Submitted:
02 September 2024
Posted:
09 September 2024
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Materials and Methods
2.1. BCoV Spike (BCoV/S) and Host Receptor Protein Structure Prediction
2.2. Mapping the BCoV-Spike Protein Domains
2.3. Molecular Docking with CDOCKER
2.4. Molecular Docking to Study the Protein-Protein Interaction
2.5. Bovine Cell Lines and BCoV Isolates
2.6. The Next Generation Sequencing (NGS)
2.7. The RNAs Extraction and the Quantitative Real-Time PCR (qRT-PCR)
2.8. Statistical Analysis
3. Results
3.1. The Homology Modelling for the BCoV-Spike and the Potential Host Cell Receptor Proteins
3.2. The Differential Genes Expression Profiles of Some Host Cell Receptors in BCoV/Ent and BCoV/Resp Infected Cells In-Vitro
3.3. Identifcation of teh BCoV Spikeglycoprotein Structural Domains
3.4. Docking of the Bovine Neu5,9Ac2 with the BCoV-S Protein
3.5. The interaction Interface between the BCoV Spike Glycoprotein and the Bovine ACE2.
3.6. The Proposed Model for the Interactions between the Bovine NRP1 and the BCoV/S and the Conformation of the NRP1 Expression Levels in Some Bovine Cell Lines Infected with BCoV
3.7. The Proposed Model of the Interaction between the BCoV/S Proteins and the Bovine Type-I Membrane Protein Receptor Carcinoembryonic Antigen-Related Cell Adhesion Molecule 1 (CEACAM-1) and the Confirmation of the Bovine CECAM1 during BCoV Infection in Bovine Cell Lines
3.8. The Proposed Model for the BCoV/S Glycoprotein Interaction with the Bovine Aminopeptidase N (APN) and the Conformation of the Expression Levels of the APN Genes during BCoV Infection in Some Bovine Cell Lines
3.9. The Proposed Model for the Interaction between the BCoV/S Glycoprotein with the Bovine Dipeptidyl Peptidase 4 (DPP4) and the Confirmation of the Expression Levels of the DPP4 during BCoV Infection in Some Bovine Cell Lines
3.10. The Proposed Model of the Interaction between the BCoV/S Glycoprotein with the Bovine AXL Protein and the Confirmation of the Bovine AXL Protein Expression Levels in Some Bovine Cell Lines Infected with BCoV Isolates
3.11. The Proposed Model of the Interaction between the Heparan Sulfate (HSPG2) and the BCoV/S Glycoprotein and the Confirmation of the HSPG2 Expression during BCoV Infection in Some Bovine Cell Lines
3.12. The Proposed Model for the Putative Interaction between The bovine Host Cell Furin Enzyme and the BCoV/S Glycoprotein and Mapping the Putative Furin Cleavage Sites in the BCoV-S Glycoproteins
3.13. The Putative Model for the TMPRSS2 Docking with the BCoV/S Glycoprotein and the Conformation of the TMPRSS2 Expression Levels during BCoV Infection in Some Bovine Cell Lines
3.14. A Proposed Putative Model for the Cathepsin-L (CTS-L) Docking with the BCoV/S and the Confirmation of the Cathepsin-L Expression Levels during BCoV Infection in Bovine Cells
3.15. The Proposed Model of the Neu5,9Ac2 Docking with the BCoV Haemagglutinin Esterase (BCoV-HE) Protein
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Data Availability Statement
Conflicts of Interest
References
- Masters, P.S., The molecular biology of coronaviruses. Adv Virus Res, 2006. 66: p. 193-292. [CrossRef]
- Wild, J.R., et al., Neuropilins: expression and roles in the epithelium. Int J Exp Pathol, 2012. 93(2): p. 81-103. [CrossRef]
- Nassar, A., et al., A Review of Human Coronaviruses’ Receptors: The Host-Cell Targets for the Crown Bearing Viruses. Molecules, 2021. 26(21). [CrossRef]
- Liao, Y., et al., Classification, replication, and transcription of Nidovirales. Front Microbiol, 2023. 14: p. 1291761. [CrossRef]
- Cavanagh, D., Nidovirales: a new order comprising Coronaviridae and Arteriviridae. Arch Virol, 1997. 142(3): p. 629-33.
