Hsp90 Is Required in Epimorphic Regeneration

1. Introduction

Heat shock protein 90 (Hsp90) is an ATP-dependent molecular chaperone in eukaryotes. It was first discovered over 40 years ago in the heat shock response of fruit flies. Now it is clear that this protein is evolutionarily conserved among various species. Caenorhabditis elegans and Drosophila melanogaster contain only one Hsp90 homolog [1], while in mammals and zebrafish, there are two subtypes, Hsp90α, an inducible subtype that can be induced to express under stress, and Hsp90β, a constitutively expressed subtype [1,2]. However, for certain species, such as amphioxus, the information regarding Hsp90 is incomplete. It has been reported that there exists a homologue of Hsp90α [3], but whether it possesses Hsp90β remains uncertain. Numerous studies have revealed that Hsp90 interacts with a wide range of proteins, including many signaling proteins, transcription factors, and other client proteins, thereby participating in numerous biological and pathophysiological processes. For example, Hsp90α has been shown to regulate the stability and activity of some transcription factors such as c-Myc [4,5], Nf-κB [6,7], and p53 [8,9], which are involved in cell proliferation, apoptosis, and differentiation. High expression of Hsp90 is linked to many cancer types [10]. It acts as an inducer or promoter in cancer development and regulation by stabilizing and activating some proteins that are critical for carcinogenesis [11]. Consequently, Hsp90 inhibitors such as geldanamycin, or its derivatives have been trialed in cancer therapies [12] or used to examine Hsp90’s functional role in some biological processes, for example, embryo development of zebrafish [13,14].

There is also evidence suggesting that Hsp90 is involved in the regeneration process, where damaged or lost tissues, organs, and even entire bodies are restored in organisms. Uncovering the cellular and molecular mechanisms underlying the regenerative process in diverse modes is a long-standing goal in the field of regeneration. Recently, it was discovered that Hsp90α participates in tail fin regeneration in fish [15], an epimorphic type characterized by cell proliferation and blastema formation during the regenerative process [16]. Evidence that Hsp90α may be involved in initiating and promoting caudal fin regeneration comes from the elevated expression of Hsp90α in cells near the blastema and blood vessels of the regenerated fin [15]. Our previous transcriptome analysis also indicated that Hsp90α is highly expressed at an early stage of tail regeneration in amphioxus, a vertebrate-like organism undergoing epimorphic regeneration [17]. However, the functional role of Hsp90 in the epimorphic regeneration process and whether its significance in regeneration is conserved across different species are not well understood.

To address this question, this study delved into the role of Hsp90 in tail regeneration in axolotl, an important regenerative model animal in tetrapods, and compared it with its functions in other typical epimorphic regeneration processes, such as tail fin regeneration in zebrafish and tail regeneration in amphioxus.

2. Results

2.1. Dynamic Expression Patterns of Hsp90α During the Tail Regeneration Process in Axolotls

The expression patterns of Hsp90α during regeneration were detected using in situ hybridization and qPCR methods. It was revealed that Hsp90α exhibited a highly dynamic expression pattern throughout the regeneration process. At 1h-3h post-amputation (hpa), it was expressed at the wound site (Figure 1A, B). Subsequently, its expression was upregulated and concentrated in the vicinity of the injured end of the vertebrate, primarily comprising cartilage and spinal cord, at 7 hpa (Figure 1C). At 12 hpa, its expression remained predominantly distributed in the surrounding tissues of the injured vertebrate site at a high level (Figure 1D). However, its expression decreased sharply at 1 day post-amputation (dpa) (Figure 1E) and then increased again in the wounded side of the vertebrae at 3 dpa (Figure 1F). At subsequent stages, such as 5 dpa and 7 dpa, its expression was mainly localized near the vertebrae at relatively low levels (Figure 1G, H).

This highly dynamic expression pattern of Hsp90α is also evident in the qPCR assay. It was demonstrated that following amputation, its expression level increased at 3 hpa and reached a peak at 12 hpa, and then decreased drastically to a basal level like that in an intact tail. Its expression was then upregulated at 3 dpa, while at later stages, such as 5-10 dpa, it continued to fluctuate at relatively low levels (Figure 1J).

