Preprint
Article

This version is not peer-reviewed.

Live-Attenuated Salmonella-Based Oral Vaccine Candidates Expressing PCV2d Cap and Rep by Novel Expression Plasmids as a Vaccination Strategy for Mucosal and Systemic Immune Responses against PCV2d

A peer-reviewed version of this preprint was published in:
Vaccines 2023, 11(12), 1777. https://doi.org/10.3390/vaccines11121777

Submitted:

31 October 2023

Posted:

31 October 2023

You are already at the latest version

Abstract
Oral vaccines are highly envisaged for veterinary applications due to their convenience and ability to induce protective mucosal immunity as the first line of defense. The present investigation harnessed live-attenuated Salmonella Typhimurium to orally deliver novel expression vector systems containing the Cap and Rep genes from porcine circovirus type 2 (PCV2), a significant swine pathogen. The antigen expression by the vaccine candidates JOL2885 and JOL2886, comprising eukaryotic pJHL204 and pro-eukaryotic expression pJHL270 plasmids respectively, was confirmed by western blot and IFA. We evaluated their immunogenicity and protective efficacy through oral vaccination in a mouse model. This approach elicited both mucosal and systemic immunity against PCV2d. Oral administration of the candidates induced PCV2-specific sIgA, serum IgG antibodies, and neutralizing antibodies, resulting in reduced viral loads in the livers and lungs of PCV2d-challenged mice. T-lymphocyte proliferation and flow-cytometry assays confirmed enhanced cellular immune responses after oral inoculation. The synchronized elicitation of both Th1 and Th2 responses was also confirmed by enhanced expression of TNF-α, IFN-γ, IL-4, MHC-I, and MHC-II. Our findings highlight the effectiveness and safety of the constructs with an engineered-attenuated S. Typhimurium, suggesting its potential application as an oral PCV2 vaccine candidate.
Keywords: 
;  ;  ;  

1. Introduction

Porcine circovirus disease (PCVD) mainly caused by the pathogenic porcine circovirus 2 (PCV2) is one of the most economically important swine diseases associated with several disease syndromes including systemic (PCV-SD), reproductive diseases (PCV-RD), PCV2-subclinical infection (PCV2-SI) and porcine dermatitis and nephropathy syndrome (PDNS) [1]. This small, non-enveloped, single-stranded DNA virus has three types: PCV1 which is considered non-pathogenic and PCV2 and PCV3 which are pathogenic [2]. Epidemiological analyses revealed genotype shifts in the past decades, where the first genotype shift replaced PCV2a to PCV2b, and the second shift occurred in the past years with PCV2d currently predominating worldwide [3,4]. The 1700 bp genome of PCV2 DNA genome consists of two major open reading frames (ORFs), important for its pathogenicity. ORF1 encodes the replicase (Rep) that is related to viral DNA replication while ORF2 encodes the viral capsid protein (Cap), the sole structural protein, main antigen and major immunogenic polypeptide of PCV2 [5,6,7]. Transmission of PCV2 has been shown primarily by oronasal or via contact with contaminated fomites, feeds and biological products and through direct contact with infected pigs including biological excretions such as urine, feces, nasal, ocular and bronchial, where PCV2 is often shed and detected [1,8,9]. With high presence of PCV2 in the nasal and fecal excretions of infected animals, this persistent shedding increases the potential transmission from infected to susceptible animals [8,9], affirming the initial entry and spread of PCV2 via the mucosal surface of the gastrointestinal and respiratory tract.
As a multifactorial disease with currently no effective treatment, critical efforts to control PCV2 infections include enhanced biosecurity and vaccination [10]. There are PCV2a-based commercial vaccines available: inactivated PCV2 virus, PCV2 capsid-based subunit vaccines, and inactivated chimeric vaccine [11]. Vaccination with these commercial vaccines has played an important role in the prevention and control of PCV2, especially in reducing viremia, lymphoid tissue damage and viral replication of PCV2 in pigs [11,12]. However, these licensed vaccines are administered parenterally by intramuscular injection which may have some limitations in inducing protective mucosal immunity [13] that is essential for protecting or eliminating infection at the mucosal invasion sites of pathogens such as PCV2 [14,15]. Thus, the development of a mucosal vaccine could further potentiate the approach to vaccination against PCV2 for a broader immune response. Although these PCV2a-based vaccines could confer cross-protection against PCV2b and PCV2d, it is also necessary to develop next-generation vaccines based on the currently predominating genotype PCV2d. Moreover, the industrial applicability of parenteral vaccinations is yet another complication. Oral vaccines that can be formulated as feed or water mixable would be an ideal choice against PCV2 [15].
The use of bacteria as vehicles for vaccination has gained interest due to their intrinsic properties, particularly bacterial species that can invade eukaryotic cell types, colonize specific mucosal surfaces, and target inductive cells of the immune system [16,17]. As such, Salmonella-mediated delivery of specific plasmid-encoded heterologous antigens to target eukaryotic host cells and expression of the target immunogen on its surface has been widely demonstrated [18,19]. Evidence has shown these advanced systems to be efficient in successfully transferring eukaryotic expression plasmids or expressing the antigen on its surface for induction of immune responses against specific pathogens [20,21,22]. Thus, Salmonella-mediated vaccination uniquely offers versatility in inducing potent systemic and mucosal responses through mucosal administration such as oral, nasal and ocular, which can especially be ideal for mass vaccination against mucosal and systemic pathogens. The exploitation of these advantages offered by Salmonella-based vaccines requires appropriate plasmid vector systems which are being developed to enhance prokaryotic or eukaryotic antigen expression that consequently improves immune responses. In this study, we utilized our novel dual expression plasmid, p270, which expresses antigens from both eukaryotic and prokaryotic origin as previously demonstrated against omicron SARS-CoV-2 which showed both humoral and cellular immune responses [23].
To reduce the global burden of infectious diseases in both humans and animals, particularly pathogens that infect or transmit via mucosal sites such as PCV2 in pigs, there is a need to develop next-generation vaccines that improve and generate protective immunity at mucosal sites [24]. Thus, the advantages of a Salmonella-based oral vaccine, such as induction of both mucosal and systemic immunity and convenient administration applicable for mass vaccination, offer a potential vaccine strategy against PCV2. Here, we developed a live-attenuated Salmonella-based vaccine with novel expression plasmids that express the immunogenic PCV2 Cap and Rep and evaluated its broad-spectrum immune responses and protective efficacy for potential oral vaccination strategy against PCV2.

2. Materials and Methods

2.1. Bacterial strains, plasmids, viruses and cell lines

All bacteria and plasmids used in this study are listed in Table 1. A live-attenuated Salmonella Typhimurium named JOL2500 with genotype Δlon Δcpxr ΔsifA Δasd was used as a plasmid carrier as previously described [25] and was grown in LB broth or LB agar plates at 37°C. For cloning and challenge experiments in mice, a PCV2d clinical isolate from South Korea PCV2d/CBNU0324 (GeneBank accession number MN545963) was used and propagated in porcine kidney cells (PK-15) maintained in 5% FBS-supplemented DMEM with penicillin and streptomycin. Murine macrophage cells (RAW 264.7) were used for in vitro studies and are maintained in 10% FBS-supplemented DMEM at 37°C with 5% CO2.

