Submitted:
30 August 2023
Posted:
31 August 2023
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Materials and methods
2.1. Bacterial strains and growth conditions
2.2. Characteristics of fermented kale juices
2.3. DPPH radical scavenging activity assay
2.4. ABTS radical scavenging activity assay
2.5. Quercetin and kaempferol analysis
2.61. H-NMR analysis
2.7. Cytotoxicity of fermented kale juice
2.8. Measurement of nitric oxide (NO) production
2.9. mRNA expression level of nitric oxide synthase (iNOS), cyclooxygenase-2 (COX-2), and cytokine
2.10. Enzyme and related genes
2.11. Statistical analysis
3. Results
3.1. Quality characteristics of fermented kale juice
3.1.1. Microbial growth in kale juice
3.1.2. Chromaticity analysis
3.1.3. Quantification of quercetin and kaempferol
3.1.41. H-NMR analysis
3.1.5. Enzyme and genes
3.2. Health-related characteristics of fermented kale juice
3.2.1. Cytotoxicity
3.2.2. Antioxidant activities
3.2.3. NO production
4. Discussion
5. Conclusion
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Marrero, S. C.; Martínez-Rodríguez, A.; Pérez, S. E. M.; Moya, S. P. New Trends and Applications in Fermented Beverages. Fermented Beverages, Elsevier, 2019, pp 31-66. [CrossRef]
- Septembre-Malaterre, A.; Remize, F.; Poucheret, P. Fruits and Vegetables, as a Source of Nutritional Compounds and Phytochemicals: Changes in Bioactive Compounds during Lactic Fermentation. Food Res Int. 2018, 104, 86–99. [Google Scholar] [CrossRef] [PubMed]
- Michalak, M.; Kubik-Komar, A.; Waśko, A.; Polak-Berecka, M. Starter Culture for Curly Kale Juice Fermentation Selected using Principal Component Analysis. Food Biosci. 2020, 35, 100602. [Google Scholar] [CrossRef]
- Szutowska, J. Functional Properties of Lactic Acid Bacteria in Fermented Fruit and Vegetable Juices: A Systematic Literature Review. Eur Food Res Technol. 2020, 246, 357–372. [Google Scholar] [CrossRef]
- Chung, H.-J.; Lee, H.; Na, G.; Jung, H.; Kim, D.-G.; Shin, S.-I.; Jung, S.-E.; Choi, I.-d.; Lee, J.-H.; Sim, J.-H. Metabolic and Lipidomic Profiling of Vegetable Juices Fermented with Various Probiotics. Biomolecules. 2020, 10, 725. [Google Scholar] [CrossRef]
- Kim, S. Y. Production of Fermented Kale Juices with Lactobacillus Strains and Nutritional Composition. Prev Nutr Food Sci. 2017, 22, 231. [Google Scholar] [CrossRef]
- Šamec, D.; Urlić, B.; Salopek-Sondi, B. Kale (Brassica oleracea var. acephala) as a Superfood: Review of the Scientific Evidence behind the Statement. Crit Rev food Sci Nutr. 2019, 59, 2411–2422. [Google Scholar] [CrossRef]
- Han, J.-H.; Lee, H.-J.; Kim, T.-S.; Kang, M.-H. The Effect of Glutathione S-Transferase M1 and T1 Polymorphisms on Blood Pressure, Blood Glucose, and Lipid Profiles following the Supplementation of Kale (Brassica oleracea acephala) Juice in South Korean Subclinical Hypertensive Patients. Nutr Res Pract. 2015, 9, 49–56. [Google Scholar] [CrossRef]
