Submitted:
03 May 2024
Posted:
06 May 2024
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Materials and Methods
2.1. Oligonucleotide Selection/Design
2.2. RNA Extraction
2.3. RT-qPCR
2.4. Determination of the Limit of Detection and Construction of Calibration Curves
2.5. Statistical Analyses
3. Results
3.1. In Silico Assessment of Existing Honeybee Virus Detection Methods
3.2. Multiplexing of RT-qPCR Tests Targeting Honeybee Viruses
3.3. Limit of Detection (LOD) of the RT-qPCR Tests
3.4. Virus Quantification in Artificially Spiked Samples
4. Discussion
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Osterman, J.; Aizen, M.A.; Biesmeijer, J.C.; Bosch, J.; Howlett, B.G.; Inouye, D.W.; Jung, C.; Martins, D.J.; Medel, R.; Pauw, A.; Seymour, C.L.; Paxton, R.J. Global Trends in the Number and Diversity of Managed Pollinator Species. Agric. Ecosyst. Environ. 2021, 322, 107653. [Google Scholar] [CrossRef]
- Beaurepaire, A.; Piot, N.; Doublet, V.; Antunez, K.; Campbell, E.; Chantawannakul, P.; Chejanovsky, N.; Gajda, A.; Heerman, M.; Panziera, D.; Smagghe, G.; Yañez, O.; de Miranda, J.R.; Dalmon, A. Diversity and Global Distribution of Viruses of the Western Honey Bee, Apis Mellifera. Insects 2020, 11, 239. [Google Scholar] [CrossRef] [PubMed]
- Di Prisco, G.; Annoscia, D.; Margiotta, M.; Ferrara, R.; Varricchio, P.; Zanni, V.; Caprio, E.; Nazzi, F.; Pennacchio, F. A Mutualistic Symbiosis between a Parasitic Mite and a Pathogenic Virus Undermines Honey Bee Immunity and Health. Proc. Natl. Acad. Sci. U. S. A. 2016, 113, 3203–3208. [Google Scholar] [CrossRef] [PubMed]
- McMahon, D.P.; Natsopoulou, M.E.; Doublet, V.; Fürst, M.; Weging, S.; Brown, M.J.F.; Gogol-Döring, A.; Paxton, R.J. Elevated Virulence of an Emerging Viral Genotype as a Driver of Honeybee Loss. Proc. Biol. Sci. 2016, 283. [Google Scholar] [CrossRef] [PubMed]
- De Miranda, J. Viruses In Bees: What Do They Do and What Can We Do about It? Bee World 2012, 89, 2–5. [Google Scholar] [CrossRef]
- Schurr, F.; Tison, A.; Militano, L.; Cheviron, N.; Sircoulomb, F.; Rivière, M.-P.; Ribière-Chabert, M.; Thiéry, R.; Dubois, E. Validation of Quantitative Real-Time RT-PCR Assays for the Detection of Six Honeybee Viruses. J. Virol. Methods 2019, 270, 70–78. [Google Scholar] [CrossRef] [PubMed]
- Thu, H.T.; Thi Kim Lien, N.; Thuy Linh, M.; Le, T.H.; Hoa, N.T.; Hong Thai, P.; Reddy, K.E.; Yoo, M.S.; Kim, Y.-H.; Cho, Y.S.; Kang, S.W.; Quyen, D.V. Prevalence of bee viruses among Apis cerana populations in Vietnam. J. Apic. Res. 2016, 55, 379–385. [Google Scholar] [CrossRef]
- Hassanyar, A.K.; Huang, S.; Li, Z.; Rizwan, M.; Mehmood, S.; Raza, M.F.; Qasim, M.; Hussain, M.; Su, S. Prevalence of Bee Viruses in Apis Cerana Cerana Populations from Different Locations in the Fujian Province of China. Microbiologyopen 2019, 8, e00830. [Google Scholar] [CrossRef] [PubMed]