- Brian, D.A. and R.S. Baric, Coronavirus genome structure and replication. Curr Top Microbiol Immunol, 2005. 287: p. 1-30.
- Lang, Y., et al., Coronavirus hemagglutinin-esterase and spike proteins coevolve for functional balance and optimal virion avidity. Proc Natl Acad Sci U S A, 2020. 117(41): p. 25759-25770. [CrossRef]
- Carlos, A.J., et al., The chaperone GRP78 is a host auxiliary factor for SARS-CoV-2 and GRP78 depleting antibody blocks viral entry and infection. J Biol Chem, 2021. 296: p. 100759.
- Jackson, C.B., et al., Mechanisms of SARS-CoV-2 entry into cells. Nat Rev Mol Cell Biol, 2022. 23(1): p. 3-20.
- Alnaeem, A., et al., The dipeptidyl peptidase-4 expression in some MERS-CoV naturally infected dromedary camels in Saudi Arabia 2018-2019. Virusdisease, 2020. 31(2): p. 200-203.
- Widagdo, W., et al., Host Determinants of MERS-CoV Transmission and Pathogenesis. Viruses, 2019. 11(3). [CrossRef]
- Delmas, B., et al., Aminopeptidase N is a major receptor for the entero-pathogenic coronavirus TGEV. Nature, 1992. 357(6377): p. 417-20.
- Nakagaki, K., K. Nakagaki, and F. Taguchi, Receptor-independent spread of a highly neurotropic murine coronavirus JHMV strain from initially infected microglial cells in mixed neural cultures. J Virol, 2005. 79(10): p. 6102-10. [CrossRef]
- Kemmish, H., M. Fasnacht, and L. Yan, Fully automated antibody structure prediction using BIOVIA tools: Validation study. PLoS One, 2017. 12(5): p. e0177923. [CrossRef]
- Vyas, V.K., et al., Homology modeling a fast tool for drug discovery: current perspectives. Indian J Pharm Sci, 2012. 74(1): p. 1-17.. [CrossRef]
- Takeda-Shitaka, M., et al., Protein structure prediction in structure based drug design. Curr Med Chem, 2004. 11(5): p. 551-8. [CrossRef]
- Zhao, M.M., et al., Novel cleavage sites identified in SARS-CoV-2 spike protein reveal mechanism for cathepsin L-facilitated viral infection and treatment strategies. Cell Discov, 2022. 8(1): p. 53.
- Hoffmann, M., et al., SARS-CoV-2 Cell Entry Depends on ACE2 and TMPRSS2 and Is Blocked by a Clinically Proven Protease Inhibitor. Cell, 2020. 181(2): p. 271-280 e8.
- Lubinski, B. and G.R. Whittaker, The SARS-CoV-2 furin cleavage site: natural selection or smoking gun? Lancet Microbe, 2023. 4(8): p. e570.
- Peacock, T.P., et al., The furin cleavage site in the SARS-CoV-2 spike protein is required for transmission in ferrets. Nat Microbiol, 2021. 6(7): p. 899-909.
