Submitted:
20 March 2024
Posted:
20 March 2024
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Materials and Methods
2.1. Experimental Animals and Diets
2.2. Estrus Synchronization, Semen Preparation, and Artificial Insemination
2.3. Necropsy, Sample Collection and Isolation of miRNA
2.4. Microarray Hybridization and Data Analysis
3. Results
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Ji, Y.; Wu, Z.; Dai, Z.; Wang, X.; Li, J.; Wang, B.; Wu, G. Fetal and neonatal programming of postnatal growth and feed efficiency in swine. J. Anim. Sci. Biotechnol. 2017, 8, 42. [Google Scholar] [CrossRef] [PubMed]
- Lin, Y.-J.; Huang, L.-T.; Tsai, C.-C.; Sheen, J.-M.; Tiao, M.-M.; Yu, H.-R.; Lin, I.-C.; Tain, Y.-L. Maternal high-fat diet sex-specifically alters placental morphology and transcriptome in rats: Assessment by next-generation sequencing. Placenta 2019, 78, 44–53. [Google Scholar] [CrossRef] [PubMed]
- Hoffman, M.L.; Reed, S.A.; Pillai, S.M.; Jones, A.K.; McFadden, K.K.; Zinn, S.A.; Govoni, K.E. Physiology and Endocrinology Symposium: The Effects of Poor Maternal Nutrition During Gestation on Offspring Postnatal Growth and Metabolism. J. Anim. Sci. 2017, 95, 2222–2232. [Google Scholar] [CrossRef] [PubMed]
- Du, M.; Tong, J.; Zhao, J.; Underwood, K.R.; Zhu, M.; Ford, S.P.; Nathanielsz, P.W. Fetal programming of skeletal muscle development in ruminant animals1. J. Anim. Sci. 2010, 88, E51–E60. [Google Scholar] [CrossRef] [PubMed]
- Du, M.; Wang, B.; Fu, X.; Yang, Q.; Zhu, M.-J. Fetal programming in meat production. Meat Sci. 2015, 109, 40–47. [Google Scholar] [CrossRef]
- Sohel, M.H. Macronutrient modulation of mRNA and microRNA function in animals: A review. Anim. Nutr. 2020, 6, 258–268. [Google Scholar] [CrossRef] [PubMed]
- Sohel, M.H.; Konca, Y.; Cinar, M.U. Impacts of Macronutrients on Gene Expression: Recent Evidence to Understand Productive and Reproductive Performance of Livestock. Turk Tarim Gida Bilim Teknol. Derg. 2018, 6, 203–212. [Google Scholar] [CrossRef]
- Ho, D.H.; Burggren, W.W. Epigenetics and transgenerational transfer: a physiological perspective. J. Exp. Biol. 2010, 213, 3–16. [Google Scholar] [CrossRef] [PubMed]
- Quintanilha, B.J.; Reis, B.Z.; Duarte, G.B.S.; Cozzolino, S.M.F.; Rogero, M.M. Nutrimiromics: Role of microRNAs and Nutrition in Modulating Inflammation and Chronic Diseases. Nutrients 2017, 9, 1168. [Google Scholar] [CrossRef]
- Jahan-Mihan, A.; Luhovyy, B.L.; El Khoury, D.; Anderson, G.H. Dietary Proteins as Determinants of Metabolic and Physiologic Functions of the Gastrointestinal Tract. Nutrients 2011, 3, 574–603. [Google Scholar] [CrossRef]
- Jahan-Mihan, A.; Rodriguez, J.; Christie, C.; Sadeghi, M.; Zerbe, T. The Role of Maternal Dietary Proteins in Development of Metabolic Syndrome in Offspring. Nutrients 2015, 7, 9185–9217. [Google Scholar] [CrossRef] [PubMed]
- Meruvu, S.; Schutz, L.F.; Choudhury, M. Nutritional Influence on miRNA Epigenetic Regulation: Effect of Maternal Diet and miRNAs on the Fetal Metabolic Programming. In Molecular Nutrition: Mother and Infant, 1st ed.; Vinciguerra, M., Cordero Sanchez, P., Eds.; Academic Press: Cambridge, Massachusetts, 2021; pp. 401–420. [Google Scholar]