- Budge, G.E.; Simcock, N.K.; Holder, P.J.; Shirley, M.D.F.; Brown, M.A.; Van Weymers, P.S.M.; Evans, D.J.; Rushton, S.P. Chronic Bee Paralysis as a Serious Emerging Threat to Honey Bees. Nat. Commun. 2020, 11, 2164. [Google Scholar] [CrossRef]
- Brasesco, C.; Quintana, S.; Di Gerónimo, V.; Genchi García, M.L.; Sguazza, G.; Bravi, M.E.; Fargnoli, L.; Reynaldi, F.J.; Eguaras, M.; Maggi, M. Deformed Wing Virus Type a and b in Managed Honeybee Colonies of Argentina. Bull. Entomol. Res. 2021, 111, 100–110. [Google Scholar] [CrossRef]
- Bordin, F.; Zulian, L.; Granato, A.; Caldon, M.; Colamonico, R.; Toson, M.; Trevisan, L.; Biasion, L.; Mutinelli, F. Presence of Known and Emerging Honey Bee Pathogens in Apiaries of Veneto Region (Northeast of Italy) during Spring 2020 and 2021. Appl. Sci. 2022, 12, 2134. [Google Scholar] [CrossRef]
- Brzoskowski Chagas, D.; Liz Monteiro, F.; da Silva Barcelos, L.; Iuri Frühauf, M.; Botton, N.Y.; Ribeiro, L.C.; Silveira Becker, A.; Wolff, L.F.; Helena Saalfeld, M.; de Lima, M.; de Oliveira Hübner, S.; Fischer, G. Detection of Honey Bee Viruses in Apiaries in Southern Brazil through Two Standardized Multiplex RT-PCR. J. Apic. Res. 2022, 1–8. [Google Scholar] [CrossRef]
- Cilia, G.; Tafi, E.; Zavatta, L.; Caringi, V.; Nanetti, A. The Epidemiological Situation of the Managed Honey Bee (Apis Mellifera) Colonies in the Italian Region Emilia-Romagna. Vet. Sci. 2022, 9, 437. [Google Scholar] [CrossRef] [PubMed]
- Li, N.; Li, C.; Hu, T.; Li, J.; Zhou, H.; Ji, J.; Wu, J.; Kang, W.; Holmes, E.C.; Shi, W.; Xu, S. Nationwide Genomic Surveillance Reveals the Prevalence and Evolution of Honeybee Viruses in China. Microbiome 2023, 11. [Google Scholar] [CrossRef] [PubMed]
- Hulaj, B.; Granato, A.; Bordin, F.; Goga, I.; Merovci, X.; Caldon, M.; Cana, A.; Zulian, L.; Colamonico, R.; Mutinelli, F. Emergent and Known Honey Bee Pathogens through Passive Surveillance in the Republic of Kosovo. Appl. Sci. 2024, 14, 987. [Google Scholar] [CrossRef]
- Lamas, Z.S.; Chen, Y.; Evans, J.D. Case Report: Emerging Losses of Managed Honey Bee Colonies. Biology 2024, 13, 117. [Google Scholar] [CrossRef] [PubMed]
- De Miranda, J.R.; Cordoni, G.; Budge, G. The Acute Bee Paralysis Virus-Kashmir Bee Virus-Israeli Acute Paralysis Virus Complex. J. Invertebr. Pathol. 2010, 103 Suppl 1, S30–47. [Google Scholar] [CrossRef]
- Formato, G.; Giacomelli, A.; Olivia, M.; Aubin, L.; Glick, E.; Paldi, N.; Cardeti, G.; Cersini, A.; Ciabatti, I.M.; Palazzetti, M.; Granato, A.; Mutinelli, F. First Detection of Israeli Acute Paralysis Virus (IAPV) in Italy. J. Apic. Res. 2011, 50, 176–177. [Google Scholar] [CrossRef]
- Bellucci, V.; Lucci, S.; Bianco, P.; Ubaldi, A.; Felicioli, A.; Porrini, C.; Mutinelli, F.; Battisti, S.; Spallucci, V.; Cersini, A.; Pietropaoli, M.; Formato, G. Monitoring Honey Bee Health in Five Natural Protected Areas in Italy. Vet. Ital. 2019, 55, 15–25. [Google Scholar]