2.2. Design and development of the vaccine candidates

The cap and rep genes were selected as the target antigens for the eukaryotic expression and were amplified from the PCV2d isolate using the primers listed in Table 1. The cap and rep genes were linked by a self-cleaving peptide with 66 base pairs encoding 22 amino acids of porcine teschovirus-1 called P2A for a multi-antigen delivery [28]. For the prokaryotic expression, the PCV2 capsid sequence was codon optimized for Salmonella Typhimurium (ST) and was costumed synthesized (Cosmogenetech, Republic of Korea). The amplified inserts, Cap-P2A-Rep for eukaryotic expression and only Cap for prokaryotic expression were inserted into the suitable MCS region of the novel dual-expression plasmid, p270, previously designed with cytomegalovirus (CMV) promoter for eukaryotic and Ptrc promoter for prokaryotic antigen expression [23]. This multi-antigen dual-expressing vaccine construct is designated as p270:EuCap-Rep+ProCap. Additionally, a eukaryotic expression plasmid, p204, a Semliki-based vector as previously designed [25] serves as a baseline for comparison and was inserted with the Cap-P2A-Rep construct only and is designated as p204:Cap-Rep. All constructs were verified by sequencing before electroporation into a live-attenuated Salmonella Typhimurium JOL2500 (Δlon Δcpxr ΔsifA Δasd) for vaccine delivery resulting in JOL2885 (p204:Cap-Rep) and JOL2886 (p270:EuCap-Rep+ProCap).

2.3. Confirming the expression by RT-PCR, immunofluorescence and western blot

To confirm the eukaryotic expression by the vaccine constructs, JOL2885 and JOL2886 were used for bactofection in RAW cells for 3 hours. After killing extracellular bacteria with 100 μg/ml gentamycin, cells were further incubated for 48 hours at 37C with 5% CO2. For confirmation by RT-PCR, infected cells were harvested for total RNA extraction using Trizol method and the synthesized cDNA was then mixed with the gene-specific primers listed in Table 1 for PCR and agarose gel analysis. Furthermore, eukaryotic expression was visualized by immunofluorescence using the primary antibodies raised in rabbits at 1:200 dilution as previously described [29]. After washing the cells, AlexaFluor 488 secondary antibody (Invitrogen, USA) was added and incubated for 1 hour. The immunostained cells were then viewed under the fluorescence microscope to detect positive green fluorescence of the target antigens Cap and Rep. Additionally, to detect the expression of the antigens at the protein level, cell lysates from Raw cells were mixed with SDS sample buffer and run on 12% gel. After trans-blot, the PVDF membrane was blocked with 5% skim milk for 2 hours and then incubated with primary antibodies raised in rabbits at 1:200 dilution overnight at 4°C. The membranes were then thoroughly washed with PBST before incubating with ant-rabbit IgG-HRP at 1:6000 and further incubated for 1 hour. For the prokaryotic expression confirmation by JOL2886 (p270:EuCap-Rep+ProCap), the strain was cultured to OD600 of 1 and the bacterial lysate was collected. The proteins were separated in 12% SDS-PAGE gel and analysed as similarly described above.

2.4. Mice immunization, PCV2d virus challenge and sampling

5-week-old SPF female BALB/c mice (Samtako, Republic of Korea) were housed in a laboratory animal facility and provided with fresh water and feed. All animal experiments were performed according to the guidelines for laboratory animal care and use and were approved by Jeonbuk National University Animal Ethics Committee (NON2022-024-001). To evaluate the immunoprotectivity of the vaccine candidates used as an oral vaccine, randomly grouped mice (n=6) were orally immunized four times with 100 μl 108 CFU of JOL2885, JOL2886 or PBS given at 1-week intervals. In comparison, the candidates were also inoculated into groups of mice by intramuscular route given twice with 100 μl 107 CFU at 2-week intervals. After primary immunization, serum samples were collected on days 14 and 21 for specific antibody detection by ELISA and neutralizing antibodies. Three mice from each group were sacrificed 3 weeks after the last booster to collect the splenocytes for assessment of T cell populations by flow cytometry. Two weeks after the last booster, all immunized mice were challenged intraperitoneally with PCV2d isolate (0.2 mL of 104.5TCID50/ml) propagated in PK-15 cells [30,31]. Three weeks later, liver and lungs were collected from three test animals in each group for PCV2 titer determination by qPCR and immunohistochemical detection of PCV2.

2.5. Enzyme-linked immunosorbent assay (ELISA)

To evaluate the induction of IgG and sIgA, serum, lungs and intestinal wash samples were collected from immunized mice. Indirect ELISA was performed as described previously [32] with slight modifications. Briefly, 96-well ELISA plates were coated with 100 μl of Cap or Rep purified protein diluted to a final concentration of 2 μg/well in coating buffer (9.6 pH) and incubated overnight at 4C. Serum samples were 2-fold serially diluted, added to test wells and incubated for 1 h at 37°C. After washing thrice with PBST (0.5% Tween-20), IgG and sIgA titers against the specific PCV2 antigens were measured by incubating the plates with HRP-conjugated goat anti-mouse IgG or IgA antibody (Southern Biotech, USA) at 1:3000 dilution for 1 hour at 37°C. After final washing with PBST, OPD substrate was used to develop the signal, and the OD values were read at 492nm using ELISA plate reader.

2.6. Virus neutralization assay

Neutralizing antibodies were measured at week 2 after the last booster by virus-neutralizing activity assay. Briefly, heat-inactivated serum samples at 56°C for 30 min were 2-fold serially diluted and incubated with equal volumes of 200 TCID50 PCV2d isolate for 1 hour at 37°C. The serum-virus mixture was added to 50% confluent PK-15 cells plated in 96-well plates and further incubated for 72 hours at 37°C with 5% CO2. The culture plate was then fixed with 80% acetone at -20C for 15 min and blocked with 5% BSA for 1 hour at 37C. Cells were then washed with PBS and incubated with anti-Rep polyclonal antibody followed by Alexa Fluor 488-conjugated donkey anti-rabbit IgG as the secondary antibody. The cells were viewed under a fluorescence microscope and serum titers were expressed as the highest serum dilution resulting in ≥70% reduction in infected cell cultures.

2.7. Lymphocyte proliferation assay

Splenocytes collected from immunized mice were subjected to MTT assay as previously described [33] with slight modification to determine the cell proliferation. Briefly, splenocytes were cultured in RPMI 1640 containing 10% FBS and 1% penicillin-streptomycin and were seeded into 96-well plates at 1x105 cells/well. Purified PCV2 Cap and Rep proteins prepared at a final concentration of 2 μg per well with 1μg each protein was added to stimulate splenocytes. After 48 hours of incubation at 37C in 5% CO2, 10 ul of MTT (5 mg/ml) was added to each well and further incubated for 4 hours before solubilizing with DMSO. The absorbance was measured at 570 nm and the stimulation index was calculated by dividing the values from stimulated cells with that of unstimulated cells.

2.8. Flow cytometric analysis and cytokine expression

CD4+ and CD8+ differentiation of T cells from stimulated splenocytes as similarly described above in lymphocyte proliferation were incubated with CD3e-PE, CD8a-FITC and CD4-PerCPVio700 antibodies (Miltenyi-Biotec, Germany) at 4°C for 30 min in dark. Additionally, to compare the induction of MHCI and MHCII molecules, FITC labelled MHC class 1 (H-2Kb) and MHC class II (I-A/I-E) FACS analysis markers (Bio-Rad Laboratories, Inc., USA) were used according to the manufacturer’s protocol. Cells were washed and resuspended with MACSQuant running buffer (Miltenyi-Biotec, Germany) prior to flow cytometric analysis. The percentage of CD3+CD4+, CD3+CD8+ T cells, MHCI and MHCII was analyzed using benchtop flow cytometer, MACSQuant® analyzer (Mitlenyi-Biotec, Germany).
Moreover, stimulated splenocytes in 24-well plates were harvested and total RNA was isolated. cDNA was then synthesized using reverse transcription master premix (Elpis Biotech, Republic of Korea) with oligo d(T)15 primer according to the manufacturer’s protocol. Levels of IFN-γ, TNF-α and IL-4 mRNA were analyzed by qPCR using the primers listed in Table 1. The relative cytokine expression levels were determined by the 2-ΔΔCT method using β-actin as the housekeeping gene.