2.2. Pharmacological Inhibition of Hsp90 or Knocking Down of Hsp90α During Tail Regeneration of Axolotl

To ascertain whether Hsp90 is essential in the tail regeneration process of axolotls, we blocked its activity with geldanamycin following amputation. The results showed that in the control group, a regenerating blastema appeared at 5 dpa, continued to grow at the following stage and formed a new tail at 28 dpa (Figure 2A). In contrast, in the treatment group, tail regeneration became stagnant, with no regeneration blastema formed until 15 dpa. (Figure 2B). When we pushed the treatment time window back to 9 dpa, the regeneration capacity was partially restored at 10 dpa (Figure 2C).

The significance of Hsp90 in the tail regeneration was further confirmed by knocking down Hsp90α during the tail regeneration process. It was evident that, compared to the normal regenerative process in the control group (Figure 3A), the regenerative process was hindered by the knockdown of Hsp90α via Morpholino (Figure 3B).

2.3. Inhibition of Hsp90 Led to Decreased Cell Proliferation and Increased Cell Apoptosis.

The comparative analysis of cell proliferation in tail regenerates highlights the role of Hsp90 in the regeneration process. In the control group, cell proliferation was mainly concentrated in the regeneration region, yielding a cell proliferative index of approximately 22.5% (based on counting from nine sections from three tail regenerates) (Figure 4A-C, G). In contrast, treatment with the Hsp90 inhibitor geldanamycin led to a significant reduction in cell proliferation. The cell proliferative index decreased dramatically to 6.3%, as observed (Figure 4D-G). This substantial decrease in cell proliferation in the treatment group suggests that Hsp90 is critical for maintaining the proliferative activity necessary for effective tissue regeneration. Overall, these findings indicate that Hsp90 is an important regulator of cell proliferation during tail regeneration, and its inhibition adversely affects the regenerative process by reducing the rate of cell division.

The TUNEL assay results indicate that Hsp90 plays a significant role in modulating cell apoptosis during tail regeneration. In the control group, apoptosis was primarily observed in the upper layer of the apical cap, with a few apoptotic cells present in deeper layers. The average apoptotic index for this group was 5.6% (Figure 5A-C, G). However, the group treated with the Hsp90 inhibitor, geldanamycin, exhibited a marked increase in apoptosis. Apoptotic cells were widespread and prominent throughout the regeneration region, affecting both the wound epidermis and underlying cells (Figure 5D-F). This widespread apoptosis in the treatment group resulted in a significant increase in the average apoptotic index, which rose to 15.8% per section (Figure 5D-G). This suggests that inhibiting Hsp90 leads to an increase in apoptosis during tail regeneration, emphasizing the role of Hsp90 in cell survival and tissue regeneration.

2.4. Inhibition of Hsp 90 During the Axolotl's Tail Regeneration Process of Axolotl Led to Changes in Gene Expression Profile.

To gain molecular insights into the mechanisms by which Hsp90 modulates regeneration, we delved into the alterations in the gene expression profile subsequent to Hsp90 suppression during the regenerative process. This was achieved through a meticulous comparative transcriptome analysis, comparing the control group with the Hsp90α-inhibited group. Employing RNA sequencing in conjunction with de novo assembly, we identified a total of 103,094 transcripts, characterized by an N50 of 3,300 bp, a maximum length reaching 21,472 bp, and an average length of 1,542 bp. Notably, the completeness of our assembly was high, with 947 complete BUSCOs, accounting for 99.3% of the total 954 BUSCO groups examined. Furthermore, we successfully annotated 39,631 genes by cross-referencing with esteemed public protein databases, including Nr, UniProt, Pfam, KOG, KEGG, and GO, utilizing an E value threshold (detailed in Supplementary Table S1).