- Takeda-Shitaka, M., et al., Evaluation of homology modeling of the severe acute respiratory syndrome (SARS) coronavirus main protease for structure based drug design. Chem Pharm Bull (Tokyo), 2004. 52(5): p. 643-5. [CrossRef]
- Ramachandran, G.N., C. Ramakrishnan, and V. Sasisekharan, Stereochemistry of polypeptide chain configurations. J Mol Biol, 1963. 7: p. 95-9. [CrossRef]
- Blum, M., et al., The InterPro protein families and domains database: 20 years on. Nucleic Acids Res, 2021. 49(D1): p. D344-d354. [CrossRef]
- Etzold, T. and P. Argos, SRS--an indexing and retrieval tool for flat file data libraries. Comput Appl Biosci, 1993. 9(1): p. 49-57. [CrossRef]
- Apweiler, R., et al., The InterPro database, an integrated documentation resource for protein families, domains and functional sites. Nucleic Acids Res, 2001. 29(1): p. 37-40. [CrossRef]
- Ding, X., et al., Accelerated CDOCKER with GPUs, Parallel Simulated Annealing, and Fast Fourier Transforms. J Chem Theory Comput, 2020. 16(6): p. 3910-3919. [CrossRef]
- Gagnon, J.K., S.M. Law, and C.L. Brooks, 3rd, Flexible CDOCKER: Development and application of a pseudo-explicit structure-based docking method within CHARMM. J Comput Chem, 2016. 37(8): p. 753-62. [CrossRef]
- Pierce, B.G., Y. Hourai, and Z. Weng, Accelerating protein docking in ZDOCK using an advanced 3D convolution library. PLoS One, 2011. 6(9): p. e24657. [CrossRef]
- McNulty, M.S., et al., Coronavirus infection of the bovine respiratory tract. Vet Microbiol, 1984. 9(5): p. 425-34. [CrossRef]
- Workman, A.M., et al., Recent Emergence of Bovine Coronavirus Variants with Mutations in the Hemagglutinin-Esterase Receptor Binding Domain in U.S. Cattle. Viruses, 2022. 14(10). [CrossRef]
- Rozen, S. and H. Skaletsky, Primer3 on the WWW for general users and for biologist programmers. Methods Mol Biol, 2000. 132: p. 365-86.
- Livak, K.J. and T.D. Schmittgen, Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods, 2001. 25(4): p. 402-8. [CrossRef]
- Qian, Z., et al., Identification of the Receptor-Binding Domain of the Spike Glycoprotein of Human Betacoronavirus HKU1. J Virol, 2015. 89(17): p. 8816-27. [CrossRef]
- Peng, G., et al., Crystal structure of bovine coronavirus spike protein lectin domain. J Biol Chem, 2012. 287(50): p. 41931-8. [CrossRef]
- Kumar, A., et al., Identification of phytochemical inhibitors against main protease of COVID-19 using molecular modeling approaches. J Biomol Struct Dyn, 2021. 39(10): p. 3760-3770. [CrossRef]
- Cheng, Y.R., et al., Cell Entry of Animal Coronaviruses. Viruses, 2021. 13(10). [CrossRef]
- Burnett, F.N., et al., SARS-CoV-2 Spike Protein Intensifies Cerebrovascular Complications in Diabetic hACE2 Mice through RAAS and TLR Signaling Activation. Int J Mol Sci, 2023. 24(22). [CrossRef]
- Millet, J.K. and G.R. Whittaker, Host cell proteases: Critical determinants of coronavirus tropism and pathogenesis. Virus Res, 2015. 202: p. 120-34. [CrossRef]
- Shah, A.U. and M.G. Hemida, The Potential Roles of Host Cell miRNAs in Fine-Tuning Bovine Coronavirus (BCoV) Molecular Pathogenesis, Tissue Tropism, and Immune Regulation. Microorganisms, 2024. 12(5). [CrossRef]
- Susi, P., Special Issue: Virus Receptors and Viral Tropism. Viruses, 2021. 14(1). [CrossRef]
- Everest, H., et al., Known Cellular and Receptor Interactions of Animal and Human Coronaviruses: A Review. Viruses, 2022. 14(2). [CrossRef]
- Takeda, M., Proteolytic activation of SARS-CoV-2 spike protein. Microbiol Immunol, 2022. 66(1): p. 15-23. [CrossRef]
- Malik, Y.A., Properties of Coronavirus and SARS-CoV-2. Malays J Pathol, 2020. 42(1): p. 3-11.
- Belouzard, S., V.C. Chu, and G.R. Whittaker, Activation of the SARS coronavirus spike protein via sequential proteolytic cleavage at two distinct sites. Proc Natl Acad Sci U S A, 2009. 106(14): p. 5871-6. [CrossRef]
- Walls, A.C., et al., Tectonic conformational changes of a coronavirus spike glycoprotein promote membrane fusion. Proc Natl Acad Sci U S A, 2017. 114(42): p. 11157-11162. [CrossRef]
- Xia, S., et al., Inhibition of SARS-CoV-2 (previously 2019-nCoV) infection by a highly potent pan-coronavirus fusion inhibitor targeting its spike protein that harbors a high capacity to mediate membrane fusion. Cell Res, 2020. 30(4): p. 343-355.