- Blumfield, M.L.; E Collins, C. High-protein diets during pregnancy: healthful or harmful for offspring? Am. J. Clin. Nutr. 2014, 100, 993–995. [Google Scholar] [CrossRef] [PubMed]
- Kim, S.W.; Less, J.F.; Wang, L.; Yan, T.; Kiron, V.; Kaushik, S.J.; Lei, X.G. Meeting Global Feed Protein Demand: Challenge, Opportunity, and Strategy. Annu. Rev. Anim. Biosci. 2019, 7, 221–243. [Google Scholar] [CrossRef] [PubMed]
- Rauw, W.M.; Rydhmer, L.; Kyriazakis, I.; Øverland, M.; Gilbert, H.; Dekkers, J.C.; Hermesch, S.; Bouquet, A.; Izquierdo, E.G.; Louveau, I.; et al. Prospects for sustainability of pig production in relation to climate change and novel feed resources. J. Sci. Food Agric. 2020, 100, 3575–3586. [Google Scholar] [CrossRef] [PubMed]
- Almaraz, M.; Kuempel, C.D.; Salter, A.M.; Halpern, B.S. The impact of excessive protein consumption on human wastewater nitrogen loading of US waters. Front. Ecol. Environ. 2022, 20, 452–458. [Google Scholar] [CrossRef]
- Kizilaslan, M.; Arzik, Y.; Cinar, M.U.; Konca, Y. Genome-Wise Engineering of Ruminant Nutrition–Nutrigenomics: Applications, Challenges, and Future Perspectives–A Review. Ann. Anim. Sci. 2021, 22, 511–521. [Google Scholar] [CrossRef]
- Sohel, M.H.; Akyuz, B.; Konca, Y.; Arslan, K.; Gurbulak, K.; Abay, M.; Kaliber, M.; Cinar, M.U. Differential protein input in the maternal diet alters the skeletal muscle transcriptome in fetal sheep. Mamm. Genome 2020, 31, 309–324. [Google Scholar] [CrossRef]
- NRC: Nutrient Requirements of Small Ruminants. 2007, National Academy Press.
- Paulenz, H.; Ådnøy, T.; Fossen, O.H.; Söderquist, L.; Berg, K.A. Effect of deposition site and sperm number on the fertility of sheep inseminated with liquid semen. Veter- Rec. 2002, 150, 299–302. [Google Scholar] [CrossRef] [PubMed]
- McGeary, S.E.; Lin, K.S.; Shi, C.Y.; Pham, T.M.; Bisaria, N.; Kelley, G.M.; Bartel, D.P. The biochemical basis of microRNA targeting efficacy. Science 2019, 366, 1470. [Google Scholar] [CrossRef]
- Herwig, R.; Hardt, C.; Lienhard, M.; Kamburov, A. Analyzing and interpreting genome data at the network level with ConsensusPathDB. Nat. Protoc. 2016, 11, 1889–1907. [Google Scholar] [CrossRef]
- Parisi, G.; Tulli, F.; Fortina, R.; Marino, R.; Bani, P.; Zotte, A.D.; De Angelis, A.; Piccolo, G.; Pinotti, L.; Schiavone, A.; et al. Protein hunger of the feed sector: the alternatives offered by the plant world. Ital. J. Anim. Sci. 2020, 19, 1204–1225. [Google Scholar] [CrossRef]
- Moorby, J.; Fraser, M.D. Review: New feeds and new feeding systems in intensive and semi-intensive forage-fed ruminant livestock systems. Animal 2021, 15, 100297. [Google Scholar] [CrossRef] [PubMed]
- Calsamiglia, S.; Ferret, A.; Reynolds, C.K.; Kristensen, N.B.; van Vuuren, A.M. Strategies for optimizing nitrogen use by ruminants. Animal 2010, 4, 1184–1196. [Google Scholar] [CrossRef] [PubMed]
- Gengler, N.; Soyeurt, H.; Dehareng, F.; Bastin, C.; Colinet, F.; Hammami, H.; Vanrobays, M.-L.; Lainé, A.; Vanderick, S.; Grelet, C.; et al. Capitalizing on fine milk composition for breeding and management of dairy cows. J. Dairy Sci. 2016, 99, 4071–4079. [Google Scholar] [CrossRef] [PubMed]
