Submitted:
17 February 2024
Posted:
20 February 2024
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Materials and Methods
2.1. Study Population and Sample Procedures
2.2. Isolation and Identification of Capnocytophaga spp.
2.3. Statistical Analysis
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Holt, C.S. Capnocytophaga. In Bergey’s Manual of Systematics of Archaea and Bacteria; Whitman, B.W. Publisher John Wiley & Sons, Inc, 2015. [CrossRef]
- Zangenah, S.; Abbasi, N.; Andersson, A.F.; Bergman, P. Whole Genome Sequencing Identifies a Novel Species of the Genus Capnocytophaga Isolated from Dog and Cat Bite Wounds in Humans. Scientific Reports 2016, 6. [Google Scholar] [CrossRef] [PubMed]
- Lai, C.-H.; Lin, Y.-S.; Wang, C.-M.; Chang, P.-C.; Shia, W.-Y. A Novel 16S RRNA PCR-Restriction Fragment Length Polymorphism Assay to Accurately Distinguish Zoonotic Capnocytophaga Canimorsus and C. Cynodegmi. Microbiology Spectrum 2023, 11, e0291622. [Google Scholar] [CrossRef] [PubMed]
- Butler, T. Capnocytophaga Canimorsus: An Emerging Cause of Sepsis, Meningitis, and Post-Splenectomy Infection after Dog Bites. European journal of clinical microbiology & infectious diseases: Official publication of the European Society of Clinical Microbiology 2015, 34, 1271–1280. [Google Scholar] [CrossRef]
- Kotrashetti, V.; Idate, U.; Bhat, K.; Kulkarni, R.; Kugaji, M.; Kumbar, V. Comparison of Culture and Polymerase Chain Reaction–Restriction Fragment Length Polymorphism for Identification of Various Capnocytophaga Species from Subgingival Plaque Samples of Healthy and Periodontally Diseased Individuals. Journal of Oral and Maxillofacial Pathology 2022, 26, 287. [Google Scholar] [CrossRef] [PubMed]
- Tabatabaei, M.; Rouhani, H.R. Polymerase Chain Reaction Detection of Capnocytophaga Canimorsus and Capnocytophaga Cynodegmi as the Emerging Zoonosis. Avicenna Journal of Clinical Microbiology and Infection 2019, 6, 21–25. [Google Scholar] [CrossRef]
- Hansen, M.; Crum-Cianflone, N.F. Capnocytophaga Canimorsus Meningitis: Diagnosis Using Polymerase Chain Reaction Testing and Systematic Review of the Literature. Infectious Diseases and Therapy 2019, 8, 119–136. [Google Scholar] [CrossRef] [PubMed]
- Beauruelle, C.; Plouzeau, C.; Grillon, A.; Isnard, C.; Corvec, S.; Degand, N.; Jacquier, H.; Amara, M.; Mizrahi, A.; Diedrich, T.; et al. Capnocytophaga Zoonotic Infections: A 10-Year Retrospective Study (the French CANCAN Study). European Journal of Clinical Microbiology & Infectious Diseases 2022, 41, 581–588. [Google Scholar] [CrossRef]
- 9. Nogueira, B.S.; Martini, A. de C.; Menezes, I. de G.; Souza, R.L. de; Maruyama, F.H.; Rodrigues, J.Y.; Nakazato, L.; Dutra, V. Detection of Capnocytophaga Canimorsus and Capnocytophaga Cynodegmi in Dogs with Periodontal Disease of Brazil. Research, Society and Development 2021, 10, e245101321146. [CrossRef]
- Oba, P.M.; Sieja, K.M.; Keating, S.C.J.; Hristova, T.; Somrak, A.J.; Swanson, K.S. Oral Microbiota Populations of Adult Dogs Consuming Wet or Dry Foods. Journal of Animal Science 2022. [Google Scholar] [CrossRef] [PubMed]
- Wallis, C.; Marshall, M.; Colyer, A.; O’Flynn, C.; Deusch, O.; Harris, S. A Longitudinal Assessment of Changes in Bacterial Community Composition Associated with the Development of Periodontal Disease in Dogs. Veterinary Microbiology 2015, 181, 271–282. [Google Scholar] [CrossRef] [PubMed]
