Submitted:
19 December 2024
Posted:
20 December 2024
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Results
2.1. Phylogenetic Analysis of Enteroviruses
2.2. Obtaining a Panel of Cell Lines with Knockouts of Different Enterovirus Receptors
2.3. Evaluation of Enterovirus Reproduction in a Panel of Cells with Viral Receptor Knockouts
3. Discussion
4. Materials and Methods
4.1. Phylogenetic Analysis of the Enteroviruses
4.2. Cell Lines and Viral Strains
4.3. The HEK293T Cell Lines with Viral Receptor Gene Knockouts
4.4. Enterovirus RNA Purification and Genome Sequencing
4.5. Determination of Enterovirus Reproduction
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Jartti, M.; Flodstrom-Tullberg, M.; Hankaniemi, M.M. Enteroviruses: epidemic potential, challenges and opportunities with vaccines. J Biomed Sci 2024, 31, 73. [Google Scholar] [CrossRef] [PubMed]
- Nikonov, O.S.; Chernykh, E.S.; Garber, M.B.; Nikonova, E.Y. Enteroviruses: Classification, Diseases They Cause, and Approaches to Development of Antiviral Drugs. Biochemistry (Mosc) 2017, 82, 1615–1631. [Google Scholar] [CrossRef] [PubMed]
- Alekseeva, O.N.; Hoa, L.T.; Vorobyev, P.O.; Kochetkov, D.V.; Gumennaya, Y.D.; Naberezhnaya, E.R.; Chuvashov, D.O.; Ivanov, A.V.; Chumakov, P.M.; Lipatova, A.V. Receptors and Host Factors for Enterovirus Infection: Implications for Cancer Therapy. Cancers (Basel) 2024, 16. [Google Scholar] [CrossRef] [PubMed]
- Bergelson, J.M.; Coyne, C.B. Picornavirus entry. Adv Exp Med Biol 2013, 790, 24–41. [Google Scholar] [CrossRef]
- Maier, M.K.; Seth, S.; Czeloth, N.; Qiu, Q.; Ravens, I.; Kremmer, E.; Ebel, M.; Muller, W.; Pabst, O.; Forster, R.; et al. The adhesion receptor CD155 determines the magnitude of humoral immune responses against orally ingested antigens. Eur J Immunol 2007, 37, 2214–2225. [Google Scholar] [CrossRef] [PubMed]
- Gao, J.; Zheng, Q.; Xin, N.; Wang, W.; Zhao, C. CD155, an onco-immunologic molecule in human tumors. Cancer Sci 2017, 108, 1934–1938. [Google Scholar] [CrossRef] [PubMed]
- Bergelson, J.M.; Cunningham, J.A.; Droguett, G.; Kurt-Jones, E.A.; Krithivas, A.; Hong, J.S.; Horwitz, M.S.; Crowell, R.L.; Finberg, R.W. Isolation of a common receptor for Coxsackie B viruses and adenoviruses 2 and 5. Science 1997, 275, 1320–1323. [Google Scholar] [CrossRef] [PubMed]
- Tomko, R.P.; Xu, R.; Philipson, L. HCAR and MCAR: the human and mouse cellular receptors for subgroup C adenoviruses and group B coxsackieviruses. Proc Natl Acad Sci U S A 1997, 94, 3352–3356. [Google Scholar] [CrossRef]
- Yamayoshi, S.; Iizuka, S.; Yamashita, T.; Minagawa, H.; Mizuta, K.; Okamoto, M.; Nishimura, H.; Sanjoh, K.; Katsushima, N.; Itagaki, T.; et al. Human SCARB2-dependent infection by coxsackievirus A7, A14, and A16 and enterovirus 71. J Virol 2012, 86, 5686–5696. [Google Scholar] [CrossRef]
- Gonzalez, A.; Valeiras, M.; Sidransky, E.; Tayebi, N. Lysosomal integral membrane protein-2: a new player in lysosome-related pathology. Mol Genet Metab 2014, 111, 84–91. [Google Scholar] [CrossRef]
- Bergelson, J.M.; Shepley, M.P.; Chan, B.M.; Hemler, M.E.; Finberg, R.W. Identification of the integrin VLA-2 as a receptor for echovirus 1. Science 1992, 255, 1718–1720. [Google Scholar] [CrossRef] [PubMed]