- Preethi, K.A.; Sekar, D. Dietary microRNAs: Current status and perspective in food science. J. Food Biochem. 2021, 45, e13827. [Google Scholar] [CrossRef] [PubMed]
- Pokharel, K.; Peippo, J.; Li, M.; Kantanen, J. Identification and characterization of miRNAs during early pregnancy in domestic sheep. Anim. Genet. 2020, 51, 833–836. [Google Scholar] [CrossRef] [PubMed]
- Kaczmarek, M.M.; Najmula, J.; Guzewska, M.M.; Przygrodzka, E. MiRNAs in the Peri-Implantation Period: Contribution to Embryo–Maternal Communication in Pigs. Int. J. Mol. Sci. 2020, 21, 2229. [Google Scholar] [CrossRef]
- Morales-Prieto, D.M.; Favaro, R.R.; Markert, U.R. Placental miRNAs in feto-maternal communication mediated by extracellular vesicles. Placenta 2020, 102, 27–33. [Google Scholar] [CrossRef] [PubMed]
- Salilew-Wondim, D.; Gebremedhn, S.; Hoelker, M.; Tholen, E.; Hailay, T.; Tesfaye, D. The Role of MicroRNAs in Mammalian Fertility: From Gametogenesis to Embryo Implantation. Int. J. Mol. Sci. 2020, 21, 585. [Google Scholar] [CrossRef]
- Kabekkodu, S.P.; Shukla, V.; Varghese, V.K.; Souza, J.D.; Chakrabarty, S.; Satyamoorthy, K. Clustered miRNAs and their role in biological functions and diseases. Biol. Rev. 2018, 93, 1955–1986. [Google Scholar] [CrossRef]
- Hong, A.V.; Bourg, N.; Sanatine, P.; Poupiot, J.; Charton, K.; Gicquel, E.; Massourides, E.; Spinazzi, M.; Richard, I.; Israeli, D. Dlk1-Dio3 cluster miRNAs regulate mitochondrial functions in the dystrophic muscle in Duchenne muscular dystrophy. Life Sci. Alliance 2022, 6, e202201506. [Google Scholar] [CrossRef] [PubMed]
- Sanson, M.; Hong, A.V.; Massourides, E.; Bourg, N.; Suel, L.; Amor, F.; Corre, G.; Bénit, P.; Barthélémy, I.; Blot, S.; et al. miR-379 links glucocorticoid treatment with mitochondrial response in Duchenne muscular dystrophy. Sci. Rep. 2020, 10, 1–17. [Google Scholar] [CrossRef] [PubMed]
- Amor, F.; Hong, A.V.; Corre, G.; Sanson, M.; Suel, L.; Blaie, S.; Servais, L.; Voit, T.; Richard, I.; Israeli, D. Cholesterol metabolism is a potential therapeutic target in Duchenne muscular dystrophy. J. Cachex- Sarcopenia Muscle 2021, 12, 677–693. [Google Scholar] [CrossRef]
- Walling, G.A.; Visscher, P.M.; Wilson, A.D.; McTeir, B.L.; Simm, G.; Bishop, S.C. Mapping of quantitative trait loci for growth and carcass traits in commercial sheep populations1. J. Anim. Sci. 2004, 82, 2234–2245. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Liu, J.; Zhao, F.; Ren, H.; Xu, L.; Lu, J.; Zhang, S.; Zhang, X.; Wei, C.; Lu, G.; et al. Genome-Wide Association Studies for Growth and Meat Production Traits in Sheep. PLoS ONE 2013, 8, e66569. [Google Scholar] [CrossRef] [PubMed]
- Shandilya, U.K.; Sharma, A.; Naylor, D.; Canovas, A.; Mallard, B.; Karrow, N.A. Expression Profile of miRNA from High, Middle, and Low Stress-Responding Sheep during Bacterial Endotoxin Challenge. Animals 2023, 13, 508. [Google Scholar] [CrossRef]
- Sharma, A.; Shandilya, U.K.; Sullivan, T.; Naylor, D.; Canovas, A.; Mallard, B.A.; Karrow, N.A. Identification of Ovine Serum miRNAs Following Bacterial Lipopolysaccharide Challenge. Int. J. Mol. Sci. 2020, 21, 7920. [Google Scholar] [CrossRef] [PubMed]