- Lisjak, A.; Correa Lopes, B.; Pilla, R.; Nemec, A.; Suchodolski, J.; Tozon, N. A Comparison of the Oral Microbiota in Healthy Dogs and Dogs with Oral Tumors. Animals 2023, 13, 3594. [Google Scholar] [CrossRef] [PubMed]
- Oba, P.M.; Carroll, M.Q.; Alexander, C.; Valentine, H.; Somrak, A.J.; Keating, S.C.J.; Sage, A.M.; Swanson, K.S. Microbiota Populations in Supragingival Plaque, Subgingival Plaque, and Saliva Habitats of Adult Dogs. Animal Microbiome 2021, 3. [Google Scholar] [CrossRef] [PubMed]
- Oba, P.M.; Carroll, M.Q.; Alexander, C.; Somrak, A.J.; Keating, S.C.J.; Sage, A.M.; Swanson, K.S. Dental Chews Positively Shift the Oral Microbiota of Adult Dogs. Journal of Animal Science 2021. [Google Scholar] [CrossRef] [PubMed]
- Ruparell, A.; Warren, M.; Staunton, R.; Deusch, O.; Dobenecker, B.; Wallis, C.; O’Flynn, C.; McGenity, P.; Holcombe, L.J. Effect of Feeding a Daily Oral Care Chew on the Composition of Plaque Microbiota in Dogs. Research in Veterinary Science 2020, 132, 133–141. [Google Scholar] [CrossRef] [PubMed]
- Barbosa, E.; Pires, P.G.S.; Hauptli, L.; Moraes, P. Strategies to Improve the Home Care of Periodontal Disease in Dogs: A Systematic Review. Research in Veterinary Science 2023, 154, 8–14. [Google Scholar] [CrossRef]
- Umeda, K.; Hatakeyama, R.; Abe, T.; Takakura, K.; Wada, T.; Ogasawara, J.; Sanada, S.; Hase, A. Distribution of Capnocytophaga Canimorsus in Dogs and Cats with Genetic Characterization of Isolates. Veterinary Microbiology 2014, 171, 153–159. [Google Scholar] [CrossRef]

| Bacterium | Primer 1 | Primer 2 |
|---|---|---|
|
Capnocytophaga genus; CAL2-AS2 |
CAL2: 5′GTAGAGTGCTTCGGCACTTG3′ | AS2: 5′GTGATGCCACCAAACAATACTA3′ |
|
C. canimorsus; CAL2-CaR |
CAL2: 5′GTAGAGTGCTTCGGCACTTG3′ | CaR: 5′GCCGATGCTTATTCATACA3′ |
|
C. cynodegmi; CAL2-CyR |
CAL2: 5′GTAGAGTGCTTCGGCACTTG3′ | CyR: 5′GCGGATGCTTATTCGTATG3′ |
| Dogs with Changes in the Oral Cavity | Dogs without Changes in the Oral Cavity | ||
|---|---|---|---|
| Number of samples | n (%) | 73 (69.52) | 32 (30.48) |
| Location of swabs (%) | Teeth | 65.75 | 46.88 |
| Oral cavity excluding teeth |
34.25 | 52.12 | |
| Age of dog (%) | <1 year | 5.48 | 9.38 |
| 1–5 years | 36.99 | 65.62 | |
| 6–10 years | 36.99 | 21.88 | |
| >10 years | 20.55 | 3.12 | |
| Tooth brushing (%) | Yes | 26.03 | 34.38 |
| No | 73.97 | 65.62 | |
| Giving chews to dog (%) | Yes | 68.49 | 62.50 |
| No | 31.51 | 37.50 | |
| Household | Number of dogs | Positive dogs n (%) |
||
|---|---|---|---|---|
| Capnocytophaga spp | C. cynodegmi | C. canimorsus | ||
| 1 | 2 | 1 (50) | 0 (0) | 1 (50) |
| 2 | 2 | 1 (50) | 1(50) | 1 (50) |
| 3 | 2 | 2 (100) | 1 (50) | 2 (100) |
| 4 | 2 | 2 (100) | 2 (100) | 1 (50) |
| 5 | 4 | 2 (50) | 2 (50) | 0 (0) |
| 6 | 2 | 1 (50) | 1(50) | 1 (50) |
| 7 | 2 | 0 (0) | 0 (0) | 0 (0) |
| 8 | 3 | 1 (33.33) | 1 (33.33) | 1 (33.33) |
| 9 | 2 | 0 (0) | 0 (0) | 0 (0) |
| 10 | 3 | 2 (66.66) | 2 (66.66) | 2 (66.66) |
| 11 | 2 | 1(50) | 1 (50) | 0 (0) |
| 12 | 2 | 1(50) | 1 (50) | 1 (50) |
| 13 | 2 | 1(50) | 1 (50) | 1 (50) |
| 14 | 3 | 3 (100) | 2 (66.66) | 3 (100) |
| 15 | 2 | 0 (0) | 0 (0) | 0 (0) |
| 16 | 2 | 2 (100) | 0 (0) | 2 (100) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).