Based on the level of gene expression, 681 differentially expressed genes (DEGs) were identified between the control group and the treatment group, including 417 upregulated genes and 264 downregulated genes. To better understand the functional roles of these DEGs, KEGG classification was performed. The upregulated genes fell into the various pathways (Supplementary Figure S1A and Supplementary Table S2). A large portion of them belonged to immune system and pathogen-caused disease-related pathways, such as the NOD−like receptor signaling pathway, complement and coagulation cascade, antigen processing and presentation, legionellosis, measles, toxoplasmosis and malaria. Some immune-related pathways have been frequently associated with tumorigenesis. For instance, NOD1 and NOD2, immune receptors that recognize components of the bacterial cell wall, function as tumor suppressors, and their overexpression reduces the proliferation of cancer cells [18]. Additionally, some of these upregulated genes were enriched in pathways that play roles in suppressing cancers and cell division or promoting apoptosis, such as the P53 signaling pathway [19] and Hippo signaling pathway [20].

In contrast, a large number of downregulated genes were grouped into tumorigenesis or cell proliferation-related pathways (Supplementary Figure S1B and Supplementary Table S3), such as IL-17 signaling, growth hormone synthesis, secretion and action, prolactin signaling pathway, small cell lung cancer, relaxin signaling pathway, choline metabolism in cancer and breast cancer. For example, IL-17 is a crucial cytokine in cancer promotion and progression, and the IL-17-mediated TRAF4:ERK5 activation pathway promotes keratinocyte proliferation and tumorigenesis [21].

Among these DEGs, we particularly focused on genes encoding transcription factors, as they have crucial functions in the development and regeneration process. In total, there were 57 genes belonging to thirty transcription factor (TF) families containing 30 upregulated genes and 27 downregulated genes (Supplementary Table S4). Of these upregulated transcription factor genes (Figure 6A), K10 acts as a tumor suppressor [22], the NF-kappa-B inhibitor epsilon downregulates NF-kappa-B, which can inhibit the proliferation and migration and promote the apoptosis of cells [23], and Matrilin-1 is an inhibitor of neovascularization [24].

For the downregulated genes, it was notable that most of these transcription factor genes (11 of 17) are either oncogenes or play roles in promoting cell proliferation or maintaining cell stemness (Figure 6B and Supplementary Table S4). For example, SALL4 is a master regulator that contributes to cell stemness in biological development and tumor growth [25,26]. Plk3 is an oncogene involved in regualting the G (1)/S phase transition [27,28]. Other downregulated genes play various roles, such as B-lymphocyte-induced maturation protein-1 (Blimp1), which crucially regulates embryonic development and terminal differentiation of immune cells [29].

Collectively, these DEGs analyses can explain the reduced cell proliferation and increased apoptosis caused by Hsp90 suppression. Therefore, Hsp90 plays a crucial role in regulating tail regeneration by orchestrating the expression of the genes, many of which are involved in cell proliferation and apoptosis.

2.5. The Significance of Hsp90 in Tail Fin Regeneration of Zebrafish.

Another question is whether Hsp90 is also required in other epimorphic regeneration processes. We examined its significance in the tail fin of zebrafish, an intensively studied models of epimorphic regeneration. Recently it was revealed that Hsp90α was specifically expressed in the fin regeneration process [15]; however, its necessity in regeneration has not been determined.

Here, we first re-examined the gene expression patterns at different regenerative stages. Following amputation, Hsp90α was specifically expressed in the wound site at 3 hours post-amputation (hpa) (Figure 7A) and increased sharply at 10 hpa (Figure 7B). However, its expression sharply decreased at 1 dpa (Figure 7C). At 3 dpa, its expression was upregulated and maintained a high level and specific expression pattern until 7 dpa in the regeneration site (wound epidermis and blastema) (Figure 7D-F). At 14 dpa its expression was down regulated in the regeneration region (Figure 7G). By contrast, as a negative control, no positive staining was visualized in the tail fin (Figure 7H).

Its necessity in the regenerative process was determined by suppression of Hsp90 with geldanamycin following tail fin amputation. In the control group, as Figure 8A demonstrated, it took approximately 2 weeks to accomplish the fin regeneration process. However, in the treatment group, following amputation, wound healing was completely blocked, and no wound epidermis formed to cover the wound surface, and then gradually decayed, especially in the central area as well as the region of inter fin rays (Figure 8B). However, if the treatment time window is limited to the 3 days following amputation, the regeneration process can be partly restored. Wound healing was accomplished in the subsequent days and then the regeneration process continued but was relatively slow compared to that in the control group (Figure 8C).

