Submitted:
19 May 2023
Posted:
22 May 2023
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Results
3. Discussion
4. Materials and Methods
4.1. Chemicals
4.2. Host cell culture, maintenance and purification of tachyzoites
4.3. Proteomics
4.4. Data processing and statistics
4.5. Quantification of transcripts by multiplex TaqMan – qPCR
4.6. Statistics
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Acknowledgments
Conflicts of Interest
Abbreviations
References
- Dubey, J.P. Toxoplasmosis of animals and humans, 2nd ed.; CRC Press: Boca Raton, 2010; pp. xvii, 313 p., 314 p. of plates. [Google Scholar]
- Howe, D.K.; Sibley, L.D. Toxoplasma gondii comprises three clonal lineages: Correlation of parasite genotype with human disease. J Infect Dis 1995, 172, 1561–1566. [Google Scholar] [CrossRef] [PubMed]
- Darde, M.L. Toxoplasma gondii, "new" genotypes and virulence. Parasite 2008, 15, 366–371. [Google Scholar] [CrossRef] [PubMed]
- Kim, K.; Weiss, L.M. Toxoplasma gondii: The model apicomplexan. Int J Parasitol 2004, 34, 423–432. [Google Scholar] [CrossRef] [PubMed]
- Sidik, S.M.; Hackett, C.G.; Tran, F.; Westwood, N.J.; Lourido, S. Efficient genome engineering of Toxoplasma gondii using CRISPR/Cas9. PLoS ONE 2014, 9, e100450. [Google Scholar] [CrossRef] [PubMed]
- Sidik, S.M.; Huet, D.; Ganesan, S.M.; Huynh, M.H.; Wang, T.; Nasamu, A.S.; Thiru, P.; Saeij, J.P.; Carruthers, V.B.; Niles, J.C.; et al. A Genome-wide CRISPR screen in Toxoplasma Identifies essential apicomplexan genes. Cell 2016, 166, 1423–1435.e1412. [Google Scholar] [CrossRef]
- Heller, M.; Braga, S.; Müller, N.; Müller, J. Transfection with plasmid causing stable expression of a foreign gene affects general proteome pattern in Giardia lamblia trophozoites. Front Cell Infect Microbiol 2020, 10, 602756. [Google Scholar] [CrossRef]
- Templeton, T.J. Whole-genome natural histories of apicomplexan surface proteins. Trends Parasitol 2007, 23, 205–212. [Google Scholar] [CrossRef]
- Lekutis, C.; Ferguson, D.J.; Grigg, M.E.; Camps, M.; Boothroyd, J.C. Surface antigens of Toxoplasma gondii: Variations on a theme. Int J Parasitol 2001, 31, 1285–1292. [Google Scholar] [CrossRef]
- Tomavo, S. The major surface proteins of Toxoplasma gondii: Structures and functions. Curr Top Microbiol Immunol 1996, 219, 45–54. [Google Scholar] [CrossRef]
- Boothroyd, J.C.; Hehl, A.; Knoll, L.J.; Manger, I.D. The surface of Toxoplasma: More and less. Int J Parasitol 1998, 28, 3–9. [Google Scholar] [CrossRef]
- Jung, C.; Lee, C.Y.; Grigg, M.E. The SRS superfamily of Toxoplasma surface proteins. Int J Parasitol 2004, 34, 285–296. [Google Scholar] [CrossRef] [PubMed]
- Wasmuth, J.D.; Pszenny, V.; Haile, S.; Jansen, E.M.; Gast, A.T.; Sher, A.; Boyle, J.P.; Boulanger, M.J.; Parkinson, J.; Grigg, M.E. Integrated bioinformatic and targeted deletion analyses of the SRS gene superfamily identify SRS29C as a negative regulator of Toxoplasma virulence. MBio 2012, 3. [Google Scholar] [CrossRef] [PubMed]
- Kasper, L.H. Isolation and characterization of a monoclonal anti-P30 antibody resistant mutant of Toxoplasma gondii. Parasite Immunol 1987, 9, 433–445. [Google Scholar] [CrossRef] [PubMed]
- Hänggeli, K.P.A.; Hemphill, A.; Müller, N.; Schimanski, B.; Olias, P.; Müller, J.; Boubaker, G. Single- and duplex TaqMan-quantitative PCR for determining the copy numbers of integrated selection markers during site-specific mutagenesis in Toxoplasma gondii by CRISPR-Cas9. PLoS ONE 2022, 17, e0271011. [Google Scholar] [CrossRef] [PubMed]
- Kim, S.K.; Karasov, A.; Boothroyd, J.C. Bradyzoite-specific surface antigen SRS9 plays a role in maintaining Toxoplasma gondii persistence in the brain and in host control of parasite replication in the intestine. Infect Immun 2007, 75, 1626–1634. [Google Scholar] [CrossRef] [PubMed]
