Submitted:
19 February 2024
Posted:
20 February 2024
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Materials and Methods
2.1. Preparation of SOE
2.2. Administration of Experimental Animals
2.3. Experimental Design
2.4. Hematoxylin and Eosin Stain
2.5. Assay of ROS Content in Tumor Tissue
2.6. Gene Expression in Hepatoma Tissue
2.7. Protein Expression in Hepatoma Tissue
2.8. Analysis of Pro-Inflammatory Cytokine Content
2.9. Analysis of Chemical Composition
2.10. Statistical Analysis
3. Results
3.1. Effects of SOE Intervention on the Growth of Hepatoma In Vivo
3.2. Effect of SOE Intervention on Bcl-2 Expression in Tumor Tissue
3.3. Effects of SOE Intervention on ROS Content and Antioxidant System in Tumor Tissue
3.4. Effects of SOE Intervention on the Expression of Anti-Angiogenesis and Anti-Migration Genes in Tumor Tissue
3.5. Expression of Pro-Inflammatory Cytokines in Tumor Tissue and Serum
3.6. Chemical Composition of SOE
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Sung, H.; Ferlay, J.; Siegel, R.L.; Laversanne, M.; Soerjomataram, I.; Jemal, A.; Bray, F. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA: Cancer J. Clin 2021, 71, 209–249. [Google Scholar] [CrossRef] [PubMed]
- Rawla, P.; Sunkara, T.; Muralidharan, P.; Raj, J.P. Update in global trends and aetiology of hepatocellular carcinoma. Contemp. Oncol. (Pozn) 2018, 22, 141–150. [Google Scholar] [CrossRef] [PubMed]
- Nakamura, H.; Takada, K. Reactive oxygen species in cancer: Current findings and future directions. Cancer Sci. 2021, 112, 3945–3952. [Google Scholar] [CrossRef] [PubMed]
- Xu, J.; Ji, L.; Ruan, Y.; Wan, Z.; Lin, Z.; Xia, S.; Tao, L.; Zheng, J.; Cai, L.; Wang, Y.; Liang, X.; Cai, X. UBQLN1 mediates sorafenib resistance through regulating mitochondrial biogenesis and ROS homeostasis by targeting PGC1β in hepatocellular carcinoma. Signal Transduct. Target. Ther. 2021, 6, 190. [Google Scholar] [CrossRef] [PubMed]
- Cheung, E.C.; Vousden, K.H. The role of ROS in tumour development and progression. Nat. Rev. Cancer 2022, 22, 280–297. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Zhao, X.; Fu, J.; Xu, W.; Yuan, J. The role of tumour metabolism in cisplatin resistance. Front. Mol. Biosci. 2021, 8, 691795. [Google Scholar] [CrossRef] [PubMed]
- Milkovic, L.; Cipak Gasparovic, A.; Cindric, M.; Mouthuy, P.A.; Zarkovic, N. Short overview of ROS as cell function Regulators and their implications in therapy concepts. Cells 2019, 8, 793. [Google Scholar] [CrossRef]
- Farnsworth, R.H.; Lackmann, M.; Achen, M.G.; Stacker, S.A. Vascular remodeling in cancer. Oncogene 2014, 33, 3496–3505. [Google Scholar] [CrossRef]
- Lugano, R.; Ramachandran, M.; Dimberg, A. Tumor angiogenesis: causes, consequences, challenges and opportunities. Cell. Mol. Life Sci. 2020, 77, 1745–1770. [Google Scholar] [CrossRef]
