Submitted:
07 August 2024
Posted:
08 August 2024
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Materials and Methods
2.1. Materials and Reagents
2.2. Cell Cycle Assay
2.3. Apoptosis Detection
2.4. Assessment of the Mitochondrial Membrane Potential
2.5. Intracellular Calcium Ion Concentration Assay
2.6. Cell Autophagy Detection
2.7. Transcriptomic Data Analysis
2.8. Real-Time Fluorescent Quantitative PCR
3. Results
3.1. Effect of Corilagin on the A2780 Cell Cycle in Ovarian Cancer
3.2. Effect of Corilagin on Apoptosis of Ovarian Cancer A2780 Cells
3.3. Effect of Corilagin on the Membrane Potential of Mitochondria in Ovarian Cancer A2780 Cells
3.4. Effect of Corilagin on Intracellular Calcium Ion Concentration in Ovarian Cancer A2780 Cells
3.5. Effect of Corilagin on Autophagy in Ovarian Cancer A2780 Cells
3.6. Effect of Corilagin on A2780 Cell Transcriptome Gene Sequencing
3.7. Effect of Corilagin on Gene Expression in Ovarian Cancer A2780 Cells
4. Discussion
5. Conclusion
References
- Gogineni, V.; Morand, S.; Staats, H.; Royfman, R.; Devanaboyina, M.; Einloth, K.; Dever, D.; Stanbery, L.; Aaron, P.; Manning, L.; et al. Current Ovarian Cancer Maintenance Strategies and Promising New Developments. J. Cancer 2021, 12, 38–53. [Google Scholar] [CrossRef] [PubMed]
- Moufarrij, S.; Dandapani, M.; Arthofer, E.; Gomez, S.; Srivastava, A.; Lopez-Acevedo, M.; Villagra, A.; Chiappinelli, K.B. Epigenetic therapy for ovarian cancer: promise and progress. Clin. Epigenetics 2019, 11, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Stewart, C.; Ralyea, C.; Lockwood, S. Ovarian Cancer: An Integrated Review. Semin. Oncol. Nurs. 2019, 35, 151–156. [Google Scholar] [CrossRef]
- Zhang, Z.; Sun, Z.; Ye, Y.; Wang, X. Determination of Main Compositions in Phyllanthus Urinaria and its Effects on Cyp450 in Rats. Curr. Pharm. Anal. 2020, 16, 520–528. [Google Scholar] [CrossRef]
- B, N.L.A. , et al., Corilagin from longan seed: Identification, quantification, and synergistic cytotoxicity on SKOv3ip and hey cells with ginsenoside Rh2 and 5-fluorouracil - ScienceDirect. Food and Chemical Toxicology 2018, 119, 133–140. [Google Scholar]
- Song, Z.; Chen, T.; Wang, S.; Shen, C.; Li, H.; Li, A.; Li, P.; Ma, Y.; Chen, Z.; Li, Y. Large-scale preparation of two minor polar polyphenols from Phyllanthus emblica Linn. by macroporous resin column chromatography and high-temperature preparative high-speed counter-current chromatography. J. Sep. Sci. 2022, 45, 3923–3929. [Google Scholar] [CrossRef] [PubMed]
- Li, S.; Li, X.; Yang, X.; Lei, Y.; He, M.; Xiang, X.; Wu, Q.; Liu, H.; Wang, J.; Wang, Q. Corilagin enhances the anti-tumor activity of 5-FU by downregulating the expression of GRP 78. Sci. Rep. 2023, 13, 1–14. [Google Scholar] [CrossRef]
- Wang, Y.; Li, B.; Liu, G.; Han, Q.; Diao, Y.; Liu, J. Corilagin attenuates intestinal ischemia/reperfusion injury in mice by inhibiting ferritinophagy-mediated ferroptosis through disrupting NCOA4-ferritin interaction. Life Sci. 2023, 334, 122176. [Google Scholar] [CrossRef] [PubMed]
- Liu, F.-C.; Liao, C.-C.; Lee, H.-C.; Chou, A.-H.; Yu, H.-P. Effects of Corilagin on Lipopolysaccharide-Induced Acute Lung Injury via Regulation of NADPH Oxidase 2 and ERK/NF-κB Signaling Pathways in a Mouse Model. Biology 2022, 11, 1058. [Google Scholar] [CrossRef]
- Wu, M.; Jiang, Y.; Wang, J.; Luo, T.; Yi, Y.; Wang, H.; Wang, L. The Effect and Mechanism of Corilagin from Euryale Ferox Salisb Shell on LPS-Induced Inflammation in Raw264.7 Cells. Foods 2023, 12, 979. [Google Scholar] [CrossRef]
- Jia, L.; Jin, H.; Zhou, J.; Chen, L.; Lu, Y.; Ming, Y.; Yu, Y. A potential anti-tumor herbal medicine, Corilagin, inhibits ovarian cancer cell growth through blocking the TGF-β signaling pathways. BMC Complement. Altern. Med. 2013, 13, 33–33. [Google Scholar] [CrossRef] [PubMed]
- Jia, L.; Zhou, J.; Zhao, H.; Jin, H.; Lv, M.; Zhao, N.; Zheng, Z.; Lu, Y.; Ming, Y.; Yu, Y. Corilagin sensitizes epithelial ovarian cancer to chemotherapy by inhibiting Snail-glycolysis pathways. Oncol. Rep. 2017, 38, 2464–2470. [Google Scholar] [CrossRef] [PubMed]