- Sharma, A.; Shandilya, U.K.; Sullivan, T.; Naylor, D.; Cánovas, A.; Mallard, B.; Karrow, N. PSXIV-20 Ovine circulatory markers regulating the acute-phase response of variable stress responding sheep to LPS challenge. J. Anim. Sci. 2021, 99, 494–495. [Google Scholar] [CrossRef]
- E Peter, M. Targeting of mRNAs by multiple miRNAs: the next step. Oncogene 2010, 29, 2161–2164. [Google Scholar] [CrossRef]
- Wu, S.; Huang, S.; Ding, J.; Zhao, Y.; Liang, L.; Liu, T.; He, X. Multiple microRNAs Modulate p21Cip1/Waf1 Expression by Directly Targeting Its 3′ Untranslated Region. Oncogene. 2010, 29, 2302–2308. [Google Scholar] [CrossRef]
- DeVeale, B.; Swindlehurst-Chan, J.; Blelloch, R. The roles of microRNAs in mouse development. Nat. Rev. Genet. 2021, 22, 307–323. [Google Scholar] [CrossRef] [PubMed]
- Junho, C.V.C.; Caio-Silva, W.; Trentin-Sonoda, M.; Carneiro-Ramos, M.S. An Overview of the Role of Calcium/Calmodulin-Dependent Protein Kinase in Cardiorenal Syndrome. Front. Physiol. 2020, 11, 735. [Google Scholar] [CrossRef] [PubMed]
- Ichinose, K.; Juang, Y.; Crispín, J.C.; Kis-Toth, K.; Tsokos, G.C. Suppression of autoimmunity and organ pathology in lupus-prone mice upon inhibition of calcium/calmodulin-dependent protein kinase type IV. Arthritis Rheum. 2010, 63, 523–529. [Google Scholar] [CrossRef] [PubMed]
- Gu, R.; Ding, M.; Shi, D.; Huang, T.; Guo, M.; Yu, L.; Hu, J.; Huang, W.; Liao, H. Calcium/Calmodulin-Dependent Protein Kinase IV Mediates IFN-γ-Induced Immune Behaviors in Skeletal Muscle Cells. Cell. Physiol. Biochem. 2018, 46, 351–364. [Google Scholar] [CrossRef] [PubMed]
- Umeda, K.; Negishi, M.; Katoh, H. RasGRF1 mediates brain-derived neurotrophic factor-induced axonal growth in primary cultured cortical neurons. Biochem. Biophys. Rep. 2018, 17, 56–64. [Google Scholar] [CrossRef] [PubMed]
- Rentería, I.; García-Suárez, P.C.; Fry, A.C.; Moncada-Jiménez, J.; Machado-Parra, J.P.; Antunes, B.M.; Jiménez-Maldonado, A. The Molecular Effects of BDNF Synthesis on Skeletal Muscle: A Mini-Review. Front. Physiol. 2022, 13, 934714. [Google Scholar] [CrossRef]
- Mousavi, K.; Jasmin, B.J. BDNF is Expressed in Skeletal Muscle Satellite Cells and Inhibits Myogenic Differentiation. J. Neurosci. 2006, 26, 5739–49. [Google Scholar] [CrossRef]
- Mousavi, K.; Parry, D.J.; Jasmin, B.J. BDNF rescues myosin heavy chain IIB muscle fibers after neonatal nerve injury. Am. J. Physiol. Physiol. 2004, 287, C22–C29. [Google Scholar] [CrossRef]
- Chen, X.; Ji, Y.; Liu, R.; Zhu, X.; Wang, K.; Yang, X.; Liu, B.; Gao, Z.; Huang, Y.; Shen, Y.; et al. Mitochondrial dysfunction: roles in skeletal muscle atrophy. J. Transl. Med. 2023, 21, 1–24. [Google Scholar] [CrossRef]
- Papaioannou, G.; Inloes, J.B.; Nakamura, Y.; Paltrinieri, E.; Kobayashi, T. let-7 and miR-140 microRNAs coordinately regulate skeletal development. Proc. Natl. Acad. Sci. 2013, 110, E3291–E3300. [Google Scholar] [CrossRef]
- Yan, X.; Huang, Y.; Zhao, J.-X.; Rogers, C.J.; Zhu, M.-J.; Ford, S.P.; Nathanielsz, P.W.; Du, M. Maternal obesity downregulates microRNA let-7g expression, a possible mechanism for enhanced adipogenesis during ovine fetal skeletal muscle development. Int. J. Obes. 2012, 37, 568–575. [Google Scholar] [CrossRef] [PubMed]