- Perrin, L.; Gligorijevic, B. Proteolytic and mechanical remodeling of the extracellular matrix by invadopodia in cancer. Phys. Biol. 2022, 20, 10. [Google Scholar] [CrossRef]
- Chen, Q.F.; Shi, F.; Huang, T.; Huang, C.; Shen, L.; Wu, P.; Li, W. ASTN1 is associated with immune infiltrates in hepatocellular carcinoma, and inhibits the migratory and invasive capacity of liver cancer via the Wnt/β-catenin signaling pathway. Oncol. Rep. 2020, 44, 1425–1440. [Google Scholar] [CrossRef] [PubMed]
- Ma, X.; Wang, J.; Zhuang, J.; Ma, X.; Zheng, N.; Song, Y.; Xia, W. P4HB modulates epithelial-mesenchymal transition and the β-catenin/Snail pathway influencing chemoresistance in liver cancer cells. Oncol. Lett. 2020, 20, 257–265. [Google Scholar] [CrossRef] [PubMed]
- Zhao, H.; Wu, L.; Yan, G.; Chen, Y.; Zhou, M.; Wu, Y.; Li, Y. Inflammation and tumor progression: Signaling pathways and targeted intervention. Signal Transduct. Target. Ther. 2021, 6, 263. [Google Scholar] [CrossRef] [PubMed]
- Nigam, M.; Mishra, A.P.; Deb, V.K.; Dimri, D.B.; Tiwari, V.; Bungau, S.G.; Bungau, A.F.; Radu, A.F. Evaluation of the association of chronic inflammation and cancer: Insights and implications. Biomed. Pharmacother. 2023, 164, 115015. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.; Yin, L.; Shen, S.; Hou, Y. Inflammation and cancer: paradoxical roles in tumorigenesis and implications in immunotherapies. Genes Dis. 2021, 10, 151–164. [Google Scholar] [CrossRef]
- Man, S.; Luo, C.; Yan, M.; Zhao, G.; Ma, L.; Gao, W. Treatment for liver cancer: From sorafenib to natural products. Eur. J. Med. Chem. 2021, 224, 113690. [Google Scholar] [CrossRef] [PubMed]
- Kim, D.B.; Lee, D.K.; Cheon, C.; Ribeiro, R.; Kim, B. Natural products for liver cancer treatment: from traditional medicine to modern drug discovery. Nutrients 2022, 14, 4252. [Google Scholar] [CrossRef] [PubMed]
- Wang, Q.; Liang, Y.Y.; Li, K.W.; Li, Y.; Niu, F.J.; Zhou, S.J.; Wei, H.C.; Zhou, C.Z. Herba Siegesbeckiae: A review on its traditional uses, chemical constituents, pharmacological activities and clinical studies. J. Ethnopharmacol. 2021, 275, 114117. [Google Scholar] [CrossRef]
- Chang, C.C.; Hsu, H.F.; Huang, K.H.; Wu, J.M.; Kuo, S.M.; Ling, X.H.; Houng, J.Y. Anti-proliferative effects of Siegesbeckia orientalis ethanol extract on human endometrial RL-95 cancer cells. Molecules 2014, 19, 19980–19994. [Google Scholar] [CrossRef]
- Chang, C.C.; Ling, X.H.; Hsu, H.F.; Wu, J.M.; Wang, C.P.; Yang, J.F.; Fang, L.W.; Houng, J.Y. Siegesbeckia orientalis extract inhibits TGFβ1-induced migration and invasion of endometrial cancer cells. Molecules 2016, 21, 1021. [Google Scholar] [CrossRef]
- Liu, N.; Wu, C.; Yu, J.H.; Zhu, K.K.; Song, M.n.; Yang, F.Y.; Feng, R.I.; Zhang, Y.Y.; Chang, W.Q.; Zhang, H. Germacrane-type sesquiterpenoids with cytotoxic activity from Sigesbeckia orientalis. Bioorg. Chem. 2019, 92, 103196. [Google Scholar] [CrossRef] [PubMed]