- Xia, S., et al., The role of furin cleavage site in SARS-CoV-2 spike protein-mediated membrane fusion in the presence or absence of trypsin. Signal Transduct Target Ther, 2020. 5(1): p. 92.
- Bahoussi, A.N., et al., Evolutionary adaptation of bovine coronavirus (BCoV): Screening of natural recombinations across the complete genomes. J Basic Microbiol, 2023. 63(5): p. 519-529. [CrossRef]
- Kim, C.H., SARS-CoV-2 Evolutionary Adaptation toward Host Entry and Recognition of Receptor O-Acetyl Sialylation in Virus-Host Interaction. Int J Mol Sci, 2020. 21(12). [CrossRef]
- Tortorici, M.A., et al., Structural basis for human coronavirus attachment to sialic acid receptors. Nat Struct Mol Biol, 2019. 26(6): p. 481-489. [CrossRef]
- Scialo, F., et al., ACE2: The Major Cell Entry Receptor for SARS-CoV-2. Lung, 2020. 198(6): p. 867-877.
- Gupta, A., et al., Recent Developments and Future Perspectives of Vaccines and Therapeutic Agents against SARS-CoV2 Using the BCOV_S1_CTD of the S Protein. Viruses, 2023. 15(6). [CrossRef]
- Rodriguez, J.H. and A. Gupta, Contact residue contributions to interaction energies between SARS-CoV-1 spike proteins and human ACE2 receptors. Sci Rep, 2021. 11(1): p. 1156.
- Davies, J., et al., Neuropilin-1 as a new potential SARS-CoV-2 infection mediator implicated in the neurologic features and central nervous system involvement of COVID-19. Mol Med Rep, 2020. 22(5): p. 4221-4226. [CrossRef]
- Cantuti-Castelvetri, L., et al., Neuropilin-1 facilitates SARS-CoV-2 cell entry and infectivity. Science, 2020. 370(6518): p. 856-860. [CrossRef]
- Pal, D., et al., Mutating novel interaction sites in NRP1 reduces SARS-CoV-2 spike protein internalization. iScience, 2023. 26(4): p. 106274.
- Miura, H.S., K. Nakagaki, and F. Taguchi, N-terminal domain of the murine coronavirus receptor CEACAM1 is responsible for fusogenic activation and conformational changes of the spike protein. J Virol, 2004. 78(1): p. 216-23. [CrossRef]
- Taylor, M.E. and K. Drickamer, Mammalian sugar-binding receptors: known functions and unexplored roles. Febs j, 2019. 286(10): p. 1800-1814. [CrossRef]
- Amin, S.A., N. Adhikari, and T. Jha, Design of Aminopeptidase N Inhibitors as Anti-cancer Agents. J Med Chem, 2018. 61(15): p. 6468-6490. [CrossRef]
- Yang, Y.L., et al., Aminopeptidase N Is an Entry Co-factor Triggering Porcine Deltacoronavirus Entry via an Endocytotic Pathway. J Virol, 2021. 95(21): p. e0094421. [CrossRef]
- Liu, Y., et al., Roles of Two Major Domains of the Porcine Deltacoronavirus S1 Subunit in Receptor Binding and Neutralization. J Virol, 2021. 95(24): p. e0111821. [CrossRef]
- Wang, B., et al., Porcine Deltacoronavirus Engages the Transmissible Gastroenteritis Virus Functional Receptor Porcine Aminopeptidase N for Infectious Cellular Entry. J Virol, 2018. 92(12). [CrossRef]
- Yin, L., et al., Aminopeptidase N Expression, Not Interferon Responses, Determines the Intestinal Segmental Tropism of Porcine Deltacoronavirus. J Virol, 2020. 94(14). [CrossRef]
- Lambeir, A.M., et al., Dipeptidyl-peptidase IV from bench to bedside: an update on structural properties, functions, and clinical aspects of the enzyme DPP IV. Crit Rev Clin Lab Sci, 2003. 40(3): p. 209-94. [CrossRef]
- Roy, A.N., et al., Unraveling DPP4 Receptor Interactions with SARS-CoV-2 Variants and MERS-CoV: Insights into Pulmonary Disorders via Immunoinformatics and Molecular Dynamics. Viruses, 2023. 15(10). [CrossRef]
- Wang, Q., L. Sun, and S. Jiang, Potential recombination between SARS-CoV-2 and MERS-CoV: calls for the development of Pan-CoV vaccines. Signal Transduct Target Ther, 2023. 8(1): p. 122.