- Attar, R.; Cincin, Z.B.; Bireller, E.S.; Cakmakoglu, B. Apoptotic and genomic effects of corilagin on SKOV3 ovarian cancer cell line. OncoTargets Ther. 2017, ume 10, 1941–1946. [Google Scholar] [CrossRef]
- Barboza, J.R.; et al. Cytotoxicity and Pro-Apoptotic, Antioxidant and Anti-Inflammatory Activities of Geopropolis Produced by the Stingless Bee Melipona fasciculata Smith. Biology 2020. [Google Scholar] [CrossRef]
- Tanaka, T.; Nonaka, G.-I.; Nishioka, I. Punicafolin, an ellagitannin from the leaves of Punica granatum. Phytochemistry 1985, 24, 2075–2078. [Google Scholar] [CrossRef]
- Kakiuchi, N.; Hattori, M.; Namba, T.; Nishizawa, M.; Yamagishi, T.; Okuda, T. Inhibitory Effect of Tannins on Reverse Transcriptase from RNA Tumor Virus. J. Nat. Prod. 1985, 48, 614–621. [Google Scholar] [CrossRef]
- Tong, Y.; Zhang, G.; Li, Y.; Xu, J.; Yuan, J.; Zhang, B.; Hu, T.; Song, G. Corilagin inhibits breast cancer growth via reactive oxygen species-dependent apoptosis and autophagy. J. Cell. Mol. Med. 2018, 22, 3795–3807. [Google Scholar] [CrossRef]
- Deng, Y.; Li, X.; Zheng, Z.; Huang, W.; Chen, L.; Tong, Q.; Ming, Y. Corilagin induces the apoptosis of hepatocellular carcinoma cells through the mitochondrial apoptotic and death receptor pathways. Oncol. Rep. 2018, 39, 2545–2552. [Google Scholar] [CrossRef]
- Liu, C.; Liu, H.; Huang, H.; Hao, J.; Lv, Y.; Zhang, J.; Ma, Y.; Wu, C.; Qin, R.; Yang, X. Corilagin induces laryngeal cancer antiproliferation and inhibits growth factor and cytokine signaling pathways in vitro and in vivo. J. Funct. Foods 2020, 69, 103947. [Google Scholar] [CrossRef]
- Zhang, L.; Jia, B.; Velu, P.; Wu, H. Corilagin induces apoptosis and inhibits HMBG1/PI3K/AKT signaling pathways in a rat model of gastric carcinogenesis induced by methylnitronitrosoguanidine. Environ. Toxicol. 2022, 37, 1222–1230. [Google Scholar] [CrossRef]
- Karimian, A.; Ahmadi, Y.; Yousefi, B. Multiple functions of p21 in cell cycle, apoptosis and transcriptional regulation after DNA damage. DNA Repair 2016, 42, 63–71. [Google Scholar] [CrossRef] [PubMed]
- Manousakis, E.; Miralles, C.M.; Esquerda, M.G.; Wright, R.H.G. CDKN1A/p21 in Breast Cancer: Part of the Problem, or Part of the Solution? Int. J. Mol. Sci. 2023, 24, 17488. [Google Scholar] [CrossRef]
- Shaikh, A.; Wesner, A.A.; Abuhattab, M.; Kutty, R.G.; Premnath, P. Cell cycle regulators and bone: development and regeneration. Cell Biosci. 2023, 13, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Mansilla, S.F.; De La Vega, M.B.; Calzetta, N.L.; Siri, S.O.; Gottifredi, V. CDK-Independent and PCNA-Dependent Functions of p21 in DNA Replication. Genes 2020, 11, 593. [Google Scholar] [CrossRef]
- Kowalski, S.; Karska, J.; Łapińska, Z.; Hetnał, B.; Saczko, J.; Kulbacka, J. An overview of programmed cell death: Apoptosis and pyroptosis—Mechanisms, differences, and significance in organism physiology and pathophysiology. J. Cell. Biochem. 2023, 124, 765–784. [Google Scholar] [CrossRef] [PubMed]
- Liu, W.; Jin, W.; Zhu, S.; Chen, Y.; Liu, B. Targeting regulated cell death (RCD) with small-molecule compounds in cancer therapy: A revisited review of apoptosis, autophagy-dependent cell death and necroptosis. Drug Discov. Today 2021, 27, 612–625. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.; Chen, Y.; Wu, J.H.; Ren, Y.; Liu, B.; Zhang, Y.; Yu, H. Targeting regulated cell death with plant natural compounds for cancer therapy: A revisited review of apoptosis, autophagy-dependent cell death, and necroptosis. Phytotherapy Res. 2023, 37, 1488–1525. [Google Scholar] [CrossRef] [PubMed]
- Izadi, M.; Ali, T.A.; Pourkarimi, E. Over Fifty Years of Life, Death, and Cannibalism: A Historical Recollection of Apoptosis and Autophagy. Int. J. Mol. Sci. 2021, 22, 12466. [Google Scholar] [CrossRef]
- Jiajia, et al., Corilagin induces apoptosis, autophagy and ROS generation in gastric cancer cells in?vitro. International Journal of Molecular Medicine. 2018.