- Jones, A.K.; Hoffman, M.L.; Pillai, S.M.; McFadden, K.K.; E Govoni, K.; A Zinn, S.; A Reed, S. Gestational restricted- and over-feeding promote maternal and offspring inflammatory responses that are distinct and dependent on diet in sheep†. Biol. Reprod. 2017, 98, 184–196. [Google Scholar] [CrossRef]
- Zhang, S.; Ding, J.; Zhang, Y.; Liu, S.; Yang, J.; Yin, T. Regulation and Function of Chemokines at the Maternal–Fetal Interface. Front. Cell Dev. Biol. 2022, 10, 826053. [Google Scholar] [CrossRef]
- Ngom, P.T.; Collinson, A.C.; Pido-Lopez, J.; Henson, S.M.; Prentice, A.M.; Aspinall, R. Improved thymic function in exclusively breastfed infants is associated with higher interleukin 7 concentrations in their mothers' breast milk. Am. J. Clin. Nutr. 2004, 80, 722–728. [Google Scholar] [CrossRef] [PubMed]
- Aspinall, R.; Prentice, A.M.; Ngom, P.T. Interleukin 7 from Maternal Milk Crosses the Intestinal Barrier and Modulates T-Cell Development in Offspring. PLOS ONE 2011, 6, e20812. [Google Scholar] [CrossRef] [PubMed]
- Bennett, J.L.; Pratt, A.G.; Dodds, R.; Sayer, A.A.; Isaacs, J.D. Rheumatoid sarcopenia: loss of skeletal muscle strength and mass in rheumatoid arthritis. Nat. Rev. Rheumatol. 2023, 19, 239–251. [Google Scholar] [CrossRef]
- Steinz, M.M.; Santos-Alves, E.; Lanner, J.T. Skeletal muscle redox signaling in rheumatoid arthritis. Clin. Sci. 2020, 134, 2835–2850. [Google Scholar] [CrossRef]
- Rossatti, P.; Redpath, G.M.I.; Ziegler, L.; Samson, G.P.B.; Clamagirand, C.D.; Legler, D.F.; Rossy, J. Rapid increase in transferrin receptor recycling promotes adhesion during T cell activation. BMC Biol. 2022, 20, 1–21. [Google Scholar] [CrossRef]
| Transcript ID (Array Design) | miRBase ID | Fold change | p-value | Style | Mature sequence | OAR |
|---|---|---|---|---|---|---|
| LP vs. HP | ||||||
| oar-miR-3957-5p | MIMAT0019325 | 4.58 | 0.04 | up | cucggagaguggagcugugggugu | 18 |
| oar-miR-329a-3p | MIMAT0019266 | 2.96 | 0.04 | up | aacacaccugguuaaccuuuuu | 18 |
| SP vs. HP | ||||||
| oar-miR-3957-5p | MIMAT0019325 | 4.25 | 0.005 | up | cucggagaguggagcugugggugu | 18 |
| oar-miR-432 | MIMAT0001416 | 2.47 | 0.007 | up | ucuuggaguaggucauugggugg | 18 |
| oar-miR-200c | MIMAT0030044 | 2.24 | 0.009 | up | uaauacugccggguaaugaugg | 3 |
| oar-miR-362 | MIMAT0030060 | 2.24 | 0.01 | up | aauccuuggaaccuaggugugagu | X |
| oar-miR-409-3p | MIMAT0019328 | 2.2 | 0.01 | up | cgaauguugcucggugaaccccu | 18 |
| oar-let-7c | MIMAT0014964 | 2.18 | 0.01 | up | ugagguaguagguuguaugguu | 1 |
| oar-miR-493-3p | MIMAT0019238 | 2.17 | 0.01 | up | ugaaggucuacugugugccagg | 18 |
| oar-miR-181a | MIMAT0014973 | 2.12 | 0.02 | up | aacauucaacgcugucggugagu | 12 |
| oar-miR-379-5p | MIMAT0019247 | 2.11 | 0.02 | up | ugguagacuauggaacguaggc | 18 |
| oar-miR-134-5p | MIMAT0019308 | 2.1 | 0.03 | up | ugugacugguugaccagaggg | 18 |
| oar-miR-127 | MIMAT0001415 | 2.04 | 0.04 | up | aucggauccgucugagcuuggcu | 18 |
| SP vs. LP | ||||||
| oar-miR-200c | MIMAT0030044 | 2.45 | 0.01 | up | uaauacugccggguaaugaugg | 3 |