- Tantillo, G.; Bottaro, M.; Di Pinto, A.; Martella, V.; Di Pinto, P.; Terio, V. Virus Infections of Honeybees Apis Mellifera. Ital. J. Food Saf. 2015, 4, 5364. [Google Scholar] [CrossRef]
- Manley, R.; Temperton, B.; Doyle, T.; Gates, D.; Hedges, S.; Boots, M.; Wilfert, L. Knock-on Community Impacts of a Novel Vector: Spillover of Emerging DWV-B from Varroa-Infested Honeybees to Wild Bumblebees. Ecol. Lett. 2019, 22, 1306–1315. [Google Scholar] [CrossRef]
- Riveros, G.; Arismendi, N.; Zapata, N.; Evans, D.; Pérez, I.; Aldea, P.; Vargas, M. Occurrence, Prevalence and Viral Load of Deformed Wing Virus Variants in Apis mellifera Colonies in Chile. J. Apic. Res. 2020, 59, 63–68. [Google Scholar] [CrossRef]
- Kevill, J.L.; Stainton, K.C.; Schroeder, D.C.; Martin, S.J. Deformed Wing Virus Variant Shift from 2010 to 2016 in Managed and Feral UK Honey Bee Colonies. Arch. Virol. 2021, 166, 2693–2702. [Google Scholar] [CrossRef] [PubMed]
- Paxton, R.J.; Schäfer, M.O.; Nazzi, F.; Zanni, V.; Annoscia, D.; Marroni, F.; Bigot, D.; Laws-Quinn, E.R.; Panziera, D.; Jenkins, C.; Shafiey, H. Epidemiology of a Major Honey Bee Pathogen, Deformed Wing Virus: Potential Worldwide Replacement of Genotype A by Genotype B. Int. J. Parasitol. Parasites Wildl. 2022, 18, 157–171. [Google Scholar] [CrossRef]
- Zhang, Z.; Villalobos, E.M.; Nikaido, S.; Martin, S.J. Seasonal Variability in the Prevalence of DWV Strains in Individual Colonies of European Honeybees in Hawaii. Insects 2024, 15, 219. [Google Scholar] [CrossRef] [PubMed]
- Doublet, V.; Oddie, M.A.Y.; Mondet, F.; Forsgren, E.; Dahle, B.; Furuseth-Hansen, E.; Williams, G.R.; De Smet, L.; Natsopoulou, M.E.; Murray, T.E.; Semberg, E.; Yañez, O.; de Graaf, D.C.; Le Conte, Y.; Neumann, P.; Rimstad, E.; Paxton, R.J.; de Miranda, J.R. Shift in Virus Composition in Honeybees (Apis Mellifera) Following Worldwide Invasion by the Parasitic Mite and Virus Vector Varroa Destructor. R. Soc. Open Sci. 2024, 11, 231529. [Google Scholar] [CrossRef] [PubMed]
- Norton, A.M.; Remnant, E.J.; Buchmann, G.; Beekman, M. Accumulation and Competition amongst Deformed Wing Virus Genotypes in Naïve Australian Honeybees Provides Insight into the Increasing Global Prevalence of Genotype B. Front. Microbiol. 2020, 11, 620. [Google Scholar] [CrossRef] [PubMed]
- Gisder, S.; Genersch, E. Direct Evidence for Infection of Varroa Destructor Mites with the Bee-Pathogenic Deformed Wing Virus Variant B - but Not Variant A - via Fluorescence-in Situ-Hybridization Analysis. J. Virol. 2021, 95. [Google Scholar] [CrossRef]
- Ryabov, E.V.; Posada-Florez, F.; Rogers, C.; Lamas, Z.S.; Evans, J.D.; Chen, Y.; Cook, S.C. The vectoring competence of the mite Varroa destructor for deformed wing virus of honey bees is dynamic and affects survival of the mite. Front Insect Sci 2022, 2, 931352. [Google Scholar] [CrossRef]
- Damayo, J.E.; McKee, R.C.; Buchmann, G.; Norton, A.M.; Ashe, A.; Remnant, E.J. Virus Replication in the Honey Bee Parasite, Varroa Destructor. J. Virol. 2023, e0114923. [Google Scholar] [CrossRef]