2.9. Detection of PCV2 in mice tissues by qPCR and immunohistochemistry

PCV2 DNA was quantified from the liver and lungs of mice at day 21 post-challenge by real-time quantitative PCR as previously described [26] using the primers listed in Table 1. Real-time PCR was carried out using 2x SYBR Green qPCR Master Mix according to the manufacturer’s instructions and performed in Applied Biosystems® StepOnePlus Real-Time PCR system. The viral copies from each sample were calculated based on the standard curve generated from serial dilutions of a plasmid containing the Cap gene.
Furthermore, immunohistochemistry (IHC) was performed as previously described [34] with slight modifications. Briefly, mice organs such as liver, lungs, mesenteric lymph node were fixed in 10% neutral-buffered formalin, dehydrated, embedded and sectioned at 4 µm. Slides were then deparaffinized and dehydrated in a series of diluted ethanol before incubating the slides in antigen retrieval buffer for 20 mins. Inhibition of endogenous peroxidase activity was done by adding 30% H202 in methanol for 30 mins. After the slides were blocked with 5% BSA at room temperature for 1 hour, the slides were incubated with PCV2 Cap polyclonal antibody (1:50) at 4°C overnight. After washing with PBST, anti-rabbit biotinylated secondary antibody (1:1000) was added and incubated at room temperature for 1 hour. The slides were then incubated with diaminobenzidine (DAB) hydrogen peroxide solution for 3 min and then stained with methylene green for 3 min. The slides were mounted and viewed under the microscope.

2.10. Statistical analysis

GraphPad Prism 10 was used in the statistical analysis. Two-way ANOVA was used to determine the differences between the groups. The data are presented as mean ± SEM. A P-value of <0.05 was considered significant.

3. Results

3.1. Vaccine construction and confirmation of eukaryotic and prokaryotic expression of target antigens

Two vaccine candidates were designed and constructed using two expression plasmids: p204 for eukaryotic expression only and p270, a dual-expression vector for both eukaryotic and prokaryotic expression (Figure 1A). The target antigens for eukaryotic expression were Cap and Rep of PCV2d, which were amplified and connected by a self-cleaving peptide P2A and were inserted between the respective restriction sites in the multiple cloning site (MCS) region of the p204 or the p270 under the control of cytomegalovirus (CMV) promoter. In addition, a Cap gene was inserted into the MCS of p270 under the control of Ptrc promoter for prokaryotic expression (Figure 1A). The resulting plasmids, p204:Cap-Rep and p270:EuCap-Rep+ProCap were then constructed and electroporated into a live-attenuated Salmonella Typhimurium JOL2500 (Δlon Δcpxr ΔsifA Δasd), generating JOL2885 and JOL2886, respectively (Figure 2A). The eukaryotic expression of these two proteins was validated by western blot analysis, which revealed bands at the expected size for Cap at 26 kDa and Rep at 35 kDa, showing the efficient expression of the target proteins by the candidates (Figure 1B). Subsequently, the eukaryotic expression was also confirmed in vitro using murine macrophage cells, by immunofluorescence assay and revealed positive green fluorescence of Cap and Rep proteins in the vaccine-transfected cells, demonstrating efficient antigen delivery by the live-attenuated Salmonella and by the expression plasmids (Figure 1B). Moreover, the prokaryotic expression of Cap constructed into the dual expression plasmid, p270, was also confirmed by western blot analysis and showed the expected band at 26 kDa (Figure 1C).

3.2. Humoral and mucosal immune responses induced by the Salmonella-delivered vaccines

To evaluate whether the developed vaccines had the ability to induce humoral and mucosal antibody responses, anti-PCV2-specific IgG and secretory IgA (sIgA) antibodies were detected by ELISA using Cap or Rep purified proteins as coating antigens at days 14 and 42 post-immunization. The results showed that all the Salmonella-vaccinated groups by IM or PO (Figure 2B) induced high levels of IgG Cap- and Rep-specific antibodies especially at day 42 post-immunization compared to the PBS group (negative control) where specific antibodies were undetectable (Figure 3). Particularly, JOL2886 (p270:EuCap-Rep+ProCap) given IM induced significantly high levels of IgG Cap-specific antibodies followed by IM inoculation of JOL2885 (p204:Cap-Rep) compared to the PBS group. The oral inoculation, however, also induced high levels of IgG compared to the PBS group and no significant difference compared to the IM inoculation, indicating oral inoculation of the candidates is also comparable to that of IM. Conversely, the mucosal immune response was significantly induced by the oral inoculation of JOL2885 (p204:Cap-Rep) and JOL2886 (p270:EuCap-Rep+ProCap) compared to IM inoculation as shown by the sIgA levels in the intestine (Figure 3). Additionally, comparing the two candidates for mucosal immune response, PO inoculation of JOL2886 induced significantly higher sIgA than JOL2885 (Figure 3), suggesting the probable added contribution of the prokaryotic expression of Cap by JOL2886 in inducing immune responses.
To assess whether the antibodies elicited by the immunized mice could neutralize the virus, a serum neutralization (SN) assay was performed using the serum collected at day 41 post-immunization against PCV2d virus isolate. The results indicated that all IM- or PO-immunized groups generated neutralizing antibodies except the PBS group (Figure 3). Specifically, both IM and PO inoculation of JOL2885 (p204:Cap-Rep) induced a mean of 1:3.6 neutralizing antibody (NA) titer, while IM or PO inoculation of JOL2886 (p270:EuCap-Rep+ProCap) induced a mean of 1:5.66 NA titer and 1:4.33 NA titer, respectively. There was no significant difference between the neutralizing antibodies generated by IM or PO inoculation, indicating that oral inoculation similarly elicited neutralizing antibodies with that of the IM.

3.3. CD4+ and CD8+ T cell differentiation and lymphocyte proliferative response

To further characterize the immune responses induced by the vaccine candidates, the cell-mediated immune response was assessed by flow cytometry and proliferation assay of the collected splenocytes at week 3 post-immunization that were stimulated with Cap and Rep recombinant proteins. Both CD4+ and CD8+ T cell differentiation was relatively increased in all immunized mice compared to the PBS group with significantly higher CD4+ and CD8+, particularly in IM-inoculated mice with JOL2885 or JOL2886 than oral inoculation (Figure 4A). Interestingly, JOL2886 (p270:EuCap-Rep+ProCap) when inoculated orally has also significantly induced higher CD4+ T cells than the PBS group and there was no significant difference in the CD4+ T cell differentiation from the PO-inoculated JOL2886, suggesting that oral immunization with JOL2886 could also induce a high cell-mediated immune response.
Moreover, lymphocyte proliferative responses were significantly higher in all immunized groups compared to the PBS group (Figure 4B) after stimulation with the Cap and Rep recombinant proteins. Stimulated lymphocytes from orally immunized mice with JOL2886 showed the highest significant proliferation followed by IM-immunized mice. Comparing the proliferation index between the two candidates, JOL2886 showed a higher index than JOL2885 while oral immunization showed a higher index than IM (Figure 4B).

3.4. Cytokine expression profile and MHC class I and MHC class II molecules stimulation

The cytokine expression in the stimulated lymphocytes was also evaluated by quantitative real-time PCR to determine the expression patterns of the cytokines TNF-α, IFN-γ, and IL-4 in PO-immunized mice. Oral immunization with JOL2886 (p270:EuCap-Rep+ProCap) showed significantly more IFN-γ than JOL2885 (p204:Cap-Rep) and PBS group (Figure 4C). JOL2886 also had significantly more IL-4 than the PBS group. The results demonstrate the induction of the Th1 (TNF-α, IFN-γ) and Th2 (IL-4) immune responses, which are important for adaptive immune response and for regulating antibody production, by the candidate vaccines, particularly by JOL2886 (p270:EuCap-Rep+ProCap).
Furthermore, MHC class I and class II regulation by immunization with the candidate vaccines were evaluated by flow cytometry. MHC-I+ cells percentage in stimulated splenocytes of mice immunized orally was significantly higher in JOL2885 (p204:Cap-Rep), followed by JOL2886 (p270:EuCap-Rep+ProCap), compared to the PBS group (Figure 4D). JOL2885 showed a significantly higher MHC-I+ cell percentage than JOL2886. Conversely, for MHC-II+ cell stimulation, JOL2886 had a significantly higher percentage than JOL2885 and the PBS group. The results showed that JOL2885, carrying a eukaryotic plasmid tends to incline towards MHC-I+ cell stimulation, while JOL2886, carrying a dual-expression plasmid for eukaryotic and prokaryotic expression, could stimulate both MHCI-I+ and MHC-II+ cells (Figure 4D).

