Submitted:
31 July 2024
Posted:
31 July 2024
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Results
2.1. Isolation and Morphological Characterization of Henu3
2.2. Biological Characterization of Phage Henu3
2.3. Influence of Temperature, pH, and Ultraviolet on Phage Henu3 Stability
2.4. The Whole Genome Sequencing and Bioinformatics Analysis of Phage Henu3
2.5. Isolation of Phage-Resistant Bacteria
2.6. Phage-Resistant Strain Exhibits Increased Sensitivity to Antibiotics
2.7. Whole-Genome Re-Sequencing Analysis of Phage-Resistant Bacteria 0G10 and 2E1
3. Discussion
4. Materials and Methods
4.1. Isolation and Purification of Phage Henu3
4.2. Transmission Electron Microscopy (TEM)
4.3. Genomic Sequencing of Phage Henu3
4.4. Bioinformatics Analysis of the Whole Genome Sequence of Henu3
4.5. Optimal Multiplicity of Infection (MOI) for Phage Henu3
4.6. One-Step Growth Curve of Phage Henu3
4.7. Thermal, pH, and Ultraviolet Stability of Phage Henu3
4.8. Testing for Phage-Resistant Strains
4.9. Forward and Reverse Validation of Phage-Resistant Bacteria
4.10. Detection of Susceptibility of Phage-Resistant Bacteria to Various Antibiotics
4.11. Statistical Analysis
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Davies, J.; Davies, D. Origins and Evolution of Antibiotic Resistance. Microbiol. Mol. Biol. Rev. 2010, 74, 417–433. [Google Scholar] [CrossRef] [PubMed]
- Gagneux, S. Fitness cost of drug resistance inMycobacterium tuberculosis. Clin. Microbiol. Infect. 2009, 15, 66–68. [Google Scholar] [CrossRef] [PubMed]
- World Health, O., Global tuberculosis report 2023. World Health Organization: Geneva, 2023.
- Allué-Guardia, A.; Saranathan, R.; Chan, J.; Torrelles, J.B. Mycobacteriophages as Potential Therapeutic Agents against Drug-Resistant Tuberculosis. Int. J. Mol. Sci. 2021, 22, 735. [Google Scholar] [CrossRef] [PubMed]
- Espinosa-Pereiro, J.; Sánchez-Montalvá, A.; Aznar, M.L.; Espiau, M. MDR Tuberculosis Treatment. Medicina 2022, 58, 188. [Google Scholar] [CrossRef] [PubMed]
- Kelishomi, F.Z.; Khanjani, S.; Fardsanei, F.; Sarabi, H.S.; Nikkhahi, F.; Dehghani, B. Bacteriophages of Mycobacterium tuberculosis, their diversity, and potential therapeutic uses: a review. BMC Infect. Dis. 2022, 22, 1–14. [Google Scholar] [CrossRef] [PubMed]
- Sulakvelidze, A.; Alavidze, Z.; Morris, J.G., Jr. Bacteriophage therapy. Antimicrob Agents Chemother 2001, 45, (3), 649–59. [Google Scholar] [CrossRef]
- Harada, L.K.; Silva, E.C.; Campos, W.F.; Del Fiol, F.S.; Vila, M.; Dąbrowska, K.; Krylov, V.N.; Balcão, V.M. Biotechnological applications of bacteriophages: State of the art. Microbiol. Res. 2018, 212–213, 38–58. [Google Scholar] [CrossRef] [PubMed]
- Anand, T.; Virmani, N.; Kumar, S.; Mohanty, A.K.; Pavulraj, S.; Bera, B.C.; Vaid, R.K.; Ahlawat, U.; Tripathi, B. Phage therapy for treatment of virulent Klebsiella pneumoniae infection in a mouse model. J. Glob. Antimicrob. Resist. 2019, 21, 34–41. [Google Scholar] [CrossRef] [PubMed]
- Carvalho, C.M.; Gannon, B.W.; E Halfhide, D.; Santos, S.B.; Hayes, C.M.; Roe, J.M.; Azeredo, J. The in vivo efficacy of two administration routes of a phage cocktail to reduce numbers of Campylobacter coli and Campylobacter jejuni in chickens. BMC Microbiol. 2010, 10, 232–232. [Google Scholar] [CrossRef] [PubMed]
- Seo, B.-J.; Song, E.-T.; Lee, K.; Kim, J.-W.; Jeong, C.-G.; Moon, S.-H.; Son, J.S.; Kang, S.H.; Cho, H.-S.; Jung, B.Y.; et al. Evaluation of the broad-spectrum lytic capability of bacteriophage cocktails against various Salmonella serovars and their effects on weaned pigs infected with Salmonella Typhimurium. J. Veter- Med Sci. 2018, 80, 851–860. [Google Scholar] [CrossRef] [PubMed]