- Bergelson, J.M.; St John, N.; Kawaguchi, S.; Chan, M.; Stubdal, H.; Modlin, J.; Finberg, R.W. Infection by echoviruses 1 and 8 depends on the alpha 2 subunit of human VLA-2. J Virol 1993, 67, 6847–6852. [Google Scholar] [CrossRef] [PubMed]
- Roivainen, M.; Piirainen, L.; Hovi, T.; Virtanen, I.; Riikonen, T.; Heino, J.; Hyypia, T. Entry of coxsackievirus A9 into host cells: specific interactions with alpha v beta 3 integrin, the vitronectin receptor. Virology 1994, 203, 357–365. [Google Scholar] [CrossRef]
- Williams, C.H.; Kajander, T.; Hyypia, T.; Jackson, T.; Sheppard, D.; Stanway, G. Integrin alpha v beta 6 is an RGD-dependent receptor for coxsackievirus A9. J Virol 2004, 78, 6967–6973. [Google Scholar] [CrossRef]
- Shafren, D.R.; Dorahy, D.J.; Ingham, R.A.; Burns, G.F.; Barry, R.D. Coxsackievirus A21 binds to decay-accelerating factor but requires intercellular adhesion molecule 1 for cell entry. J Virol 1997, 71, 4736–4743. [Google Scholar] [CrossRef] [PubMed]
- Xiao, C.; Bator, C.M.; Bowman, V.D.; Rieder, E.; He, Y.; Hebert, B.; Bella, J.; Baker, T.S.; Wimmer, E.; Kuhn, R.J.; et al. Interaction of coxsackievirus A21 with its cellular receptor, ICAM-1. J Virol 2001, 75, 2444–2451. [Google Scholar] [CrossRef]
- Sakamoto, A.; Inoue, H.; Miyamoto, S.; Ito, S.; Soda, Y.; Tani, K. Coxsackievirus A11 is an immunostimulatory oncolytic virus that induces complete tumor regression in a human non-small cell lung cancer. Sci Rep 2023, 13, 5924. [Google Scholar] [CrossRef] [PubMed]
- Zhao, X.; Zhang, G.; Liu, S.; Chen, X.; Peng, R.; Dai, L.; Qu, X.; Li, S.; Song, H.; Gao, Z.; et al. Human Neonatal Fc Receptor Is the Cellular Uncoating Receptor for Enterovirus B. Cell 2019, 177, 1553–1565. [Google Scholar] [CrossRef] [PubMed]
- Shafren, D.R.; Bates, R.C.; Agrez, M.V.; Herd, R.L.; Burns, G.F.; Barry, R.D. Coxsackieviruses B1, B3, and B5 use decay accelerating factor as a receptor for cell attachment. J Virol 1995, 69, 3873–3877. [Google Scholar] [CrossRef] [PubMed]
- Ward, T.; Pipkin, P.A.; Clarkson, N.A.; Stone, D.M.; Minor, P.D.; Almond, J.W. Decay-accelerating factor CD55 is identified as the receptor for echovirus 7 using CELICS, a rapid immuno-focal cloning method. EMBO J 1994, 13, 5070–5074. [Google Scholar] [CrossRef] [PubMed]
- Shakeel, S.; Seitsonen, J.J.; Kajander, T.; Laurinmaki, P.; Hyypia, T.; Susi, P.; Butcher, S.J. Structural and functional analysis of coxsackievirus A9 integrin alphavbeta6 binding and uncoating. J Virol 2013, 87, 3943–3951. [Google Scholar] [CrossRef] [PubMed]
- Nikolaidis, M.; Mimouli, K.; Kyriakopoulou, Z.; Tsimpidis, M.; Tsakogiannis, D.; Markoulatos, P.; Amoutzias, G.D. Large-scale genomic analysis reveals recurrent patterns of intertypic recombination in human enteroviruses. Virology 2019, 526, 72–80. [Google Scholar] [CrossRef] [PubMed]
- Gambaro, F.; Perez, A.B.; Aguera, E.; Prot, M.; Martinez-Martinez, L.; Cabrerizo, M.; Simon-Loriere, E.; Fernandez-Garcia, M.D. Genomic surveillance of enterovirus associated with aseptic meningitis cases in southern Spain, 2015-2018. Sci Rep 2021, 11, 21523. [Google Scholar] [CrossRef] [PubMed]