- Hsu, H.F.; Chen, Z.H.; Chang, S.F.; Wang, C.P.; Chiou, S.J.; Yen, J.H.; Chang, C.C.; Tsai, Y.D.; Fang, L.W.; Houng, J.Y. Evaluating the anti-metastatic potential of Anisomeles indica extract by using human oral squamous carcinoma FaDu cells. Afr. J. Pharm. Pharmacol. 2012, 6, 1782–1791. [Google Scholar]
- Crusz, S.M.; Balkwill, F.R. Inflammation and cancer: advances and new agents. Nat. Rev. Clin. Oncol. 2015, 12, 584–596. [Google Scholar] [CrossRef] [PubMed]
- Zhao, H.; Wu, L.; Yan, G.; Chen, Y.; Zhou, M.; Wu, Y.; Li, Y. Inflammation and tumor progression: Signaling pathways and targeted intervention. Signal Transduct Target. Ther. 2021, 6, 263. [Google Scholar] [CrossRef] [PubMed]
- Ritter, B.; Greten, F.R. Modulating inflammation for cancer therapy. J. Exp. Med. 2019, 216, 1234–1243. [Google Scholar] [CrossRef] [PubMed]
- Nakazawa, Y.; Kamijo, T.; Koike, K.; Noda, T. ARF tumor suppressor induces mitochondria-dependent apoptosis by modulation of mitochondrial Bcl-2 family proteins. J. Biol. Chem. 2003, 278, 27888–27895. [Google Scholar] [CrossRef] [PubMed]
- Cotter, T.G. Apoptosis and cancer: the genesis of a research field. Nat. Rev. Cancer 2009, 9, 501–507. [Google Scholar] [CrossRef]
- Ciccarone, F.; Castelli, S.; Ciriolo, M.R. Oxidative stress-driven autophagy acROSs onset and therapeutic outcome in hepatocellular carcinoma. Oxid. Med. Cell Longev. 2019, 2019, 1–10. [Google Scholar] [CrossRef]
- Bielenberg, D.R.; Zetter, B.R. The contribution of angiogenesis to the process of metastasis. Cancer J. 2015, 21, 267–273. [Google Scholar] [CrossRef]
- Khalid, E.B.; Ayman, E.E.; Rahman, H.; Abdelkarim, G.; Najda, A. Natural products against cancer angiogenesis. Tumour Biol. 2016, 37, 14513–14536. [Google Scholar] [CrossRef]
- Liu, Y.; Ren, W.; Bai, Y.; Wan, L.; Sun, X.; Liu, Y.; Xiong, W.; Zhang, Y.Y.; Zhou, L. Oxyresveratrol prevents murine H22 hepatocellular carcinoma growth and lymph node metastasis via inhibiting tumor angiogenesis and lymphangiogenesis. J. Nat. Med. 2018, 72, 481–492. [Google Scholar] [CrossRef] [PubMed]
- Scheau, C.; Badarau, I. A.; Costache, R.; Caruntu, C.; Mihai, G. L.; Didilescu, A. C.; Constantin, C.; Neagu, M. The role of matrix metalloproteinases in the epithelial-mesenchymal transition of hepatocellular carcinoma. Anal. Cell. Pathol. 2019, 2019, 9423907. [Google Scholar] [CrossRef] [PubMed]
- He, M.; Roussak, K.; Ma, F.; Borcherding, N.; Garin, V.; White, M.; Schutt, C.; Jensen, T. I.; Zhao, Y.; Iberg, C.A.; Shah, K.; Bhatia, H.; Korenfeld, D.; Dinkel, S.; Gray, J.; Ulezko Antonova, A.; Ferris, S.; Donermeyer, D.; Lindestam Arlehamn, C.; Gubin, M.M.; Luo, J.; Gorvel, L.; Pellegrini, M.; Sette, A.; Tung, T.; Bak, R.; Modlin, R.L.; Fields, R.C.; Schreiber, R.D.; Allen, P.M.; Klechevsky, E. CD5 expression by dendritic cells directs T cell immunity and sustains immunotherapy responses. Science 2023, 379, eabg2752. [Google Scholar] [CrossRef] [PubMed]