- Dedrick, R.M.; Guerrero-Bustamante, C.A.; Garlena, R.A.; Russell, D.A.; Ford, K.; Harris, K.; Gilmour, K.C.; Soothill, J.; Jacobs-Sera, D.; Schooley, R.T.; et al. Engineered bacteriophages for treatment of a patient with a disseminated drug-resistant Mycobacterium abscessus. Nat. Med. 2019, 25, 730–733. [Google Scholar] [CrossRef]
- Mtimka, S.; Pillay, P.; Kwezi, L.; Pooe, O.J.; Tsekoa, T.L. An Exploratory Review of the Potential of Lytic Proteins and Bacteriophages for the Treatment of Tuberculosis. Microorganisms 2024, 12, 570. [Google Scholar] [CrossRef] [PubMed]
- Turner, D.; Shkoporov, A.N.; Lood, C.; Millard, A.D.; Dutilh, B.E.; Alfenas-Zerbini, P.; van Zyl, L.J.; Aziz, R.K.; Oksanen, H.M.; Poranen, M.M.; et al. Abolishment of morphology-based taxa and change to binomial species names: 2022 taxonomy update of the ICTV bacterial viruses subcommittee. Arch. Virol. 2023, 168, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Holman, N.D.M.; Wilkinson, A.J.; Smith, M.C.M. Alanine-scanning mutagenesis of protein mannosyl-transferase from Streptomyces coelicolor reveals strong activity-stability correlation. Microbiology 2021, 167, 001103. [Google Scholar] [CrossRef] [PubMed]
- Kołodziej, M.; Łebkowski, T.; Płociński, P.; Hołówka, J.; Paściak, M.; Wojtaś, B.; Bury, K.; Konieczny, I.; Dziadek, J.; Zakrzewska-Czerwińska, J. Lsr2 and Its Novel Paralogue Mediate the Adjustment of Mycobacterium smegmatis to Unfavorable Environmental Conditions. mSphere 2021, 6. [Google Scholar] [CrossRef] [PubMed]
- Arora, K.; Whiteford, D.C.; Lau-Bonilla, D.; Davitt, C.M.; Dahl, J.L. Inactivation of lsr2 Results in a Hypermotile Phenotype in Mycobacterium smegmatis. J. Bacteriol. 2008, 190, 4291–4300. [Google Scholar] [CrossRef] [PubMed]
- Lee, Y.; Song, S.; Sheng, L.; Zhu, L.; Kim, J.-S.; Wood, T.K. Substrate Binding Protein DppA1 of ABC Transporter DppBCDF Increases Biofilm Formation in Pseudomonas aeruginosa by Inhibiting Pf5 Prophage Lysis. Front. Microbiol. 2018, 9, 30. [Google Scholar] [CrossRef] [PubMed]
- Lucas-Elío, P.; Molina-Quintero, L.R.; Xu, H.; Sánchez-Amat, A. A histidine kinase and a response regulator provide phage resistance to Marinomonas mediterranea via CRISPR-Cas regulation. Sci. Rep. 2021, 11, 1–13. [Google Scholar] [CrossRef]
- Jin, Y.; Li, W.; Zhang, H.; Ba, X.; Li, Z.; Zhou, J. The Post-Antibiotic Era: A New Dawn for Bacteriophages. Biology 2023, 12, 681. [Google Scholar] [CrossRef] [PubMed]
- Tagliaferri, T.L.; Jansen, M.; Horz, H.-P. Fighting Pathogenic Bacteria on Two Fronts: Phages and Antibiotics as Combined Strategy. Front. Cell. Infect. Microbiol. 2019, 9, 22. [Google Scholar] [CrossRef] [PubMed]
- Tan, Y.; Su, J.; Luo, D.; Liang, B.; Liu, S.; Zeng, H. Isolation and genome-wide analysis of the novel Acinetobacter baumannii bacteriophage vB_AbaM_AB3P2. Arch. Virol. 2024, 169, 1–6. [Google Scholar] [CrossRef] [PubMed]
- Shende, R.K.; Hirpurkar, S.D.; Sannat, C.; Rawat, N.; Pandey, V. Isolation and characterization of bacteriophages with lytic activity against common bacterial pathogens. Veter- World 2017, 10, 973–978. [Google Scholar] [CrossRef] [PubMed]
- Tizro, P.; Choi, C.; Khanlou, N. , Sample Preparation for Transmission Electron Microscopy. Methods Mol Biol 2019, 1897, 417–424. [Google Scholar] [PubMed]
- Summer, E.J. , Preparation of a phage DNA fragment library for whole genome shotgun sequencing. Methods Mol Biol 2009, 502, 27–46. [Google Scholar] [PubMed]
- Liu, Y.; Liu, M.; Hu, R.; Bai, J.; He, X.; Jin, Y. Isolation of the Novel Phage PHB09 and Its Potential Use against the Plant Pathogen Pseudomonas syringae pv. actinidiae. Viruses 2021, 13. [Google Scholar] [CrossRef]