3.5. Detection of PCV2 in virus-challenged mice

Different tissues collected from all post-challenged experimental groups were used for PCV2 DNA extraction and immunohistochemical detection of PCV2 to evaluate the protective efficacy of the developed vaccines in the murine model. As shown in Figure 5, the PBS group showed the highest viral load compared to all other groups. The amounts of virus in the liver and lungs of the immunized groups either by IM or PO were lower compared to the PBS group and there was no detection of PCV2 in 1 or 2 out of 3 challenged mice in each group (Figure 5). Particularly, mice orally immunized with JOL2886 (p270:EuCap-Rep+ProCap) showed the lowest viral load in the lungs (Figure 5A). Additionally, PCV2 was also detected in the organ tissues by immunohistochemistry. Liver, lungs and MLN tissue sections from the PBS group showed significantly higher amounts of PCV2 antigens as shown by the intense brown signals compared to the vaccinated groups where no to less signals were observed (Figure 5B).

4. Discussion

PCV2 causes several disease syndromes in pigs resulting in significant economic losses in the swine industry globally. In this study, the oral vaccination of the vaccine candidates elicited a broad spectrum of immunity, covering both systemic and mucosal sites through the efficient vaccine delivery of the Salmonella vaccine strain and expression of the target antigens, Cap and Rep, in antigen-presenting cells (Figure 2). Salmonella Typhimurium is one of several bacterial species that have been shown to be able to transfer eukaryotic expression plasmids into host cells which can serve as a carrier for vaccine antigens or its genetic material [35,36]. Several studies have also demonstrated that oral vaccination with a live-attenuated Salmonella Typhimurium carrying immunogenic and protective homologous antigens of the target pathogens can induce humoral, cellular and mucosal immune responses as well as protect animal models from challenges with either human or animal pathogens [18,37,38,39]. Parenteral vaccines demand a complex production process, necessitate an expensive cold chain for safeguarding vaccine effectiveness, mandate substantial quantities of sterile resources, and rely on a considerable workforce for administering them to numerous animals, leading to elevated expenses [40]. In contrast, oral vaccines offer convenience, cost-effectiveness, and broad industrial applicability [41]. They trigger the host's mucosal immune system, the body's largest reservoir of immune cells, to generate substantial quantities of targeted protective antibodies against the virus [42,43,44]. With the ability of Salmonella to invade the mucosal-associated lymphoid tissues in the gut through oral inoculation, it thereby improves the stimulation of mucosal immunity and induces sIgA [17,45] which may be critical in providing protection against some pathogens such as PCV2. Thus, the use of live-attenuated Salmonella as a carrier for DNA vaccines for oral vaccination has gained interest due to its multiple advantages.
Although PCV2 infection in mice does not similarly resemble that of pigs, several studies have shown that PCV2 can replicate in some mouse strains including BALB/c mouse [46] which is one of the extensively used animal models for the PCV2 vaccine studies [32,34,47,48]. Secretory IgA (sIgA) in the BALB/c mouse model. has been well recognized as an important first line of defense for protection against pathogens in the mucosal surfaces and thus, plays an important role in mucosal immunity [49]. Studies have shown that the production of sIgA depends on the uptake and processing of immunogens by the antigen-presenting cells in Peyer’s patch M cells, activation of T-cells and B-cell class switch [50]. In connection to that, our results demonstrated that even though the serum IgG antibodies were highly elicited by IM inoculation of the vaccine candidates, the oral administration of the vaccine candidates significantly induced high PCV2-specific sIgA antibody levels particularly in the intestine. This induction of mucosal immunity could imply an important aspect especially when considering the nature of infection of the target pathogen, PCV2, which is generally been transmitted through the oronasal route [9]. Also, even though the IM inoculation showed induction of higher levels of IgG antibodies than PO, there is no significant difference in the antibody levels induced by the IM or PO inoculation which suggests that oral inoculation also induces comparable antibodies.
In addition, the presence of PCV2-neutralizing antibodies has also been associated with enhanced protection against PCV2 infection [51]. This was similarly observed in the present study wherein significantly high neutralizing antibodies were elicited by the oral administration of the candidate vaccines which correlated with the outcomes of relatively decreased viral load and presence of PCV2 in the liver and lungs of the PCV2-challenged mice (Figure 5). Also, no significant difference in the neutralizing antibodies induced by IM or PO inoculation was observed, suggesting that the oral inoculation similarly elicited high neutralizing antibodies as IM inoculation. Moreover, the participation of T-cell activation by vaccination is valuable in cellular immunity. The CD4+ T cells are helper cells that respond to exogenous antigens as presented by MHC class II molecules, while CD8+ T cells are cytotoxic T cells that respond to endogenous antigens presented by MHC class I molecules [52,53]. The regulations brought by the activation of these MHC pathways and subsequent changes in the T cell population are often used as indicators of immune status. Our results revealed that oral administration of the candidate vaccines could also increase the T-cell population, although not as high when administrated intramuscularly.
The exploitation of a Salmonella-mediated vaccine delivery system offers versatility as it can be coupled with advanced vector systems such as plasmid-encoded heterologous antigens for eukaryotic or prokaryotic expression [16]. In the present study, we utilized a eukaryotic expression plasmid, p204, and a dual-expression plasmid, p270, for designing and constructing two vaccines containing the Cap and Rep of PCV2d as the target immunogens (Figure 1). The PCV2 Cap protein has been known to be the major immunogenic structural protein of the virus [6,54] and thus, is selected to be in both the eukaryotic and prokaryotic expression sides of the dual-expression plasmid, while the Rep protein, involved in virus replication [55] was only included for eukaryotic expression. The dual-expression plasmid, p270, coupled with a live-attenuated Salmonella JOL2500, allows the prokaryotic expression of Cap protein through the Ptrc promoter, as well as eukaryotic expression of Cap and Rep through the CMV promoter for efficient vaccine delivery as confirmed by the western blot and IFA analysis (Figure 1). Thus, utilizing a dual-expression plasmid in a Salmonella-based vaccine delivery advances the approach to antigen delivery as it could present both exogenous and endogenous antigens for efficient presentation of immunogens into the host immune machinery [35]. Compared with the eukaryotic expression of the antigens by p204 which demonstrated increased activation of the MHC class I, following the processing of the endogenous antigens (plasmids containing the target genes), the p270 was able to activate not just MHC class I but also MHC class II through the addition of exogenous antigen expressed by the prokaryotic side of its expression system as observed in our results (Figure 4D), which could have contributed to the higher humoral and mucosal immune responses than p204, and thus, may be beneficial for induction of broad immunity by oral vaccination. The addition of Cap into the prokaryotic expression side of the candidate vaccine JOL2886 showed generally higher IgG, sIgA, neutralizing antibodies and cell-mediated immune responses than JOL2885, suggesting that bacterial expression of PCV2 Cap antigen could improve the induction of immune responses in the mucosal and systemic systems.
In conclusion, our results revealed that oral vaccination with an engineered live-attenuated S. Typhimurium for delivery of a dual-expression plasmid carrying PCV2 antigens Cap and Rep effectively induced broad-spectrum immunity including systemic and mucosal immunity against PCV2. This protective mucosal immunity brought by oral vaccine inoculation may also be deemed pivotal in achieving a broader immune response, which includes immune responses in the mucosal sites for local elimination of the virus, in addition to humoral and cellular immunity. Oral vaccination of a bacterial-based vaccine offers many advantages such as low cost, ease of administration and safety. Such advantages, along with its unique vaccine delivery system, this type of vaccine has potential applications for mass vaccination, especially in the large-scale pig industry. Although the oral vaccination of the vaccine candidates induced less serum IgG responses than IM, the dosage, vaccination schedule and incorporation of stimulators for host immune response could be explored to improve further its immunogenicity. Nevertheless, the development of an oral type of vaccine exploiting the advantages of a live-attenuated Salmonella Typhimurium as a carrier advances its potential use against various human and animal diseases, such as PCV2.