To further understand the necessity of Hsp90 in tail fin regeneration molecularly, RNA-seq for comparison between the control and geldanamycin-treated group was performed. Compared to the control group, the suppression of Hsp90 downregulated 1764 genes and upregulated 954 genes in the treatment group. These DEGs fell into various GO and KEGG process categories. A large portion of the downregulated genes were enriched in GO items related to development processes (Supplementary Table S5) and belonged to KEEG items, which are key signaling pathways involved in development and carcinogenesis (Supplementary Table S6).

Of these DEGs, we specifically focus on the transcription factor genes. For these upregulated genes (Figure 9A and Supplementary Table S7), a large proportion of them (14 of 57) are tumor suppressor genes or have the function of promoting cell apoptosis or inhibiting cell proliferation. For example, ETS homologous factor (EHF) can suppress cancer progression by inhibiting epithelial-mesenchymal transition (EMT) [30], and can inhibit the occurrence of colon cancer induced by Apc [31]. Cell death-inducing p53 target 1 (cdip1) is a pro-apoptotic gene, and inhibition of CDIP abrogates p53-mediated apoptotic responses [32]. Activating transcription factor 3 (ATF3), a stress-induced transcription factor, functions as a tumor suppressor and is upregulated upon Hsp90 inhibition [33,34]. Another large part of upregulated genes (8 of 57) are highly involved in the immune system (Figure 9A). Interferon regulatory Factor 8 (IRF8), for example, governs the development of myeloid cells such as monocytes/macrophages and dendritic cells [35], and overexpression of IRF8 in HCC cells significantly enhanced antitumor effects in immune-competent mice [36]. Thirty- four out of 167 downregulated genes were involved in promoting cell proliferation and cell cancer occurrence (Figure 9B). Another big portion of downregulated genes, 40 out of 167, play roles in development and regeneration processes including fin regeneration and formation (Figure 9B and Supplementary Table S7).

2.6. The Significance of Hsp90 in Tail Regeneration of Amphioxus.

To confirm the conservation of Hsp90’s necessity in epimorphosis, we traced its functional role in regeneration back to a key evolutionary animal, the cephalochordate amphioxus. It has established that tail regeneration in amphioxus is a vertebrate-like epimorphosis process, thereby offering an opportunity to explore the evolution of regenerative mechanisms in chordates from invertebrates to vertebrates [17]. Initially, we examined the expression patterns of Hsp90α during the tail regeneration of amphioxus. Notably, Hsp90α was robustly expressed at the wound site during the wound healing stage (Figure 10A, B) and its expression was remaied evident, albeit relatively weak, in blastema at subsequent early and late blastemal stages (12-24 dpa) (Figure 10C, D). As a negative control, no positive staining was observed in the tail regenerate (Figure 10E).

To ascertain whether Hsp90 is indispensable for successful tail regeneration, we inhibited its activity during the tail regeneration process, similar to previous studies in axolotl and zebrafish. As previously reported, wounds in the control group healed successfully at 9 dpa (Figure 10F), followed by the successful formation of the regeneration blastema (Figure 10F). In contrast, inhibition of Hsp90 led to the failure of wound healing, subsequently impeding blastema formation, and ultimately resulting in tail decay (Figure 10G).

3. Discussion

As a stress-induced protein and a highly conserved molecular chaperone, Hsp90 is involved in various biological processes, such as embryo development [13,14], immune response [37], and carcinogenesis [10]. However, its functional role in regeneration process remains largely unknown.

Here, we demonstrate that Hsp90α is expressed in a highly dynamic and specific pattern during three typical epimorphic regeneration processes: tail regeneration in axolotls, tail fin regeneration in zebrafish, and tail regeneration of amphioxus. Knocking down Hsp90α or inhibiting Hsp90 impairs these regeneration processes, suggesting that Hsp90 is essential for epimorphic regeneration. Interestingly, when the inhibition of Hsp90 is removed at a certain point, the stagnant regeneration process in both axolotls and zebrafish is restored to an active state (Figure 2C and Figure 8C). These findings indicate that Hsp90 may function as a trigger or inducer in regeneration.

