Submitted:
10 July 2024
Posted:
11 July 2024
You are already at the latest version
Abstract

Keywords:
1. Introduction
2. Material and Methods
2.1. Bacterial Culture
2.2. SELEX Screening for Omp X DNA Aptamers
2.3. Preparation of Secondary ssDNA Library by Streptavidin Magnetic Beads(SA-MBs) Method
2.4. Real-Time Monitoring of the Screening Process by qPCR
2.5. High Throughput Sequencing and Prediction of Secondary and Tertiary Structures and Molecular Docking Analysis
2.6. Evaluation of Aptamer Binding Dissociation Constants(Kd) and Specificity
2.7. Synthesis of AuNCs
2.8. Characterization of Target Bacteria Recognition Based on AuNCs-Aptamers
2.9. Inhibition of Bacterial Growth by In Vitro Aptamers
2.10. Statistical Analysis
3. Results and Discussion
3.1. Screening of Omp X Aptamers
3.2. High Throughput Sequencing Analysis of the Enriched Pools
3.3. Binding Affinity and Specificity Studies
3.4. Results of the Recognition Characterization of Target Bacteria Based on AuNCs-Aptamers
3.5. Results of the Inhibitory Effect of In Vitro Aptamers on Bacterial Growth
4. Conclusions
Declaration of competing interest
Data availability
Acknowledgements
References
- Hu G, Chen X, Chu W, et al. Immunogenic characteristics of the outer membrane phosphoporin as a vaccine candidate against Klebsiella pneumoniae. Vet Res. 2022, 21, 53(1):5. [CrossRef]
- Cerdeira L, Silva KC, Fernandes MR, et al.. Draft genome sequence of a CTX-M-15-producing Klebsiella pneumoniae sequence type 340 (clonal complex 258) isolate from a food-producing animal. J Glob Antimicrob Resist. 2016, 7:67-68. [CrossRef]
- Kim K, Choi J, Lim JA, et al. Outer membrane proteins A (OmpA)and X (OmpX)are essential for basolateral invasion of Cronobacter sakazakii. Appl Environ Microbiol, 2010a, 76(15): 5188-5198. [CrossRef]
- Iwanaga N, Chen K, Yang H, et al. Vaccine-driven lung TRM cells provide immunity against Klebsiella via fibroblast IL-17R signaling. Sci Immunol. 2021, 6(63):eabf1198. [CrossRef]
- Zhao Y, He L, Huang B, et al. Identification of a novel DNA aptamer that selectively targets lung cancer serum. RSC Adv. 2021, 11(53):33759-33769. [CrossRef]
- Zheng Y, Zhao Y, Di Y,et al. DNA aptamers from whole-serum SELEX as new diagnostic agents against gastric cancer. RSC Adv. 2019, 9(2):950-957.
- Santarpia G, Carnes E. Therapeutic Applications of Aptamers. International Journal of Molecular Sciences. 2024, 25(12):6742.
- Z. Hu, Z. Jiang, Z. Yang, L. et al. Development of a modularized aptamer targeting the nuclear T-cell suppressor PAC1, Analyst, 2023, 148(11): 2616-2625. [CrossRef]
- H.R. Kim, B.C. Kim, Development of multi-reactive aptamers for Cronobacter spp. using the sequential partitioning method to detect them in powdered infant formula, Anal Chim Acta, 2023, 1249:340935. [CrossRef]
- J. Li, M. Chen, S. Ke, J. Tian, H. Yu, X. Liu, B.Y. Yu, Generation of a high-affinity DNA aptamer for on-site screening of toxic aristolochic acid I in herbal medicines and botanical products, Anal Chim Acta, 2023, 1264:341302. [CrossRef]
- Huang X, Jain PK, El-Sayed IH, El-Sayed MA. Plasmonic photothermal therapy (PPTT) using gold nanoparticles. Lasers Med Sci. 2008, 23(3):217-28. [CrossRef]
- Jiaojiao Sun, Li Zhang, Yingchun Xu, et al. A platform for specific and sensitive detection of target bacteria by selective magnetic enrichment and a broad-spectrum fluorescent probe. Sensors and Actuators B: Chemical. 2021, (349):130762. [CrossRef]
- Kang JH, Super M, Yung CW, et al. An extracorporeal blood-cleansing device for sepsis therapy. Nat Med. 2014, 20(10):1211-6. [CrossRef]
- Q. Zhao, H. Yan, P. Liu,et al. An ultrasensitive and colorimetric sensor for copper and iron based on glutathionefunctionalized gold nanoclusters, Anal. Chim. Acta, 2016, (948):73-79.
- L. Shang, N. Azadfar, F. Stockmar, W. Send, et al. One-pot synthesis of near-infrared fluorescent gold clusters for cellular fluorescence lifetime imaging, Small. 2011, (7) :2614-2620. [CrossRef]
- J. Qiao, X. Meng, Y. Sun, et al. Aptamer-based fluorometric assay for direct identification of methicillin-resistant Staphylococcus aureus from clinical samples, J. Microbiol. Methods, 2018, (153): 92-98. [CrossRef]
- D. Chang, Z. Wang, C.D. Flynn, et al. A high-dimensional microfluidic approach for selection of aptamers with programmable binding affinities, Nat Chem., 2023, 15(6): 773-780. [CrossRef]
- H.B. Wu, C.H. Wang, Y.D. Chung, et al. Highly-specific aptamer targeting SARS-CoV-2 S1 protein screened on an automatic integrated microfluidic system for COVID-19 diagnosis, Anal Chim Acta. 2023, 1274: 341531.
- Fu Z, Huang J, Wei W, Wu Z, Shi X. A multimode biosensor based on prussian blue nanoparticles loaded with gold nanoclusters for the detection of aflatoxin B1. Anal Methods. 2024, 16(19):3088-3098.
- Wang C, Du X, Xie T, et al. Label- and modification-free-based in situ selection of bovine serum albumin specific aptamer. J Sep Sci., 2019, 42(23):3571-3578.







| ssDNA ID | Sequences |
| Random library | 5’-CTATAGCAATGGTACGGTACTTCC-N40-CAAAAGTGCACGCTACTTTGCTAA-3’(P7) |
| Forward primer | 5’-CTATAGCAATGGTACGGTACTTCC-3’(P11) |
| Reverse prime | 5’-Biotin-TTAGCAAAGTAGCGTGCACTTTTG-3(Biotin-P11) |
| Aptamer No. | Sequences | pool fraction | Diversity | Enrichment |
Kd (nmol L-1 ) |
| Apt-1 | 5’-CTATAGCAATGGTACGGTACTTCCCAATGGTACTTTAGGGCAAGCTAACCCGGGTCTGCGGCGCCAAAAGTGCACGCTACTTTGCTAA -3’ | 9 % | 59 | 327 | 62.50 |
| Apt-2 | 5’-CTATAGCAATGGTACGGTACTTCCCCATGGCACGGGGGCAGTAGCGCTCGGCGGGGGGCCCCGCCAAAAGTGCACGCTACTTTGCTAA -3’ | 14 % | 82 | 398 | 22.05 |
| Apt-3 | 5’-CTATAGCAATGGTACGGTACTTCCCCGCGCTAACCCCCAAGTGCGCGCTCCTGGGGAGCGCGGCCGCCAAAAGTGCACGCTACTTTGCTAA -3’ | 19 % | 135 | 496 | 7.9 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).