Author Contributions

Conceptualization, K.K.S.L. and J.H.L.; Experimental work, K.K.S.L.; Data Analysis, K.K.S.L.; Writing – Original Draft Preparation, K.K.S.L.; Review – Editing, C.S. and J.H.L.; Supervision, J.H.L.; Funding Acquisition, J.H.L. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by National University Development Project at Jeonbuk National University in 2023.

Institutional Review Board Statement

All the animal experiments complied with the guidelines of the Animal Welfare and Use Committee of Jeonbuk National University (JBNU). The use of laboratory animals in the study was approved by Jeonbuk National University Institutional Animal Care and Use Committee (IACUC, NON2022-024-001).

Data Availability Statement

All data generated or analyzed during this study are included in this article.

Acknowledgments

We would like to thank Prof. Kim Won-Il for kindly providing the PCV2d isolate and PK-15 cells used in this study. We would also like to thank the Center of University-wide Research Facilities (CURF) at Jeonbuk National University.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Gillespie, J.; Opriessnig, T.; Meng, X.J.; Pelzer, K.; Buechner-Maxwell, V. Porcine Circovirus Type 2 and Porcine Circovirus-Associated Disease. J Vet Intern Med 2009, 23. [Google Scholar] [CrossRef] [PubMed]
  2. Woźniak, A.; Miłek, D.; Bąska, P.; Stadejek, T. Does Porcine Circovirus Type 3 (PCV3) Interfere with Porcine Circovirus Type 2 (PCV2) Vaccine Efficacy? Transbound Emerg Dis 2019, 66. [Google Scholar] [CrossRef] [PubMed]
  3. Xiao, C.T.; Halbur, P.G.; Opriessnig, T. Global Molecular Genetic Analysis of Porcine Circovirus Type 2 (PCV2) Sequences Confirms the Presence of Four Main PCV2 Genotypes and Reveals a Rapid Increase of PCV2d. Journal of General Virology 2015, 96. [Google Scholar] [CrossRef] [PubMed]
  4. Karuppannan, A.K.; Opriessnig, T. Porcine Circovirus Type 2 (PCV2) Vaccines in the Context of Current Molecular Epidemiology. Viruses 2017, 9. [Google Scholar] [CrossRef] [PubMed]
  5. Fan, H.; Xiao, S.; Tong, T.; Wang, S.; Xie, L.; Jiang, Y.; Chen, H.; Fang, L. Immunogenicity of Porcine Circovirus Type 2 Capsid Protein Targeting to Different Subcellular Compartments. Mol Immunol 2008, 45. [Google Scholar] [CrossRef] [PubMed]
  6. Blanchard, P.; Mahé, D.; Cariolet, R.; Keranflec’h, A.; Baudouard, M.A.; Cordioli, P.; Albina, E.; Jestin, A. Protection of Swine against Post-Weaning Multisystemic Wasting Syndrome (PMWS) by Porcine Circovirus Type 2 (PCV2) Proteins. Vaccine 2003, 21. [Google Scholar] [CrossRef] [PubMed]
  7. Zhan, Y.; Yu, W.; Cai, X.; Lei, X.; Lei, H.; Wang, A.; Sun, Y.; Wang, N.; Deng, Z.; Yang, Y. Correction for Zhan et al., “The Carboxyl Terminus of the Porcine Circovirus Type 2 Capsid Protein Is Critical to Virus-Like Particle Assembly, Cell Entry, and Propagation.”. J Virol 2021, 95. [Google Scholar] [CrossRef] [PubMed]
  8. Rose, N.; Opriessnig, T.; Grasland, B.; Jestin, A. Epidemiology and Transmission of Porcine Circovirus Type 2 (PCV2). Virus Res 2012, 164. [Google Scholar] [CrossRef] [PubMed]
  9. Patterson, A.R.; Opriessnig, T. Epidemiology and Horizontal Transmission of Porcine Circovirus Type 2 (PCV2). Animal health research reviews / Conference of Research Workers in Animal Diseases 2010, 11. [Google Scholar] [CrossRef]
  10. Alarcon, P.; Rushton, J.; Nathues, H.; Wieland, B. Economic Efficiency Analysis of Different Strategies to Control Post-Weaning Multi-Systemic Wasting Syndrome and Porcine Circovirus Type 2 Subclinical Infection in 3-Weekly Batch System Farms. Prev Vet Med 2013, 110. [Google Scholar] [CrossRef]
  11. Chae, C. Commercial Porcine Circovirus Type 2 Vaccines: Efficacy and Clinical Application. Veterinary Journal 2012, 194. [Google Scholar] [CrossRef] [PubMed]
  12. Rose, N.; Andraud, M.; Bigault, L.; Jestin, A.; Grasland, B. A Commercial PCV2a-Based Vaccine Significantly Reduces PCV2b Transmission in Experimental Conditions. Vaccine 2016, 34. [Google Scholar] [CrossRef] [PubMed]
  13. Lycke, N. Recent Progress in Mucosal Vaccine Development: Potential and Limitations. Nat Rev Immunol 2012, 12. [Google Scholar] [CrossRef] [PubMed]
  14. Wang, L.; Zhao, D.; Sun, B.; Yu, M.; Wang, Y.; Ru, Y.; Jiang, Y.; Qiao, X.; Cui, W.; Zhou, H.; et al. Oral Vaccination with the Porcine Circovirus Type 2 (PCV-2) Capsid Protein Expressed by Lactococcus Lactis Induces a Specific Immune Response against PCV-2 in Mice. J Appl Microbiol 2020, 128. [Google Scholar] [CrossRef]
  15. Li, W.; Li, J.; Dai, X.; Liu, M.; Khalique, A.; Wang, Z.; Zeng, Y.; Zhang, D.; Ni, X.; Zeng, D.; et al. Surface Display of Porcine Circovirus Type 2 Antigen Protein Cap on the Spores of Bacillus Subtilis 168: An Effective Mucosal Vaccine Candidate. Front Immunol 2022, 13. [Google Scholar] [CrossRef] [PubMed]
  16. Becker, P.D.; Noerder, M.; Guzmán, C.A. Genetic Immunization: Bacteria as DNA Vaccine Delivery Vehicles. Hum Vaccin 2008, 4. [Google Scholar] [CrossRef] [PubMed]
  17. Dieye, Y. Bacterial Delivery Vehicles for Mucosal Vaccines: A Promising Tool for Mass Vaccination. Am J Biomed Sci Res 2022, 17. [Google Scholar] [CrossRef]
  18. Cazorla, S.I.; Becker, P.D.; Frank, F.M.; Ebensen, T.; Sartori, M.J.; Corral, R.S.; Malchiodi, E.L.; Guzmán, C.A. Oral Vaccination with Salmonella Enterica as a Cruzipain-DNA Delivery System Confers Protective Immunity against Trypanosoma Cruzi. Infect Immun 2008, 76. [Google Scholar] [CrossRef] [PubMed]
  19. Zhu, D.; Mengyue, M.; Qimuge, A.; Bilige, B.; Baiyin, T.; Temuqile, T.; Chen, S.; Borjigen, S.; Baigude, H.; Yang, D. Oral Delivery of SARS-CoV-2 DNA Vaccines Using Attenuated Salmonella Typhimurium as a Carrier in Rat. Molecular Genetics, Microbiology and Virology 2022, 37. [Google Scholar] [CrossRef]
  20. Weiss, S. Transfer of Eukaryotic Expression Plasmids to Mammalian Hosts by Attenuated Salmonella Spp. International Journal of Medical Microbiology 2003, 293. [Google Scholar] [CrossRef]
  21. Lee, J.S.; Shin, K.S.; Pan, J.G.; Kim, C.J. Surface-Displayed Viral Antigens on Salmonella Carrier Vaccine. Nat Biotechnol 2000, 18. [Google Scholar] [CrossRef] [PubMed]