There are two key observations related to these phenotypes induced by Hsp90 inhibition. Firstly, there is a decrease in cell proliferation due to the suppression of Hsp90 during axolotl tail regeneration. Secondly, there is an increase in cell apoptosis during the tail regenerative process when Hsp90 is inhibited. This regulation of cell apoptosis and proliferation by Hsp90 in regeneration is further supported by changes in gene expression profiles. It is evident that inhibiting Hsp90 leads to the downregulation of numerous genes that promote cell proliferation and maintain stemness. Among these genes, sall4, a key driver of cell stemness [26], is downregulated in both zebrafish and axolotl due to Hsp90 inhibition. Conversely, a significant proportion of upregulated genes are enriched in signaling pathways such as the P53 and Hippo signaling pathways, which play roles in either suppressing cancers and cell division or promoting apoptosis [19,20].

Notably, many of the genes regulated by Hsp90 during regeneration processes are highly involved in tumor formation. Moreover, numerous studies have revealed that overexpression of Hsp90 can induce various cancers. This raises the question of the relationship between regeneration and cancer. The concept of linking regeneration to cancer can be traced back historically to Waddington’s theory, which posits a mechanistic connection between uncontrolled cancerous growth and controlled embryonic development [38]. This theory has been further expanded in recent years to suggest a link between cancer and regeneration [39]. Increasing evidence shows that there are many similarities in cellular processes and gene expression profiles between regeneration and tumorigenesis [40,41]. Our results suggest that, in term of Hsp90, this gene shares similar functions in both regeneration processes and cancers. For instance, as observed in regeneration, Hsp90 also promotes cell proliferation and suppresses apoptosis in cancers [42]. In cancer, inhibiting Hsp90 upregulates the tumor suppressor gene ATF3 [33], and this upregulation of ATF3 induced by Hsp90 inhibition was also observed in the context of regeneration in this study.

In conclusion, our study highlights the necessity of Hsp90 in epimorphic regeneration and its governing role in these processes through regulation of cell proliferation and apoptosis, akin to its function in cancers. Given Hsp90's importance as a molecular chaperone and its ability to interact with a variety of client proteins, further exploration of its additional functions and underlying mechanisms in regeneration is warranted

4. Materials and Methods

4.1. Animals’ Experimental Procedure.

Axolotls (white; obtained from axolotl breeding ground in Changchun, China) with a body length of approximately 5 cm were used for tail amputation. Prior to amputation, the animals were anesthetized with 0.03% MS222 solution (ethyl 3-ami-nobenzoate methanesulfonate salt, Sigma-Aldrich, St. Louis, MO). Prior to tail amputation, the animals were anesthetized with 0.03% MS222 solution (Ethyl 3-ami-nobenzoate methanesulfonate salt, Sigma-Aldrich, St. Louis, MO). The tail-amputated animals and the tail regenerates were used for subsequent experiments.

Zebrafish (wild type, AB line), at 8-10 months old, cultured in our lab, were used in this study. Before tail fin amputation, the animals were anesthetized with 0.01% MS222 solution and then the fin approximately 50% of the fin in length was cut off using a razor blade.

The amphioxus Branchiostoma japonicum used in this study were collected from Shazikou Bay near the city of Qingdao and then cultured in our laboratory. Animals with a body length of approximately 3 cm were selected for tail amputation. The tail amputation was performed as described previously [17].

4.2. Whole-Mount In Situ Hybridization.

To determine the expression patterns of the Hsp90 α during the tail regeneration process of the axolotl, whole mount in situ hybridization was performed on tail regenerates at different stages according to the previously described methods [43,44] with minor modifications. In brief, the tail regenerates were collected and fixed in freshly prepared 4% PFA at 4 °C overnight, then dehydrated with a gradient ethanol and stored in 100% ethanol at -20 °C. The PGM-T-easy vectors (Promega) containing the target gene were linearized with restriction endonuclease NcoI or XhoI, and the sense and antisense gene probes were synthesized by in vitro transcription with T7 or SP6 RNA polymerase and digoxigenin RNA labeling mix (Roche Applied Science). Prior to hybridization, tissues were incubated with 10 μg/ml proteinase K at 37 °C for 10 min to increase tissue permeability. For 48 hours, hybridization was carried out at 60 °C. Alkaline-phosphatase (AP)-conjugated anti-digoxigenin antibody (Roche Applied Science) incubation, at a dilution of 1:2000, was conducted at 4 °C overnight. BCIP and NBT (Roche Applied Science) were used to create the colorimetric alkaline phosphatase reaction.