- Huang, Z.; Wang, B.; Eaves, D. H.; Shikany, J. M.; Pace, R. D. Phenolic Compound Profile of Selected Vegetables Frequently Consumed by African Americans in the Southeast United States. Food Chem. 2007, 103, 1395–1402. [Google Scholar] [CrossRef]
- Zielińska, M.; Lewandowska, U.; Podsędek, A.; Cygankiewicz, A. I.; Jacenik, D.; Sałaga, M.; Kordek, R.; Krajewska, W. M.; Fichna, J. Orally Available Extract from Brassica Oleracea var. Capitata Rubra Attenuates Experimental Colitis in Mouse Models of Inflammatory Bowel Diseases. J Funct Foods. 2015, 17, 587–599. [Google Scholar] [CrossRef]
- Leroy, F.; De Vuyst, L. Lactic acid Bacteria as Functional Starter Cultures for the Food Fermentation Industry. Trends Food Sci Technol. 2004, 15, 67–78. [Google Scholar] [CrossRef]
- Tamang, J. P.; Cotter, P. D.; Endo, A.; Han, N. S.; Kort, R.; Liu, S. Q.; Mayo, B.; Westerik, N.; Hutkins, R. Fermented Foods in a Global Age: East Meets West. Compr Rev Food Sci Food Saf 2020, 19, 184–217. [Google Scholar] [CrossRef]
- Hess, J. M. Role of Lactic Acid Bacteria in Impacting Nutrient Bioavailability. Lactic Acid Bacteria: A Functional Approach. 2020, 3, 35–57. [Google Scholar] [CrossRef]
- Jiang, X.; Liu, X.; Xu, H.; Sun, Y.; Zhang, Y.; Wang, Y. Improvement of the Nutritional, Antioxidant and Bioavailability Properties of Corn Gluten-Wheat Bran Mixture Fermented with Lactic Acid Bacteria and Acid Protease. LWT 2021, 144, 111161. [Google Scholar] [CrossRef]
- Hu, Y.; Zhang, L.; Wen, R.; Chen, Q.; Kong, B. Role of Lactic Acid Bacteria in Flavor Development in Traditional Chinese Fermented Foods: A Review. Crit Rev Food Sci Nutr. 2022, 62, 2741–2755. [Google Scholar] [CrossRef] [PubMed]
- Khatami, M. Unresolved Inflammation:‘Immune Tsunami’or Erosion of Integrity in Immune-Privileged and Immune-Responsive Tissues and Acute and Chronic Inflammatory Diseases or Cancer. Expert Opin Biol Ther. 2011, 11, 1419–1432. [Google Scholar] [CrossRef] [PubMed]
- Furman, D.; Campisi, J.; Verdin, E.; Carrera-Bastos, P.; Targ, S.; Franceschi, C.; Ferrucci, L.; Gilroy, D. W.; Fasano, A.; Miller, G. W. Chronic Inflammation in the Etiology of Disease across the Life span. Nat. Med. 2019, 25, 1822–1832. [Google Scholar] [CrossRef] [PubMed]
- Shahinozzaman, M.; Raychaudhuri, S.; Fan, S.; Obanda, D. N. Kale Attenuates Inflammation and Modulates Gut Microbial Composition and Function in C57BL/6J Mice with Diet-Induced Obesity. Microorganisms. 2021, 9, 238. [Google Scholar] [CrossRef]
- Hämäläinen, M.; Nieminen, R.; Asmawi, M. Z.; Vuorela, P.; Vapaatalo, H.; Moilanen, E. Effects of Flavonoids on Prostaglandin E2 Production and on COX-2 and mPGES-1 Expressions in Activated Macrophages. Planta Medica 2011, 77, 1504–1511. [Google Scholar] [CrossRef]
- De Marco, S.; Sichetti, M.; Muradyan, D.; Piccioni, M.; Traina, G.; Pagiotti, R.; Pietrella, D. Probiotic Cell-Free Supernatants Exhibited Anti-Inflammatory and Antioxidant Activity on Human Gut Epithelial Cells and Macrophages Stimulated with LPS. Evid based Complement Altern Med. 2018. [Google Scholar] [CrossRef]