- Aziz, R.K.; Bartels, D.; Best, A.A.; DeJongh, M.; Disz, T.; Edwards, R.A.; Formsma, K.; Gerdes, S.; Glass, E.M.; Kubal, M.; et al. The RAST server: Rapid annotations using subsystems technology. BMC Genom. 2008, 9, 75. [Google Scholar] [CrossRef] [PubMed]
- Saitou, N.; Nei, M. The neighbor-joining method: a new method for reconstructing evolutionary trees. Mol. Biol. Evol. 1987, 4, 406–425. [Google Scholar] [CrossRef] [PubMed]
- Sullivan, M.J.; Petty, N.K.; Beatson, S.A. Easyfig: A genome comparison visualizer. Bioinformatics 2011, 27, 1009–1010. [Google Scholar] [CrossRef] [PubMed]
- Moraru, C.; Varsani, A.; Kropinski, A.M. VIRIDIC—A Novel Tool to Calculate the Intergenomic Similarities of Prokaryote-Infecting Viruses. Viruses 2020, 12, 1268. [Google Scholar] [CrossRef] [PubMed]
- Nayak, T.; Kakkar, A.; Singh, R.K.; Jaiswal, L.K.; Singh, A.K.; Temple, L.; Gupta, A. Isolation and characterization of a novel mycobacteriophage Kashi-VT1 infecting Mycobacterium species. Front. Cell. Infect. Microbiol. 2023, 13, 1173894. [Google Scholar] [CrossRef] [PubMed]
- Hyman, P.; Abedon, S.T. Bacteriophage host range and bacterial resistance. Adv. Appl. Microbiol. 2010, 70, 217–248. [Google Scholar] [PubMed]
- Park, D.-W.; Lim, G.-y.; Lee, Y.-d.; Park, J.-H. Characteristics of lytic phage vB_EcoM-ECP26 and reduction of shiga-toxin producing Escherichia coli on produce romaine. Appl. Biol. Chem. 2020, 63, 19. [Google Scholar] [CrossRef]
- Gillis, A.; Mahillon, J. An improved method for rapid generation and screening of Bacillus thuringiensis phage-resistant mutants. J. Microbiol. Methods 2014, 106, 101–103. [Google Scholar] [CrossRef]
- Shen, Q.; Zhou, X.-T.; Guo, Q.; Xue, Y.-P.; Zheng, Y.-G. Engineering laboratory/factory-specific phage-resistant strains of Escherichia coli by mutagenesis and screening. World J. Microbiol. Biotechnol. 2022, 38, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Li, P.; Lin, H.; Mi, Z.; Xing, S.; Tong, Y.; Wang, J. Screening of Polyvalent Phage-Resistant Escherichia coli Strains Based on Phage Receptor Analysis. Front. Microbiol. 2019, 10, 850. [Google Scholar] [CrossRef] [PubMed]
- Tang, X.; Shen, Y.; Song, X.; Benghezal, M.; Marshall, B.J.; Tang, H.; Li, H. Reassessment of the Broth Microdilution Method for Susceptibility Testing of Helicobacter pylori. J. Infect. Dis. 2022, 226, S486–S492. [Google Scholar] [CrossRef] [PubMed]









| Strain | Mutation location | Mutant genes | Type of mutation | REF | ALT | Function |
|---|---|---|---|---|---|---|
| 2E1 | 632863 | MSMEG_0555 | INDEL | C | CACACTGTTCTGCGCGTTGTAGACGCG GTTCGACGACGCCGACAGCTCTTTGT |
Carbohydrate ABC transporter permease |
| 0G10, 2E1 | 1000473 | MSMEG_0916 | INDEL | GCC | G | TetR/AcrR family transcriptional regulator |
| 0G10, 2E1 | 1127759 | MSMEG_1060 | INDEL | CCTG | C | Lsr2 family protein |
| 0G10, 2E1 | 2085173 | MSMEG_2004 | INDEL | CGG | C | MFS transporter |
| 0G10 | 2429903 | MSMEG_2348 | INDEL | C | CG | Glycosyltransferase |
| 2E1 | 4550626 | MSMEG_4468 | INDEL | GAAT | G | Sugar ABC transporter substrate-binding protein |
| 0G10, 2E1 | 4596508 | MSMEG_4512 | INDEL | GC | G | Mycobactin polyketide synthase MbtD |
| 0G10, 2E1 | 5940372 | MSMEG_5878 | INDEL | C | CGG | Cutinase family protein |
| 0G10, 2E1 | 6148093 | MSMEG_6084 | INDEL | G | GC | Helix-turn-helix domain containing protein |
| 0G10, 2E1 | 6302176 | MSMEG_6236 | INDEL | T | TGGCCTC | Two-component system response regulator MnoR |
| 0G10, 2E1 | 6768692 | MSMEG_6720 | INDEL | GC | G | Alpha/beta hydrolase |
| 0G10, 2E1 | 6803027 | MSMEG_6758 | INDEL | GCACCCT | G | Aquaporin family protein |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).