The expression patterns of the Hsp90α in the tail fin regeneration of zebrafish as well as in the tail regeneration of amphioxus were also detected according to the above protocol. The cDNA sequences of Hsp90α used in this study was presented (Supplementary Table S8).

4.3. Quantitative Real-Time PCR (qRT-PCR).

To examine the expression levels of Hsp90α at the different stages of tail regeneration of axolotl, qRT-PCR was performed. Total RNA was extracted with TRIzol regent (Invitrogen) from tail regenerates at different stages. Single-stranded cDNAs were synthesized with the reverse transcription system (Thermo) according to the manufacturer’s instruction. As previously mentioned, qRT-PCR was carried out using Power SYBR Green PCR Master Mix (Takara) on an ABI 7500 real-time PCR machine (Applied Biosystems) [44]. Data were quantified according to Cycle threshold (CT) values using the 2-^ΔΔCT method [45]. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the internal reference for q-PCR standardization. Three separate runs of the experiments were carried out in triplicate. The data were expressed as the mean ± standard deviation (SD) and assessed using the paired t test method in the GraphPad Prism software. The statistical significance cutoff criterion was set at P <0.05. The primers employed in this study were as follows: GAPDH-Forward, CGTGACCCCGCCAACATC; GAPDH-Reverse, ACGCTTAGCACCGCCCTTCA; Hsp90α-Forward, AAGAGAGGAAAGCACGGACA; Hsp90α-Reverse, TGCATCACCTGTGTCCATTT.

4.4. Gene Knockdown By Vivo-Morpholinos.

To knock down the expression of Hsp90α protein, the antisense vivo-morpholino (MO) oligonucleotides were designed and synthesized by Gene Tools, LLC (Philomath). The MO sequence was complementary to the 5′ sequence near the start of translation (ATG): 5′-CATCCTGAATCCAAATAGAGGTGTC-3′. For control, the MO with sequence of 5′-CCTCTTACCTCAGTTACAATTTATA-3′(Vivo standard control purchased from Gene Tools, LLC ) was used. After the tail amputation, the axolotls were intraperitoneally injected with MOs (20 μM) at a volume of 50 μL per animal once every two days for a total of 10 days. The MOs (20 μM) were also injected directly into the tissues at multiple points at the wound site approximately 2 μL per animal. The regeneration process was then observed at different time points.

4.5. Pharmacological Treatments.

To better understand the function of Hsp90 during the tail regeneration process of the axolotl, its activity was suppressed with geldanamycin, an Hsp90 inhibitor [46,47,48]. Blue Affi-gel beads (Bio-Rad, 153-7302) were soaked in PBS containing geldanamycin at a concentration of 200 μM at 4°C overnight. Control beads were soaked in PBS. After tail amputation, bead grafting to the wound site was conducted as previously described [16]. Then the animals were kept in an ice box and covered with wet tissue paper for 15 minutes. The animals were then cultured in tap water containing 15 μM geldanamycin, and the water was changed every 3 days. The animals used for controls were kept in pure tap water. The tail regeneration process was recorded at different time points.

4.6. TUNEL Staining.

To investigate the potential role of Hsp90 in regulating cell apoptosis during regeneration, TUNEL staining was performed on sections of tail regenerates treated with geldanamycin and compared to control samples. Tail regenerates at 3 days post-amputation (3-dpa) were collected and fixed in 4% paraformaldehyde (PFA). Longitudinal paraffin sections were then prepared with a thickness of 8 μm. TUNEL staining was conducted using the TUNEL BrightRed Apoptosis Detection Kit (Vazyme Biotech Co., Ltd., Nanjing, China) as previously described [44], with an additional step of staining nuclei with DAPI. The slides were examined using a fluorescence microscope. The apoptotic index was calculated by dividing the number of TUNEL-positive cells by the number of DAPI-stained cells in each tissue section. The results were analyzed using a one-way ANOVA followed by Dunnett’s test for post hoc analysis.