  22. Yoon, W.; Park, Y.; Kim, S.; Bang, I.S. Development of an Oral Salmonella-Based Vaccine Platform against SARS-CoV-2. Vaccines (Basel) 2022, 10. [Google Scholar] [CrossRef] [PubMed]
  23. Sivasankar, C.; Hewawaduge, C.; Lee, J.H. Novel Pro-and Eukaryotic Expression Plasmid Expressing Omicron Antigens Delivered via Salmonella Elicited MHC Class I and II Based Protective Immunity. Journal of Controlled Release 2023, 357. [Google Scholar] [CrossRef] [PubMed]
  24. Miquel-Clopés, A.; Bentley, E.G.; Stewart, J.P.; Carding, S.R. Mucosal Vaccines and Technology. Clin Exp Immunol 2019, 196. [Google Scholar] [CrossRef] [PubMed]
  25. Senevirathne, A.; Park, J.Y.; Hewawaduge, C.; Perumalraja, K.; Lee, J.H. Eukaryotic Expression System Complemented with Expressivity of Semliki Forest Virus’s RdRp and Invasiveness of Engineered Salmonella Demonstrate Promising Potential for Bacteria Mediated Gene Therapy. Biomaterials 2021, 279. [Google Scholar] [CrossRef] [PubMed]
  26. Sun, N.; Zhang, H.; Sun, P.; Khan, A.; Guo, J.; Zheng, X.; Sun, Y.; Fan, K.; Yin, W.; Li, H. Matrine Exhibits Antiviral Activity in a PRRSV/PCV2 Co-Infected Mouse Model. Phytomedicine 2020, 77. [Google Scholar] [CrossRef]
  27. Giulietti, A.; Overbergh, L.; Valckx, D.; Decallonne, B.; Bouillon, R.; Mathieu, C. An Overview of Real-Time Quantitative PCR: Applications to Quantify Cytokine Gene Expression. Methods 2001, 25. [Google Scholar] [CrossRef] [PubMed]
  28. Kim, J.H.; Lee, S.R.; Li, L.H.; Park, H.J.; Park, J.H.; Lee, K.Y.; Kim, M.K.; Shin, B.A.; Choi, S.Y. High Cleavage Efficiency of a 2A Peptide Derived from Porcine Teschovirus-1 in Human Cell Lines, Zebrafish and Mice. PLoS One 2011, 6. [Google Scholar] [CrossRef]
  29. Jawalagatti, V.; Kirthika, P.; Hewawaduge, C.; Yang, M. sik; Park, J.Y.; Oh, B.; Lee, J.H. Bacteria-Enabled Oral Delivery of a Replicon-Based MRNA Vaccine Candidate Protects against Ancestral and Delta Variant SARS-CoV-2. Molecular Therapy 2022, 30. [Google Scholar] [CrossRef]
  30. Cságola, A.; Cadar, D.; Tuboly, T. Replication and Transmission of Porcine Circovirus Type 2 in Mice. Acta Vet Hung 2008, 56. [Google Scholar] [CrossRef]
  31. Zhang, C.; Zhu, S.; Wei, L.; Yan, X.; Wang, J.; Quan, R.; She, R.; Hu, F.; Liu, J. Recombinant Flagellin-Porcine Circovirus Type 2 Cap Fusion Protein Promotes Protective Immune Responses in Mice. PLoS One 2015, 10. [Google Scholar] [CrossRef]
  32. Aravindaram, K.; Kuo, T.Y.; Lan, C.W.; Yu, H.H.; Wang, P.H.; Chen, Y.S.; Chen, G.H.C.; Yang, N.S. Protective Immunity against Porcine Circovirus 2 in Mice Induced by a Gene-Based Combination Vaccination. Journal of Gene Medicine 2009, 11. [Google Scholar] [CrossRef]
  33. Li, S.; Wang, B.; Jiang, S.; Lan, X.; Qiao, Y.; Nie, J.; Yin, Y.; Shi, Y.; Kong, W.; Shan, Y. Expression and Evaluation of Porcine Circovirus Type 2 Capsid Protein Mediated by Recombinant Adeno-Associated Virus 8. J Vet Sci 2021, 22. [Google Scholar] [CrossRef]
  34. Sylla, S.; Cong, Y.L.; Sun, Y.X.; Yang, G.L.; Ding, X.M.; Yang, Z.Q.; Zhou, Y.L.; Yang, M.; Wang, C.F.; Ding, Z. Protective Immunity Conferred by Porcine Circovirus 2 ORF2-Based DNA Vaccine in Mice. Microbiol Immunol 2014, 58. [Google Scholar] [CrossRef]
  35. Hegazy, W.A.H.; Hensel, M. Salmonella Enterica as a Vaccine Carrier. Future Microbiol 2012, 7. [Google Scholar] [CrossRef]
  36. Galen, J.E.; Wahid, R.; Buskirk, A.D. Strategies for Enhancement of Live-Attenuated Salmonella-Based Carrier Vaccine Immunogenicity. Vaccines (Basel) 2021, 9. [Google Scholar] [CrossRef]
  37. Bai, Y.; Gong, H.; Li, H.; Vu, G.P.; Lu, S.; Liu, F. Oral Delivery of RNase P Ribozymes by Salmonella Inhibits Viral Infection in Mice. Proc Natl Acad Sci U S A 2011, 108. [Google Scholar] [CrossRef]
  38. Jawalagatti, V.; Kirthika, P.; Hewawaduge, C.; Park, J.Y.; Yang, M.S.; Oh, B.; So, M.Y.; Kim, B.; Lee, J.H. A Simplified SARS-CoV-2 Mouse Model Demonstrates Protection by an Oral Replicon-Based MRNA Vaccine. Front Immunol 2022, 13. [Google Scholar] [CrossRef]
  39. Park, J.Y.; Hewawaduge, C.; Sivasankar, C.; Lloren, K.K.S.; Oh, B.; So, M.Y.; Lee, J.H. An MRNA-Based Multiple Antigenic Gene Expression System Delivered by Engineered Salmonella for Severe Fever with Thrombocytopenia Syndrome and Assessment of Its Immunogenicity and Protection Using a Human DC-SIGN-Transduced Mouse Model. Pharmaceutics 2023, 15. [Google Scholar] [CrossRef]
  40. Plotkin, S.; Robinson, J.M.; Cunningham, G.; Iqbal, R.; Larsen, S. The Complexity and Cost of Vaccine Manufacturing – An Overview. Vaccine 2017, 35. [Google Scholar]
  41. Kang, S.H.; Hong, S.J.; Lee, Y.K.; Cho, S. Oral Vaccine Delivery for Intestinal Immunity-Biological Basis, Barriers, Delivery System, and M Cell Targeting. Polymers (Basel) 2018, 10. [Google Scholar] [CrossRef]
  42. Baker, P.J. Advantages of an Oral Vaccine to Control the COVID-19 Pandemic. American Journal of Medicine 2022, 135. [Google Scholar] [CrossRef]
  43. Vela Ramirez, J.E.; Sharpe, L.A.; Peppas, N.A. Current State and Challenges in Developing Oral Vaccines. Adv Drug Deliv Rev 2017, 114. [Google Scholar] [CrossRef]
  44. Wang, S.; Liu, H.; Zhang, X.; Qian, F. Intranasal and Oral Vaccination with Protein-Based Antigens: Advantages, Challenges and Formulation Strategies. Protein Cell 2015, 6. [Google Scholar] [CrossRef]
  45. Cárdenas, L.; Clements, J.D. Oral Immunization Using Live Attenuated Salmonella Spp. as Carriers of Foreign Antigens. Clin Microbiol Rev 1992, 5. [Google Scholar] [CrossRef]
  46. Kiupel, M.; Stevenson, G.W.; Choi, J.; Latimer, K.S.; Kanitz, C.L.; Mittal, S.K. Viral Replication and Lesions in BALB/c Mice Experimentally Inoculated with Porcine Circovirus Isolated from a Pig with Postweaning Multisystemic Wasting Disease. Vet Pathol 2001, 38. [Google Scholar] [CrossRef]
  47. Liu, C.; Liu, Y.; Feng, H.; Zhao, B.; Chen, Y.; Huang, H.; Wang, P.; Deng, R.; Zhang, G. PCV Cap Proteins Fused with Calreticulin Expressed into Polymers in Escherichia Coli with High Immunogenicity in Mice. BMC Vet Res 2020, 16. [Google Scholar] [CrossRef]
  48. Ouyang, T.; Liu, X. hui; Ouyang, H. sheng; Ren, L. zhu Mouse Models of Porcine Circovirus 2 Infection. Animal Model Exp Med 2018, 1. [Google Scholar]