- Kyriakopoulou, Z.; Pliaka, V.; Amoutzias, G.D.; Markoulatos, P. Recombination among human non-polio enteroviruses: implications for epidemiology and evolution. Virus Genes 2015, 50, 177–188. [Google Scholar] [CrossRef] [PubMed]
- Vorobyev, P.O.; Babaeva, F.E.; Panova, A.V.; Shakiba, J.; Kravchenko, S.K.; Soboleva, A.V.; Lipatova, A.V. Oncolytic Viruses in the Therapy of Lymphoproliferative Diseases. Mol Biol 2022, 56, 684–695. [Google Scholar] [CrossRef]
- Lin, D.; Shen, Y.; Liang, T. Oncolytic virotherapy: basic principles, recent advances and future directions. Signal Transduct Target Ther 2023, 8, 156. [Google Scholar] [CrossRef]
- Donina, S.; Strele, I.; Proboka, G.; Auzinš, J.; Alberts, P.; Jonsson, B.; Venskus, D.; Muceniece, A. Adapted ECHO-7 virus Rigvir immunotherapy (oncolytic virotherapy) prolongs survival in melanoma patients after surgical excision of the tumour in a retrospective study. Melanoma Research 2015, 25, 421–426. [Google Scholar] [CrossRef]
- Babiker, H.M.; Riaz, I.B.; Husnain, M.; Borad, M.J. Oncolytic virotherapy including Rigvir and standard therapies in malignant melanoma. Oncolytic Virother 2017, 6, 11–18. [Google Scholar] [CrossRef] [PubMed]
- Hamad, A.; Soboleva, A.V.; Vorobyev, P.O.; Mahmoud, M.; Vasilenko, K.V.; Chumakov, P.M.; Lipatova, A.V. Development of a recombinant oncolytic poliovirus type 3 strain with altered cell tropism. Bulletin of RSMU 2022, 2, 5–10. [Google Scholar] [CrossRef]
- Podshivalova, E.S.; Semkina, A.S.; Kravchenko, D.S.; Frolova, E.I.; Chumakov, S.P. Efficient delivery of oncolytic enterovirus by carrier cell line NK-92. Mol Ther Oncolytics 2021, 21, 110–118. [Google Scholar] [CrossRef]
- Le, T.H.; Lipatova, A.V.; Volskaya, M.A.; Tikhonova, O.A.; Chumakov, P.M. [The State of The Jak/Stat Pathway Affects the Sensitivity of TumorCells to Oncolytic Enteroviruses]. Mol Biol (Mosk) 2020, 54, 634–642. [Google Scholar] [CrossRef] [PubMed]
- Mendelsohn, C.L.; Wimmer, E.; Racaniello, V.R. Cellular receptor for poliovirus: molecular cloning, nucleotide sequence, and expression of a new member of the immunoglobulin superfamily. Cell 1989, 56, 855–865. [Google Scholar] [CrossRef]
- Martino, T.A.; Petric, M.; Weingartl, H.; Bergelson, J.M.; Opavsky, M.A.; Richardson, C.D.; Modlin, J.F.; Finberg, R.W.; Kain, K.C.; Willis, N.; et al. The coxsackie-adenovirus receptor (CAR) is used by reference strains and clinical isolates representing all six serotypes of coxsackievirus group B and by swine vesicular disease virus. Virology 2000, 271, 99–108. [Google Scholar] [CrossRef] [PubMed]
- Lipatova, A.V.; Le, T.H.; Sosnovtseva, A.O.; Babaeva, F.E.; Kochetkov, D.V.; Chumakov, P.M. Relationship between cell receptors and tumor cell sensitivity to oncolytic enteroviruses. Bulletin of Experimental Biology and Medicine 2018, 166, 58–62. [Google Scholar] [CrossRef]
- Lea, S.M.; Powell, R.M.; McKee, T.; Evans, D.J.; Brown, D.; Stuart, D.I.; van der Merwe, P.A. Determination of the affinity and kinetic constants for the interaction between the human virus echovirus 11 and its cellular receptor, CD55. J Biol Chem 1998, 273, 30443–30447. [Google Scholar] [CrossRef]
- Pettigrew, D.M.; Williams, D.T.; Kerrigan, D.; Evans, D.J.; Lea, S.M.; Bhella, D. Structural and functional insights into the interaction of echoviruses and decay-accelerating factor. J Biol Chem 2006, 281, 5169–5177. [Google Scholar] [CrossRef] [PubMed]