| Category | Gene ontology term | Set size | Candidates contained | p-value | q-value |
|---|---|---|---|---|---|
| Biological process | GO:0048247 lymphocyte chemotaxis | 65 | 3 (4.6%) | 9.74e-05 | 0.00792 |
| GO:0002548 monocyte chemotaxis | 71 | 3 (4.2%) | 0.000127 | 0.00792 | |
| GO:0051171 regulation of nitrogen compound metabolic process | 6033 | 17 (0.3%) | 0.000574 | 0.0199 | |
| GO:0071621 granulocyte chemotaxis | 124 | 3 (2.4%) | 0.000655 | 0.0199 | |
| GO:0080090 regulation of primary metabolic process | 6227 | 17 (0.3%) | 0.000863 | 0.0199 | |
| GO:0031323 regulation of cellular metabolic process | 6297 | 17 (0.3%) | 0.000996 | 0.0199 | |
| GO:0097530 granulocyte migration | 149 | 3 (2.0%) | 0.00111 | 0.0199 | |
| GO:0006796 phosphate-containing compound metabolic process | 3342 | 11 (0.3%) | 0.0032 | 0.0419 | |
| GO:0044271 cellular nitrogen compound biosynthetic process | 5019 | 14 (0.3%) | 0.0032 | 0.0419 | |
| GO:0009059 macromolecule biosynthetic process | 5040 | 14 (0.3%) | 0.00335 | 0.0419 | |
| GO:0060255 regulation of macromolecule metabolic process | 6339 | 16 (0.3%) | 0.0037 | 0.042 | |
| GO:0044267 cellular protein metabolic process | 5282 | 14 (0.3%) | 0.00531 | 0.0553 | |
| GO:0034976 response to endoplasmic reticulum stress | 298 | 3 (1.0%) | 0.00779 | 0.0602 | |
| GO:0034654 nucleobase-containing compound biosynthetic process | 4307 | 12 (0.3%) | 0.00786 | 0.0602 | |
| GO:0060326 cell chemotaxis | 305 | 3 (1.0%) | 0.00837 | 0.0602 | |
| GO:0048638 regulation of developmental growth | 306 | 3 (1.0%) | 0.00845 | 0.0602 | |
| GO:0018130 heterocycle biosynthetic process | 4372 | 12 (0.3%) | 0.00889 | 0.0602 | |
| GO:0019438 aromatic compound biosynthetic process | 4383 | 12 (0.3%) | 0.00908 | 0.0602 | |
| GO:0034645 cellular macromolecule biosynthetic process | 4976 | 13 (0.3%) | 0.00916 | 0.0602 | |
|
Molecular function |
GO:0005125 cytokine activity | 237 | 4 (1.7%) | 0.000299 | 0.00459 |
| GO:0005126 cytokine receptor binding | 273 | 4 (1.5%) | 0.00051 | 0.00459 | |
| GO:0019887 protein kinase regulator activity | 190 | 3 (1.6%) | 0.00224 | 0.0134 | |
| GO:0048018 receptor ligand activity | 493 | 4 (0.8%) | 0.00445 | 0.0164 | |
| GO:0019210 kinase inhibitor activity | 73 | 2 (2.7%) | 0.00456 | 0.0134 | |
| GO:0001664 G protein-coupled receptor binding | 294 | 3 (1.0%) | 0.00757 | 0.0227 |
| Pathway name | Set size | Candidates contained | p-value | q-value | Pathway source |
|---|---|---|---|---|---|
| Chemokine receptors bind chemokines | 62 | 3 (4.8%) | 0.000117 | 0.00397 | Reactome |
| COVID-19 adverse outcome pathway | 15 | 2 (13.3%) | 0.000241 | 0.00397 | Wikipathways |
| Rheumatoid arthritis - Homo sapiens (human) | 93 | 3 (3.3%) | 0.000378 | 0.00397 | KEGG |
| Viral protein interaction with cytokine and cytokine receptor - Homo sapiens (human) | 100 | 3 (3.0%) | 0.000483 | 0.00397 | KEGG |
| Chagas disease - Homo sapiens (human) | 102 | 3 (2.9%) | 0.000512 | 0.00397 | KEGG |
| Toll-like receptor signaling pathway - Homo sapiens (human) | 104 | 3 (2.9%) | 0.000542 | 0.00397 | KEGG |
| IL-7 signaling pathway | 25 | 2 (8.0%) | 0.000683 | 0.00429 | Wikipathways |