- Lu, G., et al., Molecular basis of binding between novel human coronavirus MERS-CoV and its receptor CD26. Nature, 2013. 500(7461): p. 227-31.
- Bohan, D., et al., Phosphatidylserine Receptors Enhance SARS-CoV-2 Infection: AXL as a Therapeutic Target for COVID-19. bioRxiv, 2021. [CrossRef]
- Galindo-Hernández, O. and J.L. Vique-Sánchez, AXL inhibitors selected by molecular docking: Option for reducing SARS-CoV-2 entry into cells. Acta Pharm, 2022. 72(3): p. 329-343. [CrossRef]
- Fang, Q., et al., Verifying AXL and putative proteins as SARS-CoV-2 receptors by DnaE intein-based rapid cell-cell fusion assay. J Med Virol, 2023. 95(7): p. e28953. [CrossRef]
- Milewska, A., et al., Human coronavirus NL63 utilizes heparan sulfate proteoglycans for attachment to target cells. J Virol, 2014. 88(22): p. 13221-30. [CrossRef]
- Kearns, F.L., et al., Spike-heparan sulfate interactions in SARS-CoV-2 infection. Curr Opin Struct Biol, 2022. 76: p. 102439. [CrossRef]
- Clausen, T.M., et al., SARS-CoV-2 Infection Depends on Cellular Heparan Sulfate and ACE2. Cell, 2020. 183(4): p. 1043-1057.e15.
- Bermejo-Jambrina, M., et al., Infection and transmission of SARS-CoV-2 depend on heparan sulfate proteoglycans. Embo j, 2021. 40(20): p. e106765. [CrossRef]
- Jaimes, J.A., J.K. Millet, and G.R. Whittaker, Proteolytic Cleavage of the SARS-CoV-2 Spike Protein and the Role of the Novel S1/S2 Site. iScience, 2020. 23(6): p. 101212.
- Hulswit, R.J., C.A. de Haan, and B.J. Bosch, Coronavirus Spike Protein and Tropism Changes. Adv Virus Res, 2016. 96: p. 29-57. [CrossRef]
- Whittaker, G.R., SARS-CoV-2 spike and its adaptable furin cleavage site. Lancet Microbe, 2021. 2(10): p. e488-e489.
- Vardhan, S. and S.K. Sahoo, Virtual screening by targeting proteolytic sites of furin and TMPRSS2 to propose potential compounds obstructing the entry of SARS-CoV-2 virus into human host cells. J Tradit Complement Med, 2022. 12(1): p. 6-15. [CrossRef]
- Shah, A., Hemida MG, The dual actions of the host miRNA-16a in restricting Bovine coronavirus (BCoV) replication through targeting host cell Furin and in enhancing the host immune response. bioRxiv preprint 2024.
- Bertram, S., et al., TMPRSS2 activates the human coronavirus 229E for cathepsin-independent host cell entry and is expressed in viral target cells in the respiratory epithelium. J Virol, 2013. 87(11): p. 6150-60. [CrossRef]
- Shirato, K., M. Kawase, and S. Matsuyama, Middle East respiratory syndrome coronavirus infection mediated by the transmembrane serine protease TMPRSS2. J Virol, 2013. 87(23): p. 12552-61. [CrossRef]
- McCallum, M., et al., Human coronavirus HKU1 recognition of the TMPRSS2 host receptor. Cell, 2024. [CrossRef]
- Saunders, N., et al., TMPRSS2 is a functional receptor for human coronavirus HKU1. Nature, 2023. 624(7990): p. 207-214. [CrossRef]
- Zhang, Y., et al., Transmembrane serine protease TMPRSS2 implicated in SARS-CoV-2 infection is autoactivated intracellularly and requires N-glycosylation for regulation. J Biol Chem, 2022. 298(12): p. 102643.