- Vandesande, H.; Laajala, M.; Kantoluoto, T.; Ruokolainen, V.; Lindberg, A.M.; Marjomaki, V. Early Entry Events in Echovirus 30 Infection. J Virol 2020, 94. [Google Scholar] [CrossRef] [PubMed]
- Rudnik-Jansen, I.; Howard, K.A. FcRn expression in cancer: Mechanistic basis and therapeutic opportunities. J Control Release 2021, 337, 248–257. [Google Scholar] [CrossRef]
- Kim, M.H.; Lee, J.H.; Lee, J.S.; Kim, D.C.; Yang, J.W.; An, H.J.; Na, J.M.; Shin, M.C.; Song, D.H. Fc Receptor Expression as a Prognostic Factor in Patients With Non-small-cell Lung Cancer. In Vivo 2022, 36, 2708–2713. [Google Scholar] [CrossRef]
- Sievers, F.; Higgins, D.G. Clustal Omega for making accurate alignments of many protein sequences. Protein Sci 2018, 27, 135–145. [Google Scholar] [CrossRef] [PubMed]
- Huerta-Cepas, J.; Serra, F.; Bork, P. ETE 3: Reconstruction, Analysis, and Visualization of Phylogenomic Data. Mol Biol Evol 2016, 33, 1635–1638. [Google Scholar] [CrossRef]
- Vorobyev, P.O.; Kochetkov, D.V.; Vasilenko, K.V.; Lipatova, A.V. Comparative efficiency of accessible transfection methods in model cell lines for biotechnological applications. Bulletin of Russian State Medical University 2022, 11–18. [Google Scholar] [CrossRef]
- Bankevich, A.; Nurk, S.; Antipov, D.; Gurevich, A.A.; Dvorkin, M.; Kulikov, A.S.; Lesin, V.M.; Nikolenko, S.I.; Pham, S.; Prjibelski, A.D.; et al. SPAdes: a new genome assembly algorithm and its applications to single-cell sequencing. J Comput Biol 2012, 19, 455–477. [Google Scholar] [CrossRef]
- Galaxy, C. The Galaxy platform for accessible, reproducible and collaborative biomedical analyses: 2022 update. Nucleic Acids Res 2022, 50, W345–W351. [Google Scholar] [CrossRef]



| Viral receptor target gene | Oligonucleotides used for cloning of sgRNA spacers | Oligonucleotides used for amplification of CRISPR/Cas9 targeted gene regions | An antibody used against a viral receptor |
|---|---|---|---|
| PVR | 5’-phospho-GATCGcgggatgcccaatacgagccG | CCATGCCATCCTGTACCCTT | Abcam (ab205304) |
| 5’-phospho-AAAACggctcgtattgggcatcccgC | GAAGCAATGCCTACAGTGCC | ||
| CXADR | 5’-phospho-GATCGtacgcttagtcccgaagaccG | TTCTGAATGGCTGCGGGG | Abcam (ab126250) |
| 5’-phospho-AAAACggtcttcgggactaagcgtaC | ATGTGACTGGCAAGGTGATG | ||
| CD55 | 5’-phospho-GATCGattggagagcactctattG | CCAGCACCACCACAAATTGA | Abcam (ab253284) |
| 5’-phospho-AAAACaatagagtgctctccaatC | AGACCCTTCTGAGAAGCTGT | ||
| SCARB2 | 5’-phospho-GATCGacagttgacgaattgctctggG | ATCGAGGCCATGTTGAAAGC | Abcam (ab176317) |
| 5’-phospho-AAAACccagagcaattcgtcaactgtC | GTTAATCTGGCTTGGGGTGC | ||
| ICAM1 | 5’-phospho-GATCGgctattcaaactgccctgatgG | GCGCACATTCCCCTTGATGAA | Abcam (ab109361) |
| 5’-phospho-AAAACcatcagggcagtttgaatagcC | CAGTACACGGTGAGGAAGGT | ||
| ITGA2 | 5’-phospho-GATCGattggagagcactctattG | TGTAGCCACAAGACACTGATG | Abcam (ab181548) |
| 5’-phospho-AAAACgttggtacttcggctttctcC | ACAGCAAAAGGATTCCAGCA | ||
| FCGRT | 5’-phospho-GATCGctgagctacaatagcctgcgC | TTCTCCCTCCCTGGGTATCT | Abcam (ab228975) |
| 5’-phospho-AAAACaccggaatctcaccttttcccG | ACCGGAATCTCACCTTTTCCC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).