- Locke, B.; Forsgren, E.; Fries, I.; de Miranda, J.R. Acaricide Treatment Affects Viral Dynamics in Varroa Destructor-Infested Honey Bee Colonies via Both Host Physiology and Mite Control. Appl. Environ. Microbiol. 2012, 78, 227–235. [Google Scholar] [CrossRef] [PubMed]
- Mazzei, M.; Forzan, M.; Cilia, G.; Sagona, S.; Bortolotti, L.; Felicioli, A. First detection of replicative deformed wing virus (DWV) in Vespa velutina nigrithorax. Bull. Insectol. 2018, 71, 211–216. [Google Scholar]
- Bubnič, J.; Prešern, J.; Pietropaoli, M.; Cersini, A.; Moškrič, A.; Formato, G.; Manara, V.; Smodiš Škerl, M.I. Integrated Pest Management Strategies to Control Varroa Mites and Their Effect on Viral Loads in Honey Bee Colonies. Insects 2024, 15, 115. [Google Scholar] [CrossRef]
- Cox-Foster, D.L.; Conlan, S.; Holmes, E.C.; Palacios, G.; Evans, J.D.; Moran, N.A.; Quan, P.-L.; Briese, T.; Hornig, M.; Geiser, D.M.; Martinson, V.; vanEngelsdorp, D.; Kalkstein, A.L.; Drysdale, A.; Hui, J.; Zhai, J.; Cui, L.; Hutchison, S.K.; Simons, J.F.; Egholm, M.; Pettis, J.S.; Lipkin, W.I. A Metagenomic Survey of Microbes in Honey Bee Colony Collapse Disorder. Science 2007, 318, 283–287. [Google Scholar] [CrossRef]
- Kukielka, D.; Esperón, F.; Higes, M.; Sánchez-Vizcaíno, J.M. A Sensitive One-Step Real-Time RT-PCR Method for Detection of Deformed Wing Virus and Black Queen Cell Virus in Honeybee Apis Mellifera. J. Virol. Methods 2008, 147, 275–281. [Google Scholar] [CrossRef] [PubMed]
- McMahon, D.P.; Fürst, M.A.; Caspar, J.; Theodorou, P.; Brown, M.J.F.; Paxton, R.J. A Sting in the Spit: Widespread Cross-Infection of Multiple RNA Viruses across Wild and Managed Bees. J. Anim. Ecol. 2015, 84, 615–624. [Google Scholar] [CrossRef]
- Bradford, E.L.; Christie, C.R.; Campbell, E.M.; Bowman, A.S. A Real-Time PCR Method for Quantification of the Total and Major Variant Strains of the Deformed Wing Virus. PLoS One 2017, 12, e0190017. [Google Scholar] [CrossRef] [PubMed]
- Kevill, J.L.; Highfield, A.; Mordecai, G.J.; Martin, S.J.; Schroeder, D.C. ABC Assay: Method Development and Application to Quantify the Role of Three DWV Master Variants in Overwinter Colony Losses of European Honey Bees. Viruses 2017, 9. [Google Scholar] [CrossRef]
- Chantawannakul, P.; Ward, L.; Boonham, N.; Brown, M. A Scientific Note on the Detection of Honeybee Viruses Using Real-Time PCR (TaqMan) in Varroa Mites Collected from a Thai Honeybee (Apis Mellifera) Apiary. J. Invertebr. Pathol. 2006, 91, 69–73. [Google Scholar] [CrossRef]
- Blanchard, P.; Regnault, J.; Schurr, F.; Dubois, E.; Ribière, M. Intra-Laboratory Validation of Chronic Bee Paralysis Virus Quantitation Using an Accredited Standardised Real-Time Quantitative RT-PCR Method. J. Virol. Methods 2012, 180, 26–31. [Google Scholar] [CrossRef]