| Cytokine-cytokine receptor interaction - Homo sapiens (human) | 295 | 4 (1.4%) | 0.00102 | 0.00558 | KEGG |
| Cyclin D associated events in G1 | 44 | 2 (4.5%) | 0.00212 | 0.00931 | Reactome |
| G1 Phase | 44 | 2 (4.5%) | 0.00212 | 0.00931 | Reactome |
| Chemokine signaling pathway - Homo sapiens (human) | 192 | 3 (1.6%) | 0.00316 | 0.0126 | KEGG |
| Peptide ligand-binding receptors | 207 | 3 (1.4%) | 0.00391 | 0.0143 | Reactome |
| Lipid and atherosclerosis - Homo sapiens (human) | 215 | 3 (1.4%) | 0.00435 | 0.0146 | KEGG |
| Human cytomegalovirus infection - Homo sapiens (human) | 225 | 3 (1.3%) | 0.00493 | 0.0146 | KEGG |
| DNA damage response | 68 | 2 (2.9%) | 0.00498 | 0.0146 | Wikipathways |
| E2F transcription factor network | 75 | 2 (2.7%) | 0.00603 | 0.0166 | PID |
| Category level | GO term | Set size | Candidates contained | p-value | q-value |
|---|---|---|---|---|---|
| Biological process | GO:0034645 cellular macromolecule biosynthetic process | 4976 | 30 (0.6%) | 6.54e-06 | 0.000634 |
| GO:0009059 macromolecule biosynthetic process | 5040 | 30 (0.6%) | 8.62e-06 | 0.000634 | |
| GO:0009889 regulation of biosynthetic process | 4310 | 27 (0.6%) | 1.38e-05 | 0.000676 | |
| GO:0044271 cellular nitrogen compound biosynthetic process | 5019 | 29 (0.6%) | 2.59e-05 | 0.000881 | |
| GO:0010467 gene expression | 5644 | 31 (0.5%) | 2.99e-05 | 0.000881 | |
| GO:0051171 regulation of nitrogen compound metabolic process | 6033 | 32 (0.5%) | 4.06e-05 | 0.000996 | |
| GO:0080090 regulation of primary metabolic process | 6227 | 32 (0.5%) | 8.1e-05 | 0.0017 | |
| GO:0031323 regulation of cellular metabolic process | 6297 | 32 (0.5%) | 0.000103 | 0.00189 | |
| GO:0060255 regulation of macromolecule metabolic process | 6339 | 32 (0.5%) | 0.000119 | 0.00195 | |
| GO:0018130 heterocycle biosynthetic process | 4372 | 25 (0.6%) | 0.000176 | 0.00259 | |
| GO:0090304 nucleic acid metabolic process | 5270 | 28 (0.5%) | 0.0002 | 0.00267 | |
| GO:1901362 organic cyclic compound biosynthetic process | 4529 | 25 (0.6%) | 0.000316 | 0.00387 | |
| GO:0034654 nucleobase-containing compound biosynthetic process | 4307 | 24 (0.6%) | 0.000393 | 0.00445 | |
| GO:0019438 aromatic compound biosynthetic process | 4383 | 24 (0.5%) | 0.000516 | 0.00542 | |
| GO:0009892 negative regulation of metabolic process | 3076 | 18 (0.6%) | 0.00172 | 0.0169 | |
| GO:0050779 RNA destabilization | 36 | 2 (5.6%) | 0.00478 | 0.0421 | |
| GO:0009893 positive regulation of metabolic process | 3654 | 19 (0.5%) | 0.00487 | 0.0421 | |
| GO:0051101 regulation of DNA binding | 124 | 3 (2.4%) | 0.00543 | 0.0439 | |
| GO:0072175 epithelial tube formation | 126 | 3 (2.4%) | 0.00568 | 0.0439 | |
| GO:0016331 morphogenesis of embryonic epithelium | 141 | 3 (2.1%) | 0.00774 | 0.0569 | |
| Molecular function |
GO:0003677 DNA binding | 2515 | 22 (0.9%) | 6.1e-07 | 7.63e-06 |
| GO:0001067 regulatory region nucleic acid binding | 1535 | 17 (1.1%) | 7.63e-07 | 7.63e-06 | |
| GO:0046872 metal ion binding | 4259 | 23 (0.5%) | 0.000869 | 0.00579 | |
| GO:0001228 DNA-binding transcription activator activity, RNA polymerase II-specific | 444 | 6 (1.4%) | 0.00164 | 0.00822 | |