4.7. BrdU Labeling.

To assess whether Hsp90 regulates cell proliferation during regeneration, BrdU labeling was performed on animals treated with geldanamycin and on control animals. BrdU was initially injected intraperitoneally at a concentration of 15 μg/mL in PBS, with a total volume of approximately 40 μL per animal at 1 day post-amputation (dpa). A second BrdU injection was administered at 2 dpa using the same volume and concentration as the first injection. The tails that regenerated by 3 dpa were then collected and fixed in freshly prepared 4% PFA.

Standard paraffin sections with a thickness of 8 μm were then prepared. The sections were dewaxed in xylene and rehydrated through a graded alcohol series. After rinsing with PBS, the sections were incubated in 2N HCl at 37°C for 30 minutes to denature the DNA, followed by neutralization in 0.1 M sodium borate for 15 minutes. To prevent nonspecific binding, the sections were then blocked with 3%BSA. They were then incubated overnight at 4°C with mouse anti-BrdU antibody (Abcam, ab8152) at a 1:100 dilution. Following four washes with PBST (PBS containing 0.1% v/v Tween-20), the sections were incubated in the dark at room temperature with CY3-labeled goat anti-mouse IgG (YESEN, 33208ES60) at a 1:200 dilution. Nuclei were stained with DAPI. After three washes with PBS, the sections were mounted using an anti-fade mounting medium. The slides were examined using a fluorescence microscope. The proliferative index was calculated by dividing the number of BrdU positive cells by the number of DAPI-stained cells in each tissue section. A one-way ANOVA, followed by Dunnett’s post hoc test, was used to compare the geldanamycin-treated group with the control group.

4.8. RNA-Seq Analysis.

To elucidate the molecular mechanism by which Hsp90 regulates tail regeneration in axolotls, RNA-seq analysis was performed. Total RNA was isolated with TRIzol regent (Invitrogen) from tail regenerates from geldanamycin-treated animals (three biological replicates and one individual per extraction) or control groups at 3 dpa.

The cDNA libraries for sequencing were generated with the NEBNext® Ultra™RNA Library Prep Kit for Illumina® (#E7530L, NEB, USA) according to the manufacturer’s instructions as described elsewhere16. The cDNA libraries were paired-end sequenced on an Illumina HiSeq 4000 platform by Beina Gene Biotechnology Co. (Wuhan, China). The depth of sequencing was 6.5 G per sample.

The raw reads obtained were further refined by removing unqualified reads using the fastp software (version 0.21.0; with the default parameter) [49]. Subsequently, these reads were assembled in a de novo process utilizing the Trinity software (version 2.11.0; with the parameter --min_kmer_cov 2) [50]. The quality of the assembled transcripts or unigenes was evaluated based on the size of N50. The completeness of the assembled transcripts or unigenes was assessed using BUSCO (Benchmarking Universal Single-Copy Orthologs) [51]. The assembled transcripts or unigenes were annotated by aligning them to public databases, including the NCBI nonredundant (nr) protein database, Swiss-Prot/TrEMBL, Clusters of Orthologous Groups (COG/KOG), Gene Ontology (GO), and Kyoto Encyclopedia of Genes and Genomes (KEGG) databases.

The expression levels of genes were calculated and normalized using the RPKM (reads per kb per million reads) method [52]. Differentially expressed genes (DEGs) between geldanamycin-treated and control animals were identified employing the R package DESeq2 [53], based on the following criteria: a false discovery rate (FDR) ≤ 0.05 and an absolute fold change ≥ 2. The prediction of transcription factors was performed by comparing the genes to the AnimalTFDB (Animal Transcription Factor Database).

Similarly, comparative RNA seq analysis was carried out between tail fin regenerates at 3 dpa from geldanamycin-treated zebrafish and the control group. The resulting clean reads were mapped to the reference genome using HISAT2. 2.4 [54].