- Blanchard, P.; Guillot, S.; Antùnez, K.; Köglberger, H.; Kryger, P.; de Miranda, J.R.; Franco, S.; Chauzat, M.-P.; Thiéry, R.; Ribière, M. Development and Validation of a Real-Time Two-Step RT-qPCR TaqMan(®) Assay for Quantitation of Sacbrood Virus (SBV) and Its Application to a Field Survey of Symptomatic Honey Bee Colonies. J. Virol. Methods 2014, 197, 7–13. [Google Scholar] [CrossRef] [PubMed]
- Šimenc, L.; Knific, T.; Toplak, I. The Comparison of Honeybee Viral Loads for Six Honeybee Viruses (ABPV, BQCV, CBPV, DWV, LSV3 and SBV) in Healthy and Clinically Affected Honeybees with TaqMan Quantitative Real-Time RT-PCR Assays. Viruses 2021, 13, 1340. [Google Scholar] [CrossRef] [PubMed]
- Castelli, L.; Genchi García, M.L.; Dalmon, A.; Arredondo, D.; Antúnez, K.; Invernizzi, C.; Reynaldi, F.J.; Le Conte, Y.; Beaurepaire, A. Intra-Colonial Viral Infections in Western Honey Bees (Apis Mellifera). Microorganisms 2021, 9, 1087. [Google Scholar] [CrossRef] [PubMed]
- Cilia, G.; Zavatta, L.; Ranalli, R.; Nanetti, A.; Bortolotti, L. Replicative Deformed Wing Virus Found in the Head of Adults from Symptomatic Commercial Bumblebee (Bombus Terrestris) Colonies. Vet. Sci. 2021, 8, 117. [Google Scholar] [CrossRef] [PubMed]
- Mráz, P.; Hýbl, M.; Kopecký, M.; Bohatá, A.; Hoštičková, I.; Šipoš, J.; Vočadlová, K.; Čurn, V. Screening of Honey Bee Pathogens in the Czech Republic and Their Prevalence in Various Habitats. Insects 2021, 12, 1051. [Google Scholar] [CrossRef] [PubMed]
- Leti Maggio, E.; Tofani, S.; Granato, A.; Formato, G.; Pietrella, G.; Conti, R.; Milito, M.; Pietropaoli, M.; Cersini, A.; Scicluna, M.T. First Description of the Occurrence of Slow Bee Paralysis Virus-1 and Deformed Wing Virus B in Apis mellifera ligustica Honeybee in Italy. Appl. Sci. 2024, 14, 626. [Google Scholar] [CrossRef]
- Nikulin, S.L.; Hesketh-Best, P.J.; Mckeown, D.A.; Spivak, M.; Schroeder, D.C. A semi-automated and high-throughput approach for the detection of honey bee viruses in bee samples. PLoS ONE 2024, 19, e0297623. [Google Scholar] [CrossRef] [PubMed]
- Tiritelli, R.; Flaminio, S.; Zavatta, L.; Ranalli, R.; Giovanetti, M.; Grasso, D.A.; Leonardi, S.; Bonforte, M.; Boni, C.B.; Cargnus, E.; Catania, R.; Coppola, F.; Di Santo, M.; Pusceddu, M.; Quaranta, M.; Bortolotti, L.; Nanetti, A.; Cilia, G. Ecological and social factors influence interspecific pathogens occurrence among bees. Sci Rep. 2024, 14, 5136. [Google Scholar] [CrossRef]
- Köppel, R.; Schum, R.; Habermacher, M.; Sester, C.; Piller, L.E.; Meissner, S.; Pietsch, K. Multiplex Real-Time PCR for the Detection of Insect DNA and Determination of Contents of Tenebrio Molitor, Locusta Migratoria and Achaeta Domestica in Food. Eur. Food Res. Technol. 2019, 245, 559–567. [Google Scholar] [CrossRef]
- Fujiyuki, T.; Takeuchi, H.; Ono, M.; Ohka, S.; Sasaki, T.; Nomoto, A.; Kubo, T. Novel Insect Picorna-like Virus Identified in the Brains of Aggressive Worker Honeybees. J. Virol. 2004, 78, 1093–1100. [Google Scholar] [CrossRef]
