Submitted:
22 January 2024
Posted:
23 January 2024
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Results
2.1. Expression of PRKAR1A in transcriptomic level of various cell lines
2.2. Efficient shRNA selection for biological functional assessment of PRKAR1A
2.3. Biological functional asessment through PRKAR1A knockdowned using shRNA
2.4. Regulation of Functionality via the ERK Signaling Pathway and EMT change
2.5. Enhanced sensitivity against anticancer agent by PRKAR1A downregulation
2.6. The reduction of drug resistance ability by PRKAR1A shRNA
2.7. The Bioinformatic sruvival data according to PRKAR1A expression in cancer patients
3. Discussion
4. Materials and Methods
4.1. Cell Culture
4.1.1. Cancer cells
4.1.2. Cancer Stem Cells (CSCs)

4.2. Mass spectometry analysis
4.3. RNA extraction and conventional polymerase chain reaction (PCR)
4.4. Cell proliferation assay
4.5. Cell colony formation assay and crystal violet stain
4.6. Cell cycle assay by flow cytometry
4.7. Wound healing scratch assay
4.8. Western blot analysis
4.9. Drug resistance assay
4.10. Generation of chemoresistant cell lines
4.11. Apoptosis assay
4.12. Data Acquisition and Preprocessing
4.13. Statistical Analysis of Expression Data
4.14. Survival Analysis
4.15. Software
4.16. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Sung, H.; Ferlay, J.; Siegel, R.L.; Laversanne, M.; Soerjomataram, I.; Jemal, A.; Bray, F. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA: a cancer journal for clinicians 2021, 71, 209–249. [Google Scholar] [CrossRef]
- Torre, L.A.; Siegel, R.L.; Ward, E.M.; Jemal, A. Global cancer incidence and mortality rates and trends—an update. Cancer epidemiology, biomarkers & prevention 2016, 25, 16–27. [Google Scholar] [CrossRef]
- Alieva, M.; van Rheenen, J.; Broekman, M.L. Potential impact of invasive surgical procedures on primary tumor growth and metastasis. Clin Exp Metastasis 2018, 35, 319–331. [Google Scholar] [CrossRef]
- Fang, X.; Yan, Q.; Liu, S.; Guan, X. Cancer stem cells in hepatocellular carcinoma: intrinsic and extrinsic molecular mechanisms in stemness regulation. International Journal of Molecular Sciences 2022, 23, 12327. [Google Scholar] [CrossRef]
- Aponte, P.M.; Caicedo, A. Stemness in cancer: stem cells, cancer stem cells, and their microenvironment. Stem cells international 2017. [Google Scholar] [CrossRef]
- Phi, L.T.H.; Sari, I.N.; Yang, Y.; Lee, S.; Jun, N.; Kim, K.S.; Lee, Y.K.; Kwon, H.Y. Cancer stem cells (CSCs) in drug resistance and their therapeutic implications in cancer treatment. Stem cells international 2018. [Google Scholar] [CrossRef]
- Schirrmacher, V. From chemotherapy to biological therapy: A review of novel concepts to reduce the side effects of systemic cancer treatment. Int J Oncol 2019, 54, 407–419. [Google Scholar] [CrossRef]
- Ranji, P.; Salmani Kesejini, T.; Saeedikhoo, S.; Alizadeh, A.M. Targeting cancer stem cell-specific markers and/or associated signaling pathways for overcoming cancer drug resistance. Tumor Biol 2016, 37, 13059–13075. [Google Scholar] [CrossRef]