- Fraser, B.J., et al., Structure and activity of human TMPRSS2 protease implicated in SARS-CoV-2 activation. Nat Chem Biol, 2022. 18(9): p. 963-971.
- Bestle, D., et al., TMPRSS2 and furin are both essential for proteolytic activation of SARS-CoV-2 in human airway cells. Life Sci Alliance, 2020. 3(9).
- Zhang, L., et al., COVID-19 receptor and malignant cancers: Association of CTSL expression with susceptibility to SARS-CoV-2. Int J Biol Sci, 2022. 18(6): p. 2362-2371.

















| Bovine Genes | Forward Primer (5′ to 3′) | Reverse Primer (5′ to 3′) |
|---|---|---|
| ACE2 | GCTGTCGGGGAAATCATGTC | TCTCTCGCTTCATCTCCCAC |
| Furin | CGAGAAGAACCACCCAGACT | CTACGCCACAGACACCATTG |
| TMPRSS2 | CCTTCTTAGCAGCCCAGAGT | CATCTTCAAGGGAGGCCAGA |
| NRP1 | CCAGAAGCCAGAGGAGTACG | GCCTTTTCCGATTTCACCCT |
| CEACAM1 | TTCTTCTGCTTGCCCACAAC | TCCTTTGTAACGAGCAGGGT |
| DPP4 | AGAGACGCAGACCATGAAGA | TCGGCTAGAGTGTAGGTTCTG |
| AXL | TCTCAGATGCGGGATGGTAC | AGCTCAGGTTGAAGGGAGTG |
| APN | AGAGTGGGACTTTGCTTGGA | TGGCAATGCTGGTAATGGTG |
| HSPG2 | GTTGTCAGCGTGGTGTTCAT | GAGAGGTGACGTAGGAGGC |
| Cathepsin-L | CTTCGATTCCTCCATCCGTG | TCTATGAAGCCACCGTGACA |
| β-actin | CAAGTACCCCATTGAGCACG | GTCATCTTCTCACGGTTGGC |
| Homology model | Dope Score | Verify Score | Verify Expected High Score | Verify Expected Low Score |
|---|---|---|---|---|
| BCoV-Spike | -135770 | 476.141 | 561.414 | 252.636 |
| ACE2 | -94345 | 308.35 | 358.11 | 161.153 |
| Furin | -53696 | 227.99 | 216.48 | 97.4159 |
| TMPRSS2 | -34507 | 142.08 | 152.573 | 68.6579 |
| Cathepsin-L | -33161 | 132.18 | 144.31 | 64.94 |
| NRP1 | -25920 | 125.32 | 159.001 | 71.5506 |
| DPP4 | -90256 | 308.11 | 333.627 | 150.132 |
| APN | -118318 | 385.36 | 415.465 | 186.959 |
| CEACAM-1 | -10424 | 32.41 | 58.3052 | 26.2373 |
| AXL | -35499 | 135.46 | 137.42 | 61.84 |
| Complex (Best Pose) |
ZDock score | E_R Dock Score | Total hydrogen bonds | Total Pi bonds | Salt Bridge |
|---|---|---|---|---|---|
| BCoV/S-ACE2 | 22.58 | -12.26 | 7 | 28 | 0 |
| BCoV/S-NRP1 | 26 | -21.22 | 29 | 9 | 0 |
| BCoV/S-CEACAM-1 | 16.8 | -6.29 | 12 | 9 | 1 |
| BCoV/S-APN | 17.6 | -2.95 | 19 | 2 | 1 |
| BCoV/S-DPP4 | 22.44 | -6.23 | 20 | 9 | 1 |
| BCoV/S-AXL | 17.56 | -13.68 | 21 | 9 | 0 |
| BCoV/S-Furin | 16.6 | -13.14 | 30 | 1 | 0 |
| BCoV/S-TMPRSS2 | 20 | 0.641 | 15 | 6 | 0 |
| BCoV/S-CTS-L | 19.84 | -16.45 | 15 | 2 | 0 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).