- Bustin, S.A.; Benes, V.; Garson, J.A.; Hellemans, J.; Huggett, J.; Kubista, M.; Mueller, R.; Nolan, T.; Pfaffl, M.W.; Shipley, G.L.; Vandesompele, J.; Wittwer, C.T. The MIQE Guidelines: Minimum Information for Publication of Quantitative Real-Time PCR Experiments. Clin. Chem. 2009, 55, 611–622. [Google Scholar] [CrossRef]
- de Souza, F.S.; Kevill, J.L.; Correia-Oliveira, M.E.; de Carvalho, C.A.L.; Martin, S.J. Occurrence of Deformed Wing Virus Variants in the Stingless Bee Melipona Subnitida and Honey Bee Apis Mellifera Populations in Brazil. J. Gen. Virol. 2019, 100, 289–294. [Google Scholar] [CrossRef]
- Čukanová, E.; Prodělalová, J.; Palíková, M.; Kováčová, K.; Linhart, P.; Papežíková, I. Can the Examination of Different Types of Hive Samples Be a Non-Invasive Method for Detection and Quantification of Viruses in Honey Bee (Apis Mellifera L.) Colonies? J. Vet. Res. 2023, 67, 323–331. [Google Scholar] [CrossRef]

| Label | Sequence 5′-3′* | Target | Nucleotide positions |
|---|---|---|---|
| Acute paralysis virus (ABPV) | |||
| APVF APVP APVR |
TTTGTTTCAAAYAARATGTTYATGAAAYC FAM-TATGGTGGAAAYKCTGARAAYAAT-MGBEQ† BTWGAHACAGTCTCTGGACACAT |
Capsid protein gene | Acc. n. ON648748.1 8324-8466 |
| Black queen cell virus (BQCV) | |||
| BQCVF BQCVP BQCVR |
GTGCGGGAGATGATATGGA Cy5-TTTCCATCTTTATCGGTACGC-MGBEQ CCGTCTGAGATGCATGAATAC |
Capsid protein gene | Acc. n. MT482476.1 8060-8128 |
| Chronic bee paralysis virus (CBPV) | |||
| CBPVF CBPVP CBPVR |
GAAGTCATCCGTAGATCTGG FAM-AGACKAGRGAGGAYGGGA-MGBEQ CRAGAGGGGTATGTTGTACT |
RNA1 gene | Acc. n. MK637522.1 1961-2070 |
| Deformed wing virus A (DWVA) | |||
| DWVAF DWVAP DWVAR |
CTTTGTCTTCATTAAAGCCAC FAM-TGCGTGGAATGCGTCC-MGBEQ CTCATTAACTGTGTCGTTGAT |
Polyprotein gene | Acc. n. OR497397.1 8636-8774 |
| Deformed wing virus B (DWVB) | |||
| DWVBF DWVBP DWVBR |
TTTATCTTCATTAAAACCGCCA Cy5-ATCTTTTGAGAGGGATGAGA-MGBEQ CTCATTAACTGAGTTGTTGTC |
Polyprotein gene | Acc. n. OR497394.1 8615-8752 |
| Sacbrood virus (SBV) | |||
| SBVF SBVP SBVR |
AAYGTCCACTACACCGAAATGT Cy5-TGATGAGAGTGGACGAAGAATCTGGAATG-BHQ2 TAHGAGGTAATAACTTTTCGCCA |
Polyprotein gene | Acc. n. MN082652.1 430-548 |
| Log copy number | ||||||
|---|---|---|---|---|---|---|
| 1 | 2 | 3 | 4 | 5 | 6 | |
| Target | P values | |||||
| ABPV | 0.91 | 0.90 | 0.98 | 0.92 | 0.31 | 0.33 |
| BQCV | 0.90 | 0.87 | 0.51 | 0.96 | 0.53 | 0.10 |
| CBPV | 0.98 | 0.05 | 0.22 | 0.72 | 0.15 | 0.58 |
| DWVA | 0.02 | 0.44 | 0.97 | 0.78 | 0.08 | 0.37 |
| DWVB | 0.16 | 0.18 | 0.48 | 0.75 | 0.15 | 0.57 |
| SBV | 0.51 | 0.80 | 0.79 | 0.28 | 0.91 | 0.65 |
| Log copy number | |||
| PCR reaction | One bee | 100 µl hive debris* | |
| Target | |||
| ABPV | 1.99 | 3.65 | 3.47 |
| BQCV | 1.37 | 2.81 | 2.88 |
| CBPV | 1.21 | 2.9 | 2.72 |
| DWVA | 1.25 | 2.95 | 2.77 |
| DWVB | 1.39 | 4.07 | 3.90 |
| SBV | 1.49 | 3.17 | 4.00 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).