- Hiom, S.C. Diagnosing cancer earlier: reviewing the evidence for improving cancer survival. Br J Cancer 2015, 112, 1. [Google Scholar] [CrossRef]
- Bradley, C.J.; Given, C.W.; Roberts, C. Disparities in cancer diagnosis and survival. Cancer 2001, 91, 178–188. [Google Scholar] [CrossRef]
- Raymond, A.C.; Gao, B.; Girard, L.; Minna, J.D.; Gomika Udugamasooriya, D. Unbiased peptoid combinatorial cell screen identifies plectin protein as a potential biomarker for lung cancer stem cells. Scientific reports 2019, 9, 14954. [Google Scholar] [CrossRef]
- Cao, D.; Li, Z.; Jiang, X.; Lum, Y.L.; Khin, E.; Lee, N.P.; Wu, G.; Luk, J.M. Osteopontin as potential biomarker and therapeutic target in gastric and liver cancers. World journal of gastroenterology: WJG 2012, 18, 3923. [Google Scholar] [CrossRef] [PubMed]
- Bensalah, K.; Montorsi, F.; Shariat, S.F. Challenges of cancer biomarker profiling. Eur Urol 2007, 52, 1601–1609. [Google Scholar] [CrossRef] [PubMed]
- Luo, J.; Rizvi, H.; Preeshagul, I.R.; Egger, J.V.; Hoyos, D.; Bandlamudi, C.; McCarthy, C.G.; Falcon, C.J.; Schoenfeld, A.J.; Arbour, K.C. COVID-19 in patients with lung cancer. Annals of Oncology 2020, 31, 1386–1396. [Google Scholar] [CrossRef] [PubMed]
- Zelber-Sagi, S.; Noureddin, M.; Shibolet, O. Lifestyle and hepatocellular carcinoma what is the evidence and prevention recommendations. Cancers 2021, 14, 103. [Google Scholar] [CrossRef] [PubMed]
- Medeiros, B.; Allan, A.L. Molecular mechanisms of breast cancer metastasis to the lung: clinical and experimental perspectives. International journal of molecular sciences 2019, 20, 2272. [Google Scholar] [CrossRef]
- Bossis, I.; Stratakis, C.A. Minireview: PRKAR1A: normal and abnormal functions. Endocrinology 2004, 145, 5452–5458. [Google Scholar] [CrossRef] [PubMed]
- Pitsava, G.; Stratakis, C.A.; Faucz, F.R. PRKAR1A and thyroid tumors. Cancers 2021, 13, 3834. [Google Scholar] [CrossRef]
- Nadella, K.S.; Jones, G.N.; Trimboli, A.; Stratakis, C.A.; Leone, G.; Kirschner, L.S. Targeted deletion of Prkar1a reveals a role for protein kinase A in mesenchymal-to-epithelial transition. Cancer Res 2008, 68, 2671–2677. [Google Scholar] [CrossRef]
- Loilome, W.; Juntana, S.; Namwat, N.; Bhudhisawasdi, V.; Puapairoj, A.; Sripa, B.; Miwa, M.; Saya, H.; Riggins, G.J.; Yongvanit, P. PRKAR1A is overexpressed and represents a possible therapeutic target in human cholangiocarcinoma. International journal of cancer 2011, 129, 34–44. [Google Scholar] [CrossRef]
- Wang, S.; Cheng, Y.; Zheng, Y.; He, Z.; Chen, W.; Zhou, W.; Duan, C.; Zhang, C. PRKAR1A is a functional tumor suppressor inhibiting ERK/Snail/E-cadherin pathway in lung adenocarcinoma. Scientific Reports 2016, 6, 39630. [Google Scholar] [CrossRef]
- Gentili, C.; Sanfilippo, O.; Silvestrini, R. Cell proliferation and its relationship to clinical features and relapse in breast cancers. Cancer 1981, 48, 974–979. [Google Scholar] [CrossRef]
