Submitted:
04 December 2024
Posted:
05 December 2024
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Materials and Methods
2.1. Instruments
2.2. Reagents and Materials
2.3. Preparation of Gold Nanoparticles (AuNPs)
2.4. Preparation of Det-DNA-AuNP Conjugates
2.5. Preparation of LFNAB
2.6. Sample Analysis Procedure
3. Results
3.1. The Principle of Testing miR-122 on LFNAB
3.2. Optimization of Experimental Parameters
3.3. Analytical Properties
3.4. Specificity Test
3.5. Detection of miR-122 in Serum and Finger Blood
3.5.1. Detection of miR-122 in Serum
3.5.2. Detecting miR-122 in Fingertip Blood
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Choi, Y.; Hwang, D.W.; Kim, M.Y.; Kim, J.Y.; Sun, W.; Lee, D.S. Transgenic mouse expressing optical microRNA reporter for monitoring microRNA-124 action during development. Front. Mol. 2016, 9, 52. [Google Scholar] [CrossRef]
- Wei, X.-y.; Ding, J.; Tian, W.-g.; Yu, Y.-C. MicroRNA-122 as a diagnostic biomarker for hepatocellular carcinoma related to hepatitis C virus: a meta-analysis and systematic review. J. Int. Med. Res. 2020, 8, 0300060520941634. [Google Scholar] [CrossRef]
- Jopling, C. Liver-specific microRNA-122: Biogenesis and function. RNA Biol. 2012, 2, 137–142. [Google Scholar] [CrossRef] [PubMed]
- Wang, H. A Review of Nanotechnology in microRNA Detection and Drug Delivery. Cells 2024, 13, 15. [Google Scholar] [CrossRef]
- Koscianska, E.; Starega-Roslan, J.; Sznajder, L.J.; Olejniczak, M.; Galka-Marciniak, P.; Krzyzosiak, W.J. Northern blotting analysis of microRNAs, their precursors and RNA interference triggers. BMC Mol. Biol. 2011, 12, 1–7. [Google Scholar] [CrossRef]
- Chen, C.; Tan, R.; Wong, L.; Fekete, R.; Halsey, J. Quantitation of microRNAs by real-time RT-qPCR. Methods Mol. Biol. 2010, 113–134. [Google Scholar]
- Reis-Filho, J.S. Next-generation sequencing. Breast Cancer Res. 2009, 3, 1–7. [Google Scholar] [CrossRef]
- Hackenberg, M.; Sturm, M.; Langenberger, D.; Falcon-Perez, J.M.; Aransay, A.M. miRanalyzer: a microRNA detection and analysis tool for next-generation sequencing experiments. Nucleic Acids Res. 2009, 37, suppl_2, W68-W76.
- Jia, H.; Li, Z.; Liu, C.; Cheng, Y. Ultrasensitive detection of microRNAs by exponential isothermal amplification. Angew. Chem., Int. Ed. 2010, 49, 32, 5498-5501.
- Lu, L.-M.; Zhang, X.-B.; Kong, R.-M.; Yang, B.; Tan, W. A ligation-triggered DNAzyme cascade for amplified fluorescence detection of biological small molecules with zero-background signal. J. Am. Chem. Soc. 2011, 30, 11686–11691. [Google Scholar] [CrossRef] [PubMed]
- Peng, Y.; Zhou, W.; Yuan, R.; Xiang, Y. Dual-input molecular logic circuits for sensitive and simultaneous sensing of multiple microRNAs from tumor cells. Sens. Actuators, B 2018, 264, 202-207.
- Parkhe, V.S.; Tiwari, A.P. Gold nanoparticles-based biosensors: pioneering solutions for bacterial and viral pathogen detection-a comprehensive review. World J. Microbiol. Biotechnol. 2024, 9, 269. [Google Scholar] [CrossRef]
- Tian, R.; Li, Y.; Bai, J. Hierarchical assembled nanomaterial paper based analytical devices for simultaneously electrochemical detection of microRNAs. Anal. Chim. Acta 2019, 1058, 89–96. [Google Scholar] [CrossRef]
- Wu, Y.; Fu, C.; Shi, W.; Chen, J. Recent advances in catalytic hairpin assembly signal amplification-based sensing strategies for microRNA detection. Talanta 2021, 235, 122735. [Google Scholar] [CrossRef]
- Wang, H.; Jian, Y.; Kong, Q.; Liu, H.; Lan, F.; Liang, L.; Ge, S.; Yu, J. Ultrasensitive electrochemical paper-based biosensor for microRNA via strand displacement reaction and metal-organic frameworks. Sens. Actuators, B 2018, 257, 561-569.
- Feng, S.; Mo, K.; Song, X. 3D printed microfluidic chip integrated with nanointerferometer for multiplex detection of foodborne pathogens. AIP Adv. 2024, 14, 6. [Google Scholar] [CrossRef]
- Zhao, Y.-L.; Chen, Q.; Lv, J.; Xu, M.-M.; Zhang, X.; Li, J.-R. Specific sensing of antibiotics with metal-organic frameworks based dual sensor system. Nano Res. 2022, 7, 6430–6437. [Google Scholar] [CrossRef]
- Lu, X.; Lu, W.; Hua, D. A novel SERS-lateral flow assay (LFA) tray for monitoring of miR-155-5p during pyroptosis in breast cancer cells. Anal. Methods 2024. [Google Scholar] [CrossRef] [PubMed]
- Javani, A.; Javadi-Zarnaghi, F.; Rasaee, M.J. A multiplex protein-free lateral flow assay for detection of microRNAs based on unmodified molecular beacons. Anal. Biochem. 2017, 537, 99–105. [Google Scholar] [CrossRef]
- Zhang, J.; Tang, L.; Yu, Q.; Qiu, W.; Li, K.; Cheng, L.; Zhang, T.; Qian, L.; Zhang, X.; Liu, G. Gold-platinum nanoflowers as colored and catalytic labels for ultrasensitive lateral flow MicroRNA-21 assay. Sens. Actuators, B 2021, 344, 130325.