- Cristofori, F.; Dargenio, V. N.; Dargenio, C.; Miniello, V. L.; Barone, M.; Francavilla, R. Anti-Inflammatory and Immunomodulatory Effects of Probiotics in Gut Inflammation: a Door to the Body. Front. Immunol. 2021, 12, 578386. [Google Scholar] [CrossRef]
- Plaza-Díaz, J.; Ruiz-Ojeda, F. J.; Vilchez-Padial, L. M.; Gil, A. Evidence of the Anti-Inflammatory Effects of Probiotics and Synbiotics in Intestinal Chronic Diseases. Nutrients. 2017, 9, 555. [Google Scholar] [CrossRef]
- Michalak, M.; Szwajgier, D.; Paduch, R.; Kukula-Koch, W.; Waśko, A.; Polak-Berecka, M. Fermented Curly Kale as a New Source of Gentisic and Salicylic Acids with Antitumor Potential. J Func Foods. 2020, 67, 103866. [Google Scholar] [CrossRef]
- Seo, H.; Seong, H.; Kim, G. Y.; Jo, Y. M.; Cheon, S. W.; Song, Y.; Ryu, B. H.; Kang, H.; Han, N. S. Development of Anti-Inflammatory Probiotic Limosilactobacillus reuteri EFEL 6901 as Kimchi Starter: In vitro and In vivo Evidence. Front Microb. 2021, 12, 760476. [Google Scholar] [CrossRef] [PubMed]
- Jo, Y. M.; Kim, G. Y.; Kim, S.-A.; Cheon, S. W.; Kang, C.-H.; Han, N. S. Limosilactobacillus fermentum MG7011: an Amylase and Phytase Producing Starter for the Preparation of Rice-based Probiotic Beverages. Front Microb. 2021, 12, 745952. [Google Scholar] [CrossRef] [PubMed]
- Kang, H.; Moon, J. S.; Lee, M.-G.; Han, N. S. Immunomodulatory Effects of Leuconostoc citreum EFEL2061 isolated from Kimchi, a Traditional Korean Food, on the Th2 Type-Dominant Immune Response in vitro and in vivo. J Func Foods. 2016, 20, 79–87. [Google Scholar] [CrossRef]
- Hur, S. J.; Lee, S. Y.; Kim, Y.-C.; Choi, I.; Kim, G.-B. Effect of Fermentation on the Antioxidant Activity in Plant-based Foods. Food Chem. 2014, 160, 346–356. [Google Scholar] [CrossRef] [PubMed]
- Biglari, F.; AlKarkhi, A. F.; Easa, A. M. Antioxidant activity and Phenolic Content of Various Date Palm (Phoenix dactylifera) Fruits from Iran. Food Chem. 2008, 107, 1636–1641. [Google Scholar] [CrossRef]
- Hagen, S. F.; Borge, G. I. A.; Solhaug, K. A.; Bengtsson, G. B. Effect of Cold Storage and Harvest Date on Bioactive Compounds in Curly Kale (Brassica oleracea L. var. acephala). Postharvest Biol Technol. 2009, 51, 36–42. [Google Scholar] [CrossRef]
- Rha, C.-S.; Seong, H.; Jung, Y. S.; Jang, D.; Kwak, J.-G.; Kim, D.-O.; Han, N. S. Stability and Fermentability of Green Tea Flavonols in in-vitro-Simulated Gastrointestinal Digestion and Human Fecal Fermentation. Int J Mol Sci. 2019, 20, 5890. [Google Scholar] [CrossRef] [PubMed]
- Yu, H.-S.; Lee, N.-K.; Choi, A.-J.; Choe, J.-S.; Bae, C. H.; Paik, H.-D. Anti-Inflammatory Potential of Probiotic Strain Weissella cibaria JW15 Isolated from Kimchi through Regulation of NF-κB and MAPKs Pathways in LPS-Induced RAW 264.7 cells. J Microbiol Biotechnol. 2019. [Google Scholar] [CrossRef]
- Tangyu, M.; Muller, J.; Bolten, C. J.; Wittmann, C. Fermentation of Plant-based Milk Alternatives for Improved Flavour and Nutritional Value. Appl Microbiol Biotechnol. 2019, 103, 9263–9275. [Google Scholar] [CrossRef] [PubMed]