- Otto, T.; Sicinski, P. Cell cycle proteins as promising targets in cancer therapy. Nature Reviews Cancer 2017, 17, 93–115. [Google Scholar] [CrossRef]
- Musgrove, E.A.; Caldon, C.E.; Barraclough, J.; Stone, A.; Sutherland, R.L. Cyclin D as a therapeutic target in cancer. Nature Reviews Cancer 2011, 11, 558–572. [Google Scholar] [CrossRef] [PubMed]
- Lavoie, H.; Gagnon, J.; Therrien, M. ERK signalling: a master regulator of cell behaviour, life and fate. Nature reviews Molecular cell biology 2020, 21, 607–632. [Google Scholar] [CrossRef] [PubMed]
- Guo, Y.; Pan, W.; Liu, S.; Shen, Z.; Xu, Y.; Hu, L. ERK/MAPK signalling pathway and tumorigenesis. Experimental and therapeutic medicine 2020, 19, 1997–2007. [Google Scholar] [CrossRef] [PubMed]
- Kohno, M.; Pouyssegur, J. Targeting the ERK signaling pathway in cancer therapy. Ann Med 2006, 38, 200–211. [Google Scholar] [CrossRef] [PubMed]
- Hu, X.; Zhai, Y.; Kong, P.; Cui, H.; Yan, T.; Yang, J.; Qian, Y.; Ma, Y.; Wang, F.; Li, H. FAT1 prevents epithelial mesenchymal transition (EMT) via MAPK/ERK signaling pathway in esophageal squamous cell cancer. Cancer Lett 2017, 397, 83–93. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Z.; Yu, H.; Kong, Q.; Liu, C.; Tian, Y.; Zeng, X.; Li, D. Effect of ERβ-regulated ERK1/2 signaling on biological behaviors of prostate cancer cells. American Journal of Translational Research 2017, 9, 2775. [Google Scholar] [PubMed]
- Singh, M.; Yelle, N.; Venugopal, C.; Singh, S.K. EMT: Mechanisms and therapeutic implications. Pharmacol Ther 2018, 182, 80–94. [Google Scholar] [CrossRef]
- Pradella, D.; Naro, C.; Sette, C.; Ghigna, C. EMT and stemness: flexible processes tuned by alternative splicing in development and cancer progression. Molecular cancer 2017, 16, 1–19. [Google Scholar] [CrossRef]
- Fabregat, I.; Malfettone, A.; Soukupova, J. New insights into the crossroads between EMT and stemness in the context of cancer. Journal of clinical medicine 2016, 5, 37. [Google Scholar] [CrossRef] [PubMed]
- Manfioletti, G.; Fedele, M. Epithelial–Mesenchymal Transition (EMT) 2021. International Journal of Molecular Sciences 2022, 23, 5848. [Google Scholar] [CrossRef] [PubMed]
- Roy, S.; Sunkara, R.R.; Parmar, M.Y.; Shaikh, S.; Waghmare, S.K. EMT imparts cancer stemness and plasticity: new perspectives and therapeutic potential. Frontiers in Bioscience-Landmark 2020, 26, 238–265. [Google Scholar] [CrossRef] [PubMed]
- Elliott, A.; Adams, J.; Al-Hajj, M. The ABCs of cancer stem cell drug resistance. IDrugs: the investigational drugs journal 2010, 13, 632–635. [Google Scholar] [PubMed]
- Dean, M. ABC transporters, drug resistance, and cancer stem cells. J Mammary Gland Biol Neoplasia 2009, 14, 3–9. [Google Scholar] [CrossRef]
- Dave, B.; Mittal, V.; Tan, N.M.; Chang, J.C. Epithelial-mesenchymal transition, cancer stem cells and treatment resistance. Breast Cancer Research 2012, 14, 1–5. [Google Scholar] [CrossRef] [PubMed]
