen resistance in Hevea brasiliensis. Tree Genet. Genomes 2018, 14: 41.
- Muhammad, I.; Li, W.Q.; Jing, X.Q.; Zhou, M.R.; Shalmani, A.; Ali, M.; Wei, X.Y.; Sharif, R.; Liu, W.T.; Chen, K.M. A systematic in silico prediction of gibberellicacid stimulated GASA family members: a novel small peptide contributes to floral architecture and transcriptomic changes induced by external stimuli in rice. J. Plant Physiol. 2019, 234-235,117-132.
- Ahmad, B.; Yao, J.; Zhang, S.; Li, X.; Zhang, X.; Yadav, V.; Wang, X. Genome-wide characterization and expression profiling of GASA genes during different stages of seed development in Grapevine (Vitis vinifera L.) predict their involvement in seed development. Int. J. Mol. Sci. 2020, 21, 1088.
- Qiao, K.; Ma, C.; Lv, J.; Zhang, C.; Ma, Q.; Fan, S. Identification, characterization, and expression profiles of the GASA genes in Cotton. J. Cotton Res. 2021, 4, 7. [CrossRef]
- Zhang, S.; Wang, X. Expression pattern of GASA, downstream genes of DELLA, in Arabidopsis. Chin. Sci. Bull. 2008, 53, 3839-3846. [CrossRef]
- Nahirnak, V.; Rivarola, M.; de Urreta, M.G.; Paniego, N.; Hopp, H.E.; Almasia, N.I.; Vazquez-Rovere, C. Genome-wide analysis of the Snakin/GASA gene family in Solanum Tuberosum cv. Kennebec. Am J. Potato Res. 2016, 93(2), 172-188. [CrossRef]








| Gene name | Gene ID | Protein (aa) | MW(Da) | pI | GRAVY | Instability index |
|---|---|---|---|---|---|---|
| HbGASA1 | HB12G01226.t1 | 91 | 10007.97 | 9.05 | -0.071 | 35.77 |
| HbGASA2 | HB12G00438.t1 | 88 | 9680.57 | 8.92 | -0.006 | 27.25 |
| HbGASA3 | HB9G01711.t1 | 94 | 10413.46 | 9.12 | -0.059 | 38.58 |
| HbGASA4 | HB17G00879.t1 | 106 | 11639.83 | 9.27 | -0.176 | 37.78 |
| HbGASA5 | HB12G00124.t1 | 100 | 10764.64 | 7.46 | 0.184 | 64.30 |
| HbGASA6 | HB3G00732.t1 | 112 | 12424.58 | 9.45 | -0.446 | 54.82 |
| HbGASA7 | HB16G01943.t1 | 107 | 12053.17 | 9.38 | -0.407 | 45.44 |
| HbGASA8 | HB9G02012.t1 | 107 | 12116.24 | 9.42 | -0.427 | 53.83 |
| HbGASA9 | HB8G00808.t1 | 88 | 9709.73 | 9.33 | -0.194 | 35.92 |
| HbGASA10 | HB2G00189.t1 | 104 | 11066.93 | 8.92 | -0.015 | 45.58 |
| HbGASA11 | HB12G01227.t1 | 111 | 12325.53 | 9.46 | -0.154 | 56.89 |
| HbGASA12 | HB7G01329.t1 | 98 | 10406.24 | 9.16 | -0.179 | 45.23 |
| HbGASA13 | HB2G01401.t1 | 96 | 10572.41 | 8.9 | -0.328 | 50.72 |
| HbGASA14 | HB9G00885.t1 | 105 | 11442.52 | 8.75 | 0.078 | 59.26 |
| HbGASA15 | HB17G00792.t1 | 109 | 11904.03 | 8.75 | -0.083 | 46.10 |
| HbGASA16 | HB16G01340.t1 | 106 | 11499.55 | 9.01 | -0.013 | 49.44 |
| HbGASA17 | HB15G00224.t1 | 241 | 25225.32 | 9.79 | -0.226 | 62.00 |
| HbGASA18 | HB18G00432.t1 | 253 | 26546.86 | 9.98 | -0.355 | 66.68 |
| Primer name | Forward primer (5ʹ-3ʹ) | Reverse primer (5ʹ-3ʹ) |
| YLS8 | CCTCGTCGTCATCCGATTC | CAGGCACCTCAGTGATGTC |
| HbGASA2 | GTGACTCCAAGTGTGGGGAG | ATAAGTTCCAGAGGGCACGC |
| HbGASA3 | GCCTCAGGTGTACTTCCCTC | AGCACGAAACTTAGCACCCT |
| HbGASA6 | CAGCTTACAAGAAGCCGTGC | TTGTTGTAGCAAGGGCAGGA |
| HbGASA7 | GTTATGGCATCGCATGGTCA | ATTGGGTCTTGCTGCACCTC |
| HbGASA8 | GGCTAAATTTGTTGCTGCCTTCCT | GCCTTTGGTTGTCATAGTGGTG |
| HbGASA9 | CAAGTCCCCTTACTGCACGA | AGAGGGCACACACTTGCATT |
| HbGASA14 | TGAAGAGCAAAGCACCGAGTT | TGCAAACTACACCTCACCTTG |
| HbGASA15 | GGCAGTCCGTTTGCTTCTTG | GAGCCTCCTGTTTCCACCTC |
| HbGASA17 | CCAAGGCTGTGTTGTTTCTGG | AGGAGTCTTGGCTGGTGGTA |
| HbGASA18 | CCCAAATACTAGTCGCCCCA | GGAGTTGGTGCCTTGACTGG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).