- Dave, R. I.; Shah, N. P. Viability of Yoghurt and Probiotic Bacteria in Yoghurts Made from Commercial Starter Cultures. Int Dairy J. 1997, 7, 31–41. [Google Scholar] [CrossRef]
- Pinelo, M.; Arnous, A.; Meyer, A. S. Upgrading of Grape Skins: Significance of Plant Cell-Wall Structural Components and Extraction Techniques for Phenol Release. Trends Food Sci Technol. 2006, 17, 579–590. [Google Scholar] [CrossRef]
- Martins, S.; Mussatto, S. I.; Martínez-Avila, G.; Montañez-Saenz, J.; Aguilar, C. N.; Teixeira, J. A. Bioactive Phenolic Compounds: Production and Extraction by Solid-State Fermentation. A Review. Biotechnol Adv. 2011, 29, 365–373. [Google Scholar] [CrossRef]
- Acosta-Estrada, B. A.; Gutiérrez-Uribe, J. A.; Serna-Saldívar, S. O. Bound Phenolics in Foods, a Review. Food Chem. 2014, 152, 46–55. [Google Scholar] [CrossRef]
- Wang, X.; Yao, B.; Su, X. Linking Enzymatic Oxidative Degradation of Lignin to Organics Detoxification. Int J Mol Sci. 2018, 19, 3373. [Google Scholar] [CrossRef]
- Park, J. S.; Rho, H. S.; Kim, D. H.; Chang, I. S. Enzymatic Preparation of Kaempferol from Green Tea Seed and its Antioxidant Activity. J Agric Food Chem. 2006, 54, 2951–2956. [Google Scholar] [CrossRef]
- Nguyen Thai, H.; Van Camp, J.; Smagghe, G.; Raes, K. Improved Release and Metabolism of Flavonoids by Steered Fermentation Processes: a Review. Int J Mol Sci. 2014, 15, 19369–19388. [Google Scholar] [CrossRef]
- Gan, R. Y.; Shah, N. P.; Wang, M. F.; Lui, W. Y.; Corke, H. Lactobacillus plantarum WCFS1 Fermentation Differentially Affects Antioxidant Capacity and Polyphenol Content in Mung Bean (Vigna radiata) and Soya Bean (Glycine max) milks. J Food Process Preserv. 2017, 41, e12944. [Google Scholar] [CrossRef]
- Landete, J. M.; Curiel, J. A.; Rodríguez, H.; de las Rivas, B.; Munoz, R. Aryl Glycosidases from Lactobacillus plantarum Increase Antioxidant Activity of Phenolic Compounds. J Func Foods. 2014, 7, 322–329. [Google Scholar] [CrossRef]
- Kwaw, E.; Ma, Y.; Tchabo, W.; Apaliya, M. T.; Wu, M.; Sackey, A. S.; Xiao, L.; Tahir, H. E. Effect of Lactobacillus Strains on Phenolic Profile, Color Attributes and Antioxidant Activities of Lactic-Acid-Fermented Mulberry Juice. Food Chem. 2018, 250, 148–154. [Google Scholar] [CrossRef] [PubMed]
- Stübler, A.-S.; Lesmes, U.; Heinz, V.; Rauh, C.; Shpigelman, A., Aganovic, K. Digestibility, Antioxidative Activity and Stability of Plant Protein-Rich Products after Processing and Formulation with Polyphenol-Rich Juices: Kale and Kale–Strawberry as a Model. Eur Food Res Technol, 2019, 245, 2499-2514. [CrossRef]
- Jeganathan, B.; Punyasiri, P.; Kottawa-Arachchi, J. D.; Ranatunga, M. A.; Abeysinghe, I. S. B.; Gunasekare, M.; Bandara, B. Genetic Variation of Flavonols Quercetin, Myricetin, and Kaempferol in the Sri Lankan Tea (Camellia sinensis L.) and Their Health-Promoting Aspects. I J Food Sci. 2016. [CrossRef]