- Zhao, W.; Li, Y.; Zhang, X. Stemness-related markers in cancer. Cancer translational medicine 2017, 3, 87. [Google Scholar] [CrossRef]
- Chiou, S.; Wang, M.; Chou, Y.; Chen, C.; Hong, C.; Hsieh, W.; Chang, H.; Chen, Y.; Lin, T.; Hsu, H. Coexpression of Oct4 and Nanog enhances malignancy in lung adenocarcinoma by inducing cancer stem cell–like properties and epithelial–mesenchymal transdifferentiation. Cancer Res 2010, 70, 10433–10444. [Google Scholar] [CrossRef]
- Sun, C.; Sun, L.; Li, Y.; Kang, X.; Zhang, S.; Liu, Y. Sox2 expression predicts poor survival of hepatocellular carcinoma patients and it promotes liver cancer cell invasion by activating Slug. Medical oncology 2013, 30, 1–10. [Google Scholar] [CrossRef]
- Chen, Y.; Shi, L.; Zhang, L.; Li, R.; Liang, J.; Yu, W.; Sun, L.; Yang, X.; Wang, Y.; Zhang, Y. The molecular mechanism governing the oncogenic potential of SOX2 in breast cancer. J Biol Chem 2008, 283, 17969–17978. [Google Scholar] [CrossRef]
- Rasti, A.; Mehrazma, M.; Madjd, Z.; Abolhasani, M.; Saeednejad Zanjani, L.; Asgari, M. Co-expression of cancer stem cell markers OCT4 and NANOG predicts poor prognosis in renal cell carcinomas. Scientific reports 2018, 8, 11739. [Google Scholar] [CrossRef] [PubMed]
- Smith, J.; Field, M.; Sugaya, K. Suppression of NANOG Expression Reduces Drug Resistance of Cancer Stem Cells in Glioblastoma. Genes 2023, 14, 1276. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.; He, M.; Li, L.; Wang, X.; Han, S.; Zhao, J.; Dong, Y.; Ahmad, M.; Li, L.; Zhang, X. EMT and cancer cell stemness associated with chemotherapeutic resistance in esophageal cancer. Frontiers in Oncology 2021, 11, 672222. [Google Scholar] [CrossRef]
- Koh, E.; Kim, K.; Park, H.; Kim, J.; Kim, P. Active targeting of versatile nanocomplex using the novel biomarker of breast cancer stem cells. International Journal of Molecular Sciences 2022, 24, 685. [Google Scholar] [CrossRef]
- Koh, E.; You, J.; Jung, S.; Kim, P. Biological functions and identification of novel biomarker expressed on the surface of breast cancer-derived cancer stem cells via proteomic analysis. Mol. Cells 2020, 43, 384. [Google Scholar] [CrossRef]














| Primer | Forward (5’-3’) | Reverse (5’-3’) |
| GAPDH | AGGGCTGCTTTTAACTCTGGT | CCCCACTTGATTTTGGAGGGA |
| PRKAR1A | GCAGCCACTGTCAAAGCAAA | GGTTCTCCCTGCACCACAAT |
| E-cadherin | GCTTTGACGCCGAGAGCTA | CTTTGTCGACCGGTGCAATC |
| N-cadherin | AGGCTTCTGGTGAAATCGCA | TGGAAAGCTTCTCACGGCAT |
| Snail | GCTGCAGGACTCTAATCCAGAGTT | GACAGAGTCCCAGATGAGCATTG |
| Slug | AGATGCATATTCGGACCCAC | CCTCATGTTTGTGCAGGAGA |
| Vimentin | CGAAAACACCCTGCAATCTT | TCCAGCTTCCTGTAGGT |
| Sox2 | GCTACAGCATGATGCAGGACCA | TCTGCGAGCTGGTCATGGAGTT |
| Oct4 | CCTGAAGCAGAAGAGGATCACC | AAAGCGGCAGATGGTCGTTTGG |
| Nanog | CTCCAACATCCTGAACCTCAGC | CGTCACACCATTGCTATTCTTCG |
| Cyclin D1 | AGCTGTGCATCTACACCGAC | GAAATCGTGCGGGGTCATTG |
| MDR1 | CCCATCATTGCAATAGCAGG | GTTCAAACTTCTGCTCCTGA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).