  49. Mantis, N.J.; Rol, N.; Corthésy, B. Secretory IgA’s Complex Roles in Immunity and Mucosal Homeostasis in the Gut. Mucosal Immunol 2011, 4. [Google Scholar] [CrossRef]
  50. Brandtzaeg, P. Function of Mucosa-Associated Lymphoid Tissue in Antibody Formation. Immunol Invest 2010, 39. [Google Scholar] [CrossRef]
  51. Meerts, P.; Misinzo, G.; Lefebvre, D.; Nielsen, J.; Bøtner, A.; Kristensen, C.S.; Nauwynck, H.J. Correlation between the Presence of Neutralizing Antibodies against Porcine Circovirus 2 (PCV2) and Protection against Replication of the Virus and Development of PCV2-Associated Disease. BMC Vet Res 2006, 2. [Google Scholar] [CrossRef]
  52. Germain, R.N. T-Cell Development and the CD4-CD8 Lineage Decision. Nat Rev Immunol 2002, 2. [Google Scholar] [CrossRef] [PubMed]
  53. Dave, V. Control of CD4 Helper and CD8 Cytotoxic T Cell Differentiation. J Cell Immunol 2020, 2. [Google Scholar] [CrossRef]
  54. Nawagitgul, P.; Morozov, I.; Bolin, S.R.; Harms, P.A.; Sorden, S.D.; Paul, P.S. Open Reading Frame 2 of Porcine Circovirus Type 2 Encodes a Major Capsid Protein. Journal of General Virology 2000, 81. [Google Scholar] [CrossRef] [PubMed]
  55. Cheung, A.K. Transcriptional Analysis of Porcine Circovirus Type 2. Virology 2003, 305. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Schematic representation of the vaccine design, construction and expression confirmation of the target antigens. (A) Schematic diagram of the eukaryotic expression plasmid (pJHL204) and dual-expression plasmid (pJHL270) illustrating the plasmid map, key components and strategy for vaccine construction. The Cap and Rep cloned from PCV2d were linked by a self-cleaving peptide, P2A, and were inserted into the MCS region under the CMV promoter for eukaryotic expression in pJHL204 and pJHL270. An optimized sequence of Cap was inserted into the MCS region under the Ptrc promoter for prokaryotic expression in pJHL270. (B) Eukaryotic expression validation of Cap and Rep by the vaccine strains JOL2885 (p204:Cap-Rep) and JOL2886 (p270:EuCap-Rep+ProCap) through immunofluorescence and western blot detection of Cap and Rep in transfected RAW 264.7 cells using hyperimmune rabbit antisera raised against the target proteins. Green fluorescence indicates positive expression of the respective proteins and cell nuclei were stained with DAPI as shown by blue fluorophore. (C) Western blot validation of Cap expression by the prokaryotic side of JOL2886 (p270:EuCap-Rep+ProCap).
Figure 1. Schematic representation of the vaccine design, construction and expression confirmation of the target antigens. (A) Schematic diagram of the eukaryotic expression plasmid (pJHL204) and dual-expression plasmid (pJHL270) illustrating the plasmid map, key components and strategy for vaccine construction. The Cap and Rep cloned from PCV2d were linked by a self-cleaving peptide, P2A, and were inserted into the MCS region under the CMV promoter for eukaryotic expression in pJHL204 and pJHL270. An optimized sequence of Cap was inserted into the MCS region under the Ptrc promoter for prokaryotic expression in pJHL270. (B) Eukaryotic expression validation of Cap and Rep by the vaccine strains JOL2885 (p204:Cap-Rep) and JOL2886 (p270:EuCap-Rep+ProCap) through immunofluorescence and western blot detection of Cap and Rep in transfected RAW 264.7 cells using hyperimmune rabbit antisera raised against the target proteins. Green fluorescence indicates positive expression of the respective proteins and cell nuclei were stained with DAPI as shown by blue fluorophore. (C) Western blot validation of Cap expression by the prokaryotic side of JOL2886 (p270:EuCap-Rep+ProCap).
Preprints 89214 g001
Figure 2. Schematic diagram of Salmonella-based vaccine delivery. (A) Graphical representation of live-attenuated Salmonella with genotype Δlon, Δcpxr, ΔsifA, Δasd electroporated with the constructed plasmids for bacterial-based vaccine delivery. (B) Vaccine delivery via intramuscular or oral administration, invasion of macrophages and dendritic cells (Antigen-presenting cells) and further spread through the bloodstream and lymphatics into different organs for induction of immune responses. The figure was created using BioRender online tool (https://app.biorender.com/). .
Figure 2. Schematic diagram of Salmonella-based vaccine delivery. (A) Graphical representation of live-attenuated Salmonella with genotype Δlon, Δcpxr, ΔsifA, Δasd electroporated with the constructed plasmids for bacterial-based vaccine delivery. (B) Vaccine delivery via intramuscular or oral administration, invasion of macrophages and dendritic cells (Antigen-presenting cells) and further spread through the bloodstream and lymphatics into different organs for induction of immune responses. The figure was created using BioRender online tool (https://app.biorender.com/). .
Preprints 89214 g002
Figure 3. Induction of humoral and mucosal immune responses by JOL2885 (p204:Cap-Rep) and JOL2886 (p270:EuCap-Rep+ProCap) in BALB/c mice. Groups of mice were given two doses of 1x107 CFU intramuscularly at 2-week intervals while other groups of mice were given four doses of 1x108 CFU orally at 1-week intervals. IgG level was assessed in the serum of immunized mice at 14 and 42 days after primary immunization by ELISA with Cap or Rep purified proteins as capture antigens. The secretory IgA (sIgA) level in the lung homogenate and intestinal wash was assessed by ELISA using Cap purified protein as capture antigen. Neutralizing antibody titer (NAb) at day 42 after primary immunization was quantified by serum neutralization (SN) test and analyzed by end-point dilution reduction assay. The SEM is denoted by the error bars. The data were analyzed by two-way ANOVA. * p <0.05, ** p < 0.01 and *** p < 0.001.
Figure 3. Induction of humoral and mucosal immune responses by JOL2885 (p204:Cap-Rep) and JOL2886 (p270:EuCap-Rep+ProCap) in BALB/c mice. Groups of mice were given two doses of 1x107 CFU intramuscularly at 2-week intervals while other groups of mice were given four doses of 1x108 CFU orally at 1-week intervals. IgG level was assessed in the serum of immunized mice at 14 and 42 days after primary immunization by ELISA with Cap or Rep purified proteins as capture antigens. The secretory IgA (sIgA) level in the lung homogenate and intestinal wash was assessed by ELISA using Cap purified protein as capture antigen. Neutralizing antibody titer (NAb) at day 42 after primary immunization was quantified by serum neutralization (SN) test and analyzed by end-point dilution reduction assay. The SEM is denoted by the error bars. The data were analyzed by two-way ANOVA. * p <0.05, ** p < 0.01 and *** p < 0.001.