- Hong, Y.H.; Weng, L.W.; Chang, C.C.; Hsu, H.F.; Wang, C.P.; Wang, S.W.; Houng, J.Y. Anti-inflammatory effects of Siegesbeckia orientalis ethanol extract in in vitro and in vivo models. BioMed Res. Int. 2014, 2014, 1–10. [Google Scholar]
- Li, D.; Luo, D.; Hu, S.; Zhao, H.; Peng, B. Syringic acid suppressed proliferation, invasion, and migration via inhibition of matrix metalloproteinases expression on glioblastoma cells by promoting apoptosis. Curr. Pharm. Biotechnol. 2023, 24, 310–316. [Google Scholar] [PubMed]
- Pei, J.; Velu, P.; Zareian, M.; Feng, Z.; Vijayalakshmi, A. Effects of syringic acid on apoptosis, inflammation, and AKT/mTOR signaling pathway in gastric cancer cells. Front. Nutr. 2021, 8, 788929. [Google Scholar] [CrossRef] [PubMed]
- Yang, L.; Qu, C.; Jin, J.; Yang, H.; Pei, L. Syringic acid regulates suppression of the STAT3/JNK/AKT pathway via inhibition of human ovarian teratoma cancer cell (PA-1) growth—in vitro study. J. Biochem. Mol. Toxicol. 2021, 35, 1–9. [Google Scholar] [CrossRef]
- Wang, Y.; Xu, J.; Alarifi, S.; Wang, H. Kirenol inhibited the cell survival and induced apoptosis in human thyroid cancer cells by altering PI3K/AKT and MAP kinase signaling pathways. Environ. Toxicol. 2021, 36, 811–820. [Google Scholar] [CrossRef]
- Liu, W.; Li, Y.; Li, C. Kirenol exhibits the protective role against N-methyl-N-nitrosourea-induced gastric cancer in rats via modulating the oxidative stress and inflammatory markers. J. Environ. Pathol. Toxicol. Oncol. 2020, 39, 345–355. [Google Scholar] [CrossRef]
- Lu, Y.; Qian, R.; Xiao, J.; Xu, D.; Fu, H.; Chen, Y. Kirenol, a compound from Herba Siegesbeckiae, induces apoptosis in human chronic myeloid leukemia K562 cells. Pharmazie 2014, 69, 148–153. [Google Scholar]
- Chen, X.; Liu, B.; Tong, J.; Bo, J.; Feng, M.; Yin, L.; Lin, X. Chlorogenic acid inhibits proliferation, migration and invasion of pancreatic cancer cells via AKT/GSK-3β/β-catenin signaling pathway. Recent Pat. Anticancer Drug Discov. 2024, 19, 146–153. [Google Scholar] [CrossRef]
- Vélez-Vargas, L.C.; Santa-González, G.A.; Uribe, D.; Henao-Castañeda, I.C.; Pedroza-Díaz, J. In vitro and in silico study on the impact of chlorogenic acid in colorectal cancer cells: Proliferation, apoptosis, and interaction with β-catenin and LRP6. Pharmaceuticals 2023, 16, 276. [Google Scholar] [CrossRef]
- Li, W.; Ping, Z.; Xuemei, G.; Hongjuan, M.; Yi, H.; Xiaoli, L.; Zhongxiang, Z. Chlorogenic acid regulates the proliferation and migration of high-grade serous ovarian cancer cells through modulating the miR199a5p/DDR1 axis. Acta Biochim. Pol. 2022, 69, 855–864. [Google Scholar] [CrossRef] [PubMed]