- Lampiasi, N.; Montana, G. The Molecular Events behind Ferulic Acid Mediated Modulation of IL-6 Expression in LPS-Activated Raw 264.7 Cells. Immunobiology. 2016, 221, 486–493. [Google Scholar] [CrossRef] [PubMed]
- Blonska, M.; Czuba, Z.; Krol, W. Effect of Flavone Derivatives on Interleukin-1β (IL-1β) mRNA Expression and IL-1β Protein Synthesis in Stimulated RAW 264.7 Macrophages. Scandinavian J Immunol. 2003, 57, 162–166. [Google Scholar] [CrossRef]
- Saiki, P.; Nakajima, Y.; Van Griensven, L. J.; Miyazaki, K. Real-Time Monitoring of IL-6 and IL-10 Reporter Expression for Anti-Inflammation Activity in Live RAW 264.7 Cells. Biochem Biophys Res Commun, 2018, 505, 885–890. [Google Scholar] [CrossRef] [PubMed]







| Species | Collection | Abbreviation | Culture condition |
|---|---|---|---|
| Limosilactobacillus reuteri EFEL6901 | KACC 81105BP | EFEL6901 | 37 ℃, MRS |
| L. fermentum EFEL6800 | KACC 81106BP | EFEL6800 | 37 ℃, MRS |
| L. fermentum MG7011 | KACC 81147BP | MG7011 | 37 ℃, MRS |
| Leuconostoc citreum EFEL2061 | KACC 92070P | EFEL2601 | 37 ℃, MRS |
| Lactiplantibacillus plantarum WCFS1 | ATCC BAA-793 | WCFS1 | 37 ℃, MRS |
| Lacticaseibacillus rhamnosus GG | KCTC 5033 | LGG | 37 ℃, MRS |
| Gene | Forward primer (5’-3’) | Reverse primer (5’-3’) |
|---|---|---|
| GAPDH | TTGTCTCCTGCGACTTCAACA | GCTGTAGCCGTATTCATTGTCATA |
| iNOS | ACCATGGAGCATCCCAAGTA | CCATGTACCAACCATTGAAGG |
| COX-2 | AGCATTCATTCCTCTACATAAGC | GTAACAACACTCACATATTCATACAT |
| TNF-α | ATGATCCGCGACGTGGAA | ACCGCCTGGAGTTCTGGA |
| IL-1β | GTTGACGGACCCCAAAAGAT | CACACACCAGCAGGTTATCA |
| IL-10 | GGACAACATACTGCTAACCGACTC | AAAATCACTCTTCACCTGCTCCAC |
| Sample | L* | a* | b* | ΔE* |
|---|---|---|---|---|
| Kale juice | 29.95±0.02 | -6.56±0.02 | 10.91±0.02 | - |
| PKJ | 34.61±0.00 a | -6.80±0.01 e | 15.14±0.03a | 6.30±0.04 |
| KJ-EFEL6901 | 34.02±0.01b | -0.01±0.01a | 13.73±0.02a | 6.80±0.02a |
| KJ-EFEL6800 | 34.59±0.03a | -1.36±0.01d | 15.25±0.09a | 5.67±0.04b |
| KJ-MG7011 | 34.61±0.04a | -0.76±0.04b | 15.70±1.44a | 6.49±0.47a |
| KJ-EFEL2061 | 34.64±0.02a | -0.85±0.01c | 14.65±0.01a | 6.07±0.04ab |
| Group | Metabolites | PKJ | KJ-EFEL6901 | KJ-EFEL6800 | KJ-MG7011 | KJ-EFEL2061 | |||
|---|---|---|---|---|---|---|---|---|---|
| Carbohydrates | Fructose | 0.65±0.12 | 0.08±0.01c* | 0.20±0.03a* | 0.14±0.00b* | 0.04±0.00d* | |||
| Glucose | 0.90±0.04 | 0.06±0.01* | 0.06±0.01* | 0.05±0.00* | 0.04±0.00* | ||||
| Mannose | 0.16±0.05 | 0.09±0.01* | 0.13±0.04 | 0.09±0.00* | 0.07±0.00* | ||||
| Sucrose | 0.14±0.01 | 0.02±0.00* | 0.05±0.04* | 0.05±0.00* | 0.02±0.00* | ||||
| Alcohols | Mannitol | 0.10±0.01 | 1.23±0.03a* | 1.14±0.05ab* | 1.10±0.02b* | 0.98±0.02c* | |||
| Ethanol | 0.24±0.01 | 1.74±0.06c* | 2.98±0.24a* | 2.25±0.05b* | 1.42±0.01c* | ||||
| Organic acids | Acetate | 0.19±0.01 | 3.24±0.33* | 3.54±0.11b* | 2.63±0.13b* | 1.76±0.25b* | |||
| Succinate | 0.09±0.01 | 0.85±0.04b* | 0.30±0.01c* | 1.30±0.17a* | 1.13±0.03 a* | ||||
| Lactate | 0.09±0.01 | 1.69±0.21a* | 1.86±0.03a* | 0.97±0.01b* | 0.49±0.02c* | ||||
| Propionate | 0.03±0.01 | 0.54±0.00bc* | 0.71±0.06b* | 0.63±0.04bc* | 0.84±0.03a* | ||||