Preprints 89214 g003
Figure 4. Cell-mediated immune responses by JOL2885 (p204:Cap-Rep) and JOL2886 (p270:EuCap-Rep+ProCap) in immunized BALB/c mice. 3 weeks post-immunization, collected splenocytes were stimulated with purified Cap and Rep proteins for 48 hrs. (A) Percentages of CD4+ and CD8+ T cells presented in a bar diagram as analyzed by flow cytometry. (B) Bar diagram showing splenocyte proliferation index after stimulation with Cap and Rep proteins. (C) Changes in the cytokine expression profile of IFN-γ, TNF-α and IL-4 in orally immunized mice were determined by qPCR. (D) Bar diagram showing the percentage of MHCI and MHCII molecules. The data were analyzed by two-way ANOVA. * p <0.05, ** p < 0.01 and *** p < 0.001.
Figure 4. Cell-mediated immune responses by JOL2885 (p204:Cap-Rep) and JOL2886 (p270:EuCap-Rep+ProCap) in immunized BALB/c mice. 3 weeks post-immunization, collected splenocytes were stimulated with purified Cap and Rep proteins for 48 hrs. (A) Percentages of CD4+ and CD8+ T cells presented in a bar diagram as analyzed by flow cytometry. (B) Bar diagram showing splenocyte proliferation index after stimulation with Cap and Rep proteins. (C) Changes in the cytokine expression profile of IFN-γ, TNF-α and IL-4 in orally immunized mice were determined by qPCR. (D) Bar diagram showing the percentage of MHCI and MHCII molecules. The data were analyzed by two-way ANOVA. * p <0.05, ** p < 0.01 and *** p < 0.001.
Preprints 89214 g004
Figure 5. Viral load in the organs of vaccinated mice after PCV2d challenge. Groups of mice were immunized with 2 doses of 1x107 CFU intramuscularly at 2-week intervals or with 4 doses of 1x108 CFU orally at 1-week intervals and then challenged with PCV2d intraperitoneally. (A) PCV2 Cap genomic copies in the liver and lungs of vaccinated mice 21 days after PCV2d challenge. (B) Representative images of immunohistochemical detection of PCV2 in liver, lungs and spleen of PCV2d challenged mice. Positive immunolabeling for PCV2 antigen was indicated by a dark brown signal (yellow arrow). All images are taken at 400x magnification. The bars represent the mean values and the SEM is donated by the error bars. The data were analyzed by two-way ANOVA. * p <0.05, ** p < 0.01 and *** p < 0.001.
Figure 5. Viral load in the organs of vaccinated mice after PCV2d challenge. Groups of mice were immunized with 2 doses of 1x107 CFU intramuscularly at 2-week intervals or with 4 doses of 1x108 CFU orally at 1-week intervals and then challenged with PCV2d intraperitoneally. (A) PCV2 Cap genomic copies in the liver and lungs of vaccinated mice 21 days after PCV2d challenge. (B) Representative images of immunohistochemical detection of PCV2 in liver, lungs and spleen of PCV2d challenged mice. Positive immunolabeling for PCV2 antigen was indicated by a dark brown signal (yellow arrow). All images are taken at 400x magnification. The bars represent the mean values and the SEM is donated by the error bars. The data were analyzed by two-way ANOVA. * p <0.05, ** p < 0.01 and *** p < 0.001.
Preprints 89214 g005
Table 1. List of plasmids, bacterial strains and primers used in the study.
Table 1. List of plasmids, bacterial strains and primers used in the study.
Plasmid/Bacteria/Primer Description Reference
Plasmids
 pET28a(+) IPTG-inducible expression vector; Kanamycin resistance Novagen, USA
 pJHL204 asd+, CMV promoter, RdRp complex, SV40 promoter, pBR322 ori [25]
 pJHL270 asd+, CMV eukaryotic promoter, Ptrc prokaryotic promoter, pBR322 ori [23]
 pJHL204:Cap-Rep asd+, CMV promoter, RdRp complex, SV40 promoter, pBR322 ori, Cap-P2A-Rep This study
 pJHL270:EuCap-Rep+ProCap asd+, CMV eukaryotic promoter, Cap-P2A-Rep, Ptrc prokaryotic promoter, Cap, pBR322 ori This study
S. Typhimurium
 JOL2500 Salmonella Typhimurium with genotype ∆lon ∆cpxr ∆sifA ∆asd Lab stock
 JOL2885 JOL2500 carrying pJHL204:Cap-Rep This study
 JOL2886 JOL2500 carrying pJHL270:EuCap-Rep+ProCap This study
E. coli
 DH5α E. coli F-Φ80dlacZ∆M15∆ (lacZYA-argF) U169recA1 endA1 hsdR17(rk-, mk+) phoA supE44 thi1 gyr A96 relA1λ- Lab stock
 JOL2873 DH5α carrying pET28(a) + Cap Lab stock
 JOL2869 DH5α carrying pET28(a) + Rep Lab stock
 JOL2874 DE3 carrying pET28(a) + Cap Lab stock
 JOL2870 DE3 carrying pET28(a) + Rep Lab stock
 E. coli 232 F – λ – φ80 ∆(lacZYA-argF) endA1 recA1 hadR17 deoR thi-1 glnV44 gyrA96 relA1 ∆asdA4 Lab stock
 JOL2881 E. coli 232 carrying pJHL204:Cap-Rep This study
 JOL2879 E. coli 232 carrying pJHL270:EuCap-Rep+ProCap This study
Primers
 CAP P2A FW GGGCCCATGACGTATCCAAGGAGGCGTTTC This study
 CAP-P2A33 RV CTTCAGCAGGCTGAAGTTAGTAGCTCCGCTTCCCTTAGGGTTAAGTGGGG This study
 P2A33-ORF1 FW CAGGCTGGAGACGTGGAGGAGAACCCTGGACCTATGCCCAGCAAGAAGAG This study
 ORF1 P2A RV GGCGCGCCTCAGTAATTTATTTCATATGGAAATTCAGGG This study
 CAP OEP RV CTCCAGCCTGCTTCAGCAGGCTGAAGTT This study
 ORF1 OEP FW CCTGCTGAAGCAGGCTGGAGACGTGGAG This study
 qPCR-Cap FW GTCTACATTTCCAGTAGTTTG [26]
 qPCR-Cap RV CTCCCGCCATACCATAA [26]
 IFN-γ FW TCAAGTGGCATAGATGTGGAAGAA [27]
 IFN-γ RV TGGCTCTGCAGGATTTTCATG [27]
 TNF-α FW CATCTTCTCAAAATTCGAGTGACAA [27]
 TNF-α RV TGGGAGTAGACAAGGTACAACCC [27]
 IL-4 FW ACAGGAGAAGGGACGCCAT [27]
 IL-4 RV GAAGCCCTACAGACGAGCTCA [27]
 β-actin FW AGAGGGAAATCGTGCGTGAC [27]
 β-actin RV CAATAGTGATGACCTGGCCGT [27]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.
Copyright: This open access article is published under a Creative Commons CC BY 4.0 license, which permit the free download, distribution, and reuse, provided that the author and preprint are cited in any reuse.
Prerpints.org logo

Preprints.org is a free preprint server supported by MDPI in Basel, Switzerland.

Subscribe

© 2026 MDPI (Basel, Switzerland) unless otherwise stated

Accessibility

Disclaimer

Terms of Use

Privacy Policy

Privacy Settings