- Dong, T.; Yin, R.; Yu, Q.; Qiu, W.; Li, K.; Qian, L.; Li, H.; Shen, B.; Liu, G. Sensitive detection of microRNA-21 in cancer cells and human serum with Au@ Si nanocomposite and lateral flow assay. Anal. Chim. Acta 2021, 1147, 56–63. [Google Scholar] [CrossRef]
- Wang, W.; Nie, A.; Lu, Z.; Li, J.; Shu, M.; Han, H. Catalytic hairpin assembly-assisted lateral flow assay for visual determination of microRNA-21 using gold nanoparticles. Microchim. Acta 2019, 186, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Liu, X.; Wang, L.; Yang, H.; Zhang, X.; Zhu, C.; Wang, W.; Yan, L.; Li, B. Improvement in detection limit for lateral flow assay of biomacromolecules by test-zone pre-enrichment. Sci. Rep. 2020, 1, 9604. [Google Scholar] [CrossRef]
- Storhoff, J.J.; Elghanian, R.; Mucic, R.C.; Mirkin, C.A.; Letsinger, R.L. One-pot colorimetric differentiation of polynucleotides with single base imperfections using gold nanoparticle probes. J. Am. Chem. Soc. 1998, 9, 1959–1964. [Google Scholar] [CrossRef]
- Hao, Y.; Li, Y.; Song, L.; Deng, Z. Flash synthesis of spherical nucleic acids with record DNA density. J. Am. Chem. Soc. 2021, 8, 3065–3069. [Google Scholar] [CrossRef]
- Gao, X.; Xu, H.; Baloda, M.; Gurung, A.S.; Xu, L.-P.; Wang, T.; Zhang, X.; Liu, G. Visual detection of microRNA with lateral flow nucleic acid biosensor. Biosens. Bioelectron. 2014, 54, 578–584. [Google Scholar] [CrossRef] [PubMed]
- Ding, Q.; Qiu, W.; Sun, C.; Ren, H.; Liu, G. Comparison of DNA-Gold Nanoparticle Conjugation Methods: Application in Lateral Flow Nucleic Acid Biosensors. Molecules 2023, 28, 11. [Google Scholar] [CrossRef]
- Wu, S.; Yu, W.; Fu, X.; Yu, X.; Ye, Z.; Zhang, M.; Qiu, Y.; Ma, B. Advances in Virus Detection Techniques Based on Recombinant Polymerase Amplification. Molecules 2024, 29, 20. [Google Scholar] [CrossRef] [PubMed]
- Hu, S.; Niu, L.; Luo, L.; Song, X.; Sun, J.; Liu, Q. Rapid, Sensitive Detection of Bartonella quintana by Loop-Mediated Isothermal Amplification of the groEL Gene. Int. J. Mol. Sci. 2016, 17, 12. [Google Scholar] [CrossRef]
- Mahfouz, M. Revolutionizing Point-of-Care Diagnostics via CRISPR Systems. ACS Synth. Biol. 2024, 2, 411–412. [Google Scholar] [CrossRef] [PubMed]
- Guo, H.; Chen, J.; Feng, Y.; Dai, Z. A Simple and Robust Exponential Amplification Reaction (EXPAR)-Based Hairpin Template (exp-Hairpin) for Highly Specific, Sensitive, and Universal MicroRNA Detection. Anal. Chem. 2024, 6, 2643–2650. [Google Scholar] [CrossRef]
- Reid, M.S.; Le, X.C.; Zhang, H. Exponential Isothermal Amplification of Nucleic Acids and Assays for Proteins, Cells, Small Molecules, and Enzyme Activities: An EXPAR Example. Angew. Chem., Int. Ed. Engl. 2018, 57, 37, 11856-11866.





| Name | Sequence (5'-3') | |
|---|---|---|
| miR-122 | UGGAGUGUGACAAUGGUGUUUG | |
| Thiolated detection DNA probe (Det-DNA) | thiol-CCCCCCAAACACCATT | |
| Biotinylated capture DNA probe (Cap-DNA) | GTCACACTCCACCCCC/Biotin | |
| Biotinylated control DNA probe (Con-DNA) | Biotin/AATGGTGTTTGGGGGG | |
| random miRNA | UUGUACUACACAAAAGUACUG | |
| Single-base mismatched miRNA | UGGAGCGUGACAAUGGUGUUUG | |
| Double-base mis-matched miRNA | UGGAGCGUGACAAUAGUGUUUG | |
| Triple-base mismatched miRNA | UGGAGCGUGACAAUAGUGUUCG |
| Serum sample | Added(pM) | Found(pM) | Recovery(%) | RSD(1/43) |
|---|---|---|---|---|
| 1 | 5 | 4.76 | 95.2 | 0.98 |
| 2 | 50 | 50.79 | 101.6 | 0.05 |
| 3 | 100 | 99.83 | 99.8 | 0.08 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).