- Sharma, G.; Kamboj, M.; Narwal, A.; Bhardwaj, R.; Yadav, P. Cytotoxic role of chlorogenic acid on oral squamous cell carcinoma cell line. Indian J. Otolaryngol. Head Neck Surg. 2022, 74 (Suppl. S3), 5773–5781. [Google Scholar] [CrossRef] [PubMed]
- Velusamy, P.; Muthusami, S.; Arumugam, R. In vitro evaluation of p-coumaric acid and naringin combination in human epidermoid carcinoma cell line (A431). Med. Oncol. 2023, 41, 4. [Google Scholar] [CrossRef]
- Tehami W, Nani A, Khan NA, Hichami A. New insights into the anticancer effects of p-coumaric acid: Focus on colorectal cancer. Dose Response 2023, 21, 15593258221150704. [Google Scholar]
- Yang, B.; Wang, B.; Wang, G.; Cao, W.; Wang, Q.; Pu, H.; An, W. p-Coumaric acid inhibits osteosarcoma growth by inhibiting PI3K/Akt signaling pathway. Anticancer Agents Med. Chem. 2023, 23, 1577–1586. [Google Scholar] [CrossRef] [PubMed]
- Oliva, M.A.; Castaldo, S.; Rotondo, R.; Staffieri, S.; Sanchez, M.; Arcella, A. Inhibiting effect of p-Coumaric acid on U87MG human glioblastoma cell growth. J. Chemother. 2022, 34, 173–183. [Google Scholar] [CrossRef]
- Jin, X.X.; Mei, Y.N.; Shen, Z.; Zhu, J.F.; Xing, S.H.; Yang, H.M.; Liang, G.; Zheng, X.H. A chalcone-syringaldehyde hybrid inhibits triple-negative breast cancer cell proliferation and migration by inhibiting CKAP2-mediated FAK and STAT3 phosphorylation. Phytomedicine 2022, 101, 154087. [Google Scholar] [CrossRef]








| Gene | Sequence |
|---|---|
| Bcl-2 | 5′- CTGAGTACCTGAACCGGCA -3′ |
| 5′- GAGAAATCAAACAGAGGCCG -3′ | |
| Catalase | 5′- GCCATTGCCACAGGAAAGTA -3′ |
| 5′- CCTTGGTGAGATCGAATGGA -3′ | |
| GPx | 5′- CCAAGCTCATCACCTGGTCT -3′ |
| 5′- TCGATGTCAATGGTCTGGAA -3′ | |
| SOD | 5′- TGGCCGATGTGTCTATTGAA -3′ |
| 5′- CACCTTTGCCCAAGTCATCT -3′ | |
| β-Catenin | 5′- ATTGATTCGAAACCTTGCCC -3′ |
| 5′- AGCTCCAGTACACCCTTCTA -3′ | |
| MMP-2 | 5′- AGAACTTCCGATTATCCCATGATGA -3′ |
| 5′- TGACAGGTCCCAGTGTTGGTG -3′ | |
| MMP-7 | 5′- GGCGGAGATGCTCACTTTGAC -3′ |
| 5′- AATTCATGGGTGGCAGCAAAC -3′ | |
| MMP-9 | 5′- GCCCTGGAACTCACACGACA -3′ |
| 5′- TTGGAAACTCACACGCCAGAAG -3′ | |
| IL-6 | 5′- TGGAGTACCATAGCTACCTGGAGT -3′ |
| 5′- TCCTTAGCCACTCCTTCTGTGACT -3′ | |
| IL-1β | 5′- GGTCAAAGGTTTGGAAGCAG -3′ |
| 5′- TGTGAAATGCCACCTTTTGA -3′ | |
| TNF-α | 5′- CAGGTTCTGTCCCTTTCACTCACT -3′ |
| 5′- GTTCAGTAGACAGAAGAGCGTGGT -3′ | |
| GAPDH | 5′- TGCACCACCAACTGCTTAGC -3′ |
| 5′- GGCATGGACTGTGGTCATGAG -3′ |
| Antibody | Company | Commercial Number |
|---|---|---|
| Catalase | Sigma-Aldrich | SAB4503383 |
| GPx 1-2 | Sigma-Aldrich | SAB2500468 |
| SOD-1 | Sigma-Aldrich | SAB1406464 |
| Bcl-2 | Sigma-Aldrich | SAB5701336 |
| β-Catenin | Sigma-Aldrich | SAB4500545 |
| MMP-2 | Sigma-Aldrich | SAB5700824 |
| MMP-7 | Sigma-Aldrich | SAB4501894 |
| MMP-9 | Sigma-Aldrich | SAB5700152 |
| IL-6 | Sigma-Aldrich | SAB1408594 |
| IL-1β | Sigma-Aldrich | SAB1406017 |
| TNF-α | Sigma-Aldrich | SAB5700627 |
| β-Actin | Sigma-Aldrich | SAB3500350 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).