- Rotimi, D.E.; Singh, S.K. Interaction between apoptosis and autophagy in testicular function. Andrologia 2022, 54, e14602. [Google Scholar] [CrossRef]
- Zheng, B.; Zhou, X.; Hu, X.; Chen, Y.; Xie, J.; Yu, Q. Advances in the regulation of natural polysaccharides on human health: The role of apoptosis/autophagy pathway. Crit. Rev. Food Sci. Nutr. 2021, 63, 3931–3942. [Google Scholar] [CrossRef]
- Buzun, K.; Gornowicz, A.; Lesyk, R.; Bielawski, K.; Bielawska, A. Autophagy Modulators in Cancer Therapy. Int. J. Mol. Sci. 2021, 22, 5804. [Google Scholar] [CrossRef] [PubMed]
- Tran, S.; Fairlie, W.D.; Lee, E.F. BECLIN1: Protein Structure, Function and Regulation. Cells 2021, 10, 1522. [Google Scholar] [CrossRef] [PubMed]
- Gao, Y.; Zhang, Y.; Li, J.; Zhang, H.; Li, X. Precise engineering of nanoassembled Corilagin small molecule into supramolecular nanoparticles for the treatment and care against cervical carcinoma. Process. Biochem. 2021, 106, 103–111. [Google Scholar] [CrossRef]
- Sponchioni, M.; Palmiero, U.C.; Moscatelli, D. Thermo-responsive polymers: Applications of smart materials in drug delivery and tissue engineering. Mater. Sci. Eng. C 2019, 102, 589–605. [Google Scholar] [CrossRef] [PubMed]
- Yang, H.; Liu, Z.; Song, Y.; Hu, C. Hyaluronic acid-functionalized bilosomes for targeted delivery of tripterine to inflamed area with enhancive therapy on arthritis. Drug Deliv. 2019, 26, 820–830. [Google Scholar] [CrossRef] [PubMed]








| Gene | Gene Forward primer (5’→3’) | Reverse primer (5’→3’) |
| P53 | GTTCCGAGAGCTGAATGAGG | TCTGAGTCAGGCCCTTCTGT |
| P21 | GACACCACTGGAGGGTGACT | CAGGTCCACATGGTCTTCCT |
| CYCLIND | AACTACCTGGACCGCTTCCT | CCACTTGAGCTTGTTCACCA |
| BAX | AAGAAGCTGAGCGAGTGTCT | GTTCTGATCAGTTCCGGCAC |
| BCL-2 | GCCTTCTTTGAGTTCGGTGG | CAAATCAAACAGAGGCCGCA |
| CASPEASE3 | ACTGGACTGTGGCATTGAGA | GCACAAAGCGACTGGATGAA |
| CASPASE9 | GCCCCATATGATCGAGGACA | CAGAAACGAAGCCAGCATGT |
| CYTOCHROME C | ATGAAGTGTTCCCAGTGCCA | CTCTCCCCAGATGATGCCTT |
| PERP | TGCCATCATTCTCATTGCAT | AACCCCAGTTGAACTCATGG |
| PUMA | GAGGAGGAACAGTGGGCC | GGAGTCCCATGATGAGATTGT |
| PI3K | AAACAAAGCGGAGAACCTATTG | TAATGACGCAATGCTTGACTTC |
| AKT | TGCACAAACGAGGGGAATATAT | CGTTCCTTGTAGCCAATAAAGG |
| MTOR | GAGATACGCTGTCATCCCTTTA | CTGTATTATTGACGGCATGCTC |
| BECLIN 1 | ATCTAAGGAGCTGCCGTTATAC | CTCCTCAGAGTTAAACTGGGTT |
| ATG13 | AGCTGGAAATATGGTGTCTTGA | CAGCAATGACAGTCTGTTGTAC |
| ATG8 | CTCGTTTAGTGAACCGTCAGAAT | AACCGGAACCCTTAAACATGT |
| β-ACTIN | CATCCGCAAAGACCTGTACG | CCTGCTTGCTGATCCACATC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).