| GO:0004879 nuclear receptor activity | 52 | 2 (3.8%) | 0.00978 | 0.0391 | |
| Cellular component |
GO:0031981 nuclear lumen | 4461 | 24 (0.5%) | 0.000678 | 0.0183 |
| GO:0005634 nucleus | 7626 | 33 (0.4%) | 0.00198 | 0.0183 | |
| GO:0005654 nucleoplasm | 4103 | 21 (0.5%) | 0.00341 | 0.0307 |
| Pathway name | Set size | Candidates contained | p-value | q-value | Pathway source |
|---|---|---|---|---|---|
| Rheumatoid arthritis - Homo sapiens (human) | 93 | 8 (8.7%) | 1.69e-05 | 0.00776 | KEGG |
| Transferrin endocytosis and recycling | 31 | 4 (12.9%) | 0.000533 | 0.0765 | Reactome |
| Oncogene Induced Senescence | 32 | 4 (12.5%) | 0.000603 | 0.0765 | Reactome |
| Small cell lung cancer - Homo sapiens (human) | 92 | 6 (6.5%) | 0.000935 | 0.0765 | KEGG |
| G1 to S cell cycle control | 64 | 5 (7.8%) | 0.00112 | 0.0765 | Wikipathways |
| Small cell lung cancer | 96 | 6 (6.2%) | 0.00117 | 0.0765 | Wikipathways |
| Adenosine ribonucleotides de novo biosynthesis | 38 | 4 (10.5%) | 0.00117 | 0.0765 | HumanCyc |
| RND1 GTPase cycle | 42 | 4 (9.5%) | 0.00171 | 0.0776 | Reactome |
| Human cytomegalovirus infection - Homo sapiens (human) | 225 | 9 (4.0%) | 0.00185 | 0.0776 | KEGG |
| RND2 GTPase cycle | 43 | 4 (9.3%) | 0.00186 | 0.0776 | Reactome |
| Cyclin D associated events in G1 | 44 | 4 (9.1%) | 0.00203 | 0.0776 | Reactome |
| G1 Phase | 44 | 4 (9.1%) | 0.00203 | 0.0776 | Reactome |
| Cyclins and cell cycle regulation | 23 | 3 (13.0%) | 0.00269 | 0.0948 | BioCarta |
| Spinal Cord Injury | 117 | 6 (5.1%) | 0.00319 | 0.104 | Wikipathways |
| Cell cycle: g1/s check point | 25 | 3 (12.0%) | 0.00343 | 0.105 | BioCarta |
| Insulin receptor recycling | 26 | 3 (11.5%) | 0.00384 | 0.109 | Reactome |
| Collecting duct acid secretion - Homo sapiens (human) | 27 | 3 (11.1%) | 0.00429 | 0.109 | KEGG |
| Constitutive Signaling by AKT1 E17K in Cancer | 27 | 3 (11.1%) | 0.00429 | 0.109 | Reactome |
| Lipid and atherosclerosis - Homo sapiens (human) | 215 | 8 (3.7%) | 0.00508 | 0.119 | KEGG |
| Iron uptake and transport | 57 | 4 (7.0%) | 0.00523 | 0.119 | Reactome |
| Superpathway of purine nucleotide salvage | 59 | 4 (6.8%) | 0.00591 | 0.119 | HumanCyc |
| Purine nucleotides de novo biosynthesis | 59 | 4 (6.8%) | 0.00591 | 0.119 | HumanCyc |
| Oxidative phosphorylation - Homo sapiens (human) | 133 | 6 (4.5%) | 0.00597 | 0.119 | KEGG |
| Prion disease - Homo sapiens (human) | 273 | 9 (3.3%) | 0.00661 | 0.126 | KEGG |
| Chemokine receptors bind chemokines | 62 | 4 (6.5%) | 0.00704 | 0.129 | Reactome |
| Vitamin D Receptor Pathway | 184 | 7 (3.8%) | 0.00765 | 0.13 | Wikipathways |
| Viral protein interaction with cytokine and cytokine receptor - Homo sapiens (human) | 100 | 5 (5.0%) | 0.00776 | 0.13 | KEGG |
| Ectoderm Differentiation | 142 | 6 (4.2%) | 0.00814 | 0.13 | Wikipathways |
| Amino acids regulate mTORC1 | 34 | 3 (8.8%) | 0.00824 | 0.13 | Reactome |
| ROS and RNS production in phagocytes | 35 | 3 (8.6%) | 0.00893 | 0.135 | Reactome |
| Toll-like receptor signaling pathway - Homo sapiens (human) | 104 | 5 (4.8%) | 0.00912 | 0.135 | KEGG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).