| Pyruvate | 0.07±0.01 | 0.08±0.04 | 0.07±0.01 | 0.06±0.01* | 0.04±0.00* | ||||
| Butyrate | 0.04±0.00 | 0.30±0.01b* | 0.18±0.01b* | 0.23±0.40b* | 0.19±0.01a* | ||||
| Citrate | 0.12±0.02 | 0.02±0.01ab* | 0.04±0.01a* | 0.02±0.00ab* | 0.01±0.00b* | ||||
| Amino acids | Aspartate | 1.40±0.04 | 1.08±0.08a* | 0.04±0.01b* | 0.03±0.01b* | 0.06±0.01b* | |||
| Glutamate | 1.13±0.11 | 1.35±0.07a* | 0.33±0.02b* | 0.27±0.01b* | 0.06±0.00c* | ||||
| Cysteine | 0.06±0.01 | 0.17±0.01a* | 0.12±0.03b* | 0.12±0.00b* | 0.07±0.00bc | ||||
| Glycine | 0.08±0.03 | 0.13±0.01ab* | 0.16±0.02a* | 0.18±0.02a* | 0.06±0.00b | ||||
| Histidine | 0.01±0.00 | 0.01±0.01 | 0.01±0.00 | 0.00±0.00 | 0.01±0.00 | ||||
| Alanine | 0.91±0.03 | 0.58±0.01a* | 0.62±0.13a* | 0.48±0.03a* | 0.09±0.01b* | ||||
| Serine | 1.18±0.21 | 0.09±0.01b* | 0.12±0.01a* | 0.12±0.01ab* | 0.05±0.01c* | ||||
| Threonine | 0.30±0.03 | 0.02±0.00b* | 0.08±0.04b* | 0.18±0.03a* | 0.03±0.00b* | ||||
| Arginine | 0.78±0.04 | 0.05±0.01ab* | 0.03±0.01bc* | 0.02±0.00c* | 0.07±0.00a* | ||||
| Proline | 0.44±0.15 | 0.37±0.10 | 0.26±0.03 | 0.30±0.04 | 0.17±0.00 | ||||
| Tyrosine | 0.19±0.01 | 0.15±0.00b* | 0.03±0.00d* | 0.19±0.01a* | 0.06±0.00c* | ||||
| Valine | 0.53±0.21 | 0.47±0.08a* | 0.07±0.01b* | 0.40±0.01a* | 0.20±0.01ab* | ||||
| Methionine | 0.08±0.01 | 0.06±0.01 | 0.02±0.01a* | 0.01±0.00a* | 0.02±0.00a* | ||||
| Isoleucine | 0.43±0.05 | 0.29±0.02a* | 0.05±0.04b* | 0.11±0.01b* | 0.05±0.01b* | ||||
| Leucine | 0.48±0.02 | 0.31±0.07* | 0.14±0.00* | 0.16±0.00* | 0.10±0.01* | ||||
| Phenylalanine | 0.56±0.05 | 0.16±0.01b* | 0.05±0.03c* | 0.38±0.01a* | 0.10±0.01bc* | ||||
| Tryptophan | 0.23±0.02 | 0.21±0.01a* | 0.07±0.00c* | 0.14±0.01b* | 0.07±0.00c* | ||||
| Lysine | 0.63±0.03 | 0.43±0.05b* | 0.30±0.02c* | 0.70±0.01a | 0.09±0.00d* | ||||
| Related enzyme | EFEL6901 | EFEL6800 | ||
|---|---|---|---|---|
| Gene annotation | Protein ID | Gene annotation | Protein ID | |
| Glycoside hydrolase | Glycoside hydrolase family 13 protein | WP_003668994.1 | Glycoside hydrolase family 13 protein | WP_023466491.1 |
| Glycoside hydrolase family 65 protein | WP_003669571.1 | Glycoside hydrolase family 65 protein | WP_023465690.1 | |
| Glycoside hydrolase family 70 protein | WP_229392148.1 | |||
| Glycoside hydrolase family 73 protein | WP_003674860.1WP_003669289.1 | Glycoside hydrolase family 73 protein | WP_023466547.1WP_003681382.1WP_004562972.1 | |
| Glycoside hydrolase family 2 TIM barrel-domain containing protein | WP_003667314.1 | Glycoside hydrolase family 2 TIM barrel-domain containing protein | WP_282347715.1WP_282348494.1 | |
| Glycoside hydrolase family 3 N-terminal domain-containing protein | WP_075667436.1WP_240824081.1 | |||
| Family 78 glycoside hydrolase catalytic domain | WP_282348481.1 | |||
| Glucosidase | Alpha-glucosidase | WP_003669620.1 | Alpha-glucosidase | WP_023466314.1 |
| Glycosyl hydrolase 53 family protein | WP_003668597.1 | |||
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).