- Dzierszinski, F.; Mortuaire, M.; Cesbron-Delauw, M.F.; Tomavo, S. Targeted disruption of the glycosylphosphatidylinositol-anchored surface antigen SAG3 gene in Toxoplasma gondii decreases host cell adhesion and drastically reduces virulence in mice. Mol Microbiol 2000, 37, 574–582. [Google Scholar] [CrossRef] [PubMed]
- Frenal, K.; Soldati-Favre, D. Plasticity and redundancy in proteins important for Toxoplasma invasion. PLoS Pathog 2015, 11, e1005069. [Google Scholar] [CrossRef]
- Possenti, A.; Di Cristina, M.; Nicastro, C.; Lunghi, M.; Messina, V.; Piro, F.; Tramontana, L.; Cherchi, S.; Falchi, M.; Bertuccini, L.; et al. Functional characterization of the thrombospondin-related paralogous proteins rhoptry discharge factors 1 and 2 unveils phenotypic plasticity in Toxoplasma gondii rhoptry exocytosis. Front Microbiol 2022, 13, 899243. [Google Scholar] [CrossRef]
- Theisen, T.C.; Boothroyd, J.C. Transcriptional signatures of clonally derived Toxoplasma tachyzoites reveal novel insights into the expression of a family of surface proteins. PLoS ONE 2022, 17, e0262374. [Google Scholar] [CrossRef]
- Prucca, C.G.; Rivero, F.D.; Luján, H.D. Regulation of antigenic variation in Giardia lamblia. Annu Rev Microbiol 2011, 65, 611–630. [Google Scholar] [CrossRef]
- Müller, J.; Braga, S.; Uldry, A.C.; Heller, M.; Müller, N. Comparative proteomics of three Giardia lamblia strains: Investigation of antigenic variation in the post-genomic era. Parasitology 2020, 147, 1008–1018. [Google Scholar] [CrossRef] [PubMed]
- Müller, J.; Braga, S.; Heller, M.; Müller, N. Resistance formation to nitro drugs in Giardia lamblia: No common markers identified by comparative proteomics Int J Parasitol: Drugs Drug Resist 2019, 9, 112–119.
- Pays, E.; Vanhamme, L.; Perez-Morga, D. Antigenic variation in Trypanosoma brucei: Facts, challenges and mysteries. Curr Opin Microbiol 2004, 7, 369–374. [Google Scholar] [CrossRef] [PubMed]
- Stockdale, C.; Swiderski, M.R.; Barry, J.D.; McCulloch, R. Antigenic variation in Trypanosoma brucei: Joining the DOTs. PLoS Biol 2008, 6, e185. [Google Scholar] [CrossRef] [PubMed]
- Jublot, D.; Cavailles, P.; Kamche, S.; Francisco, D.; Fontinha, D.; Prudencio, M.; Guichou, J.F.; Labesse, G.; Sereno, D.; Loeuillet, C. A histone deacetylase (HDAC) inhibitor with pleiotropic in vitro anti-Toxoplasma and anti-Plasmodium activities controls acute and chronic Toxoplasma infection in mice. Int J Mol Sci 2022, 23, 3254. [Google Scholar] [CrossRef] [PubMed]
- Sullivan, W.J., Jr.; Hakimi, M.A. Histone mediated gene activation in Toxoplasma gondii. Mol Biochem Parasitol 2006, 148, 109–116. [Google Scholar] [CrossRef] [PubMed]
- Nardelli, S.C.; Che, F.Y.; Silmon de Monerri, N.C.; Xiao, H.; Nieves, E.; Madrid-Aliste, C.; Angel, S.O.; Sullivan, W.J., Jr.; Angeletti, R.H.; Kim, K.; et al. The histone code of Toxoplasma gondii comprises conserved and unique posttranslational modifications. MBio 2013, 4, e00922-00913. [Google Scholar] [CrossRef] [PubMed]
- Li, B. DNA double-strand breaks and telomeres play important roles in Trypanosoma brucei antigenic variation. Eukaryot Cell 2015, 14, 196–205. [Google Scholar] [CrossRef] [PubMed]
- Li, B.; Zhao, Y. Regulation of antigenic variation by Trypanosoma brucei telomere proteins depends on their unique DNA binding activities. Pathogens 2021, 10, 967. [Google Scholar] [CrossRef]
- Eraly, S.A. Striking differences between knockout and wild-type mice in global gene expression variability. PLoS ONE 2014, 9, e97734. [Google Scholar] [CrossRef]
- Slavov, N. Learning from natural variation across the proteomes of single cells. PLoS Biol 2022, 20, e3001512. [Google Scholar] [CrossRef]
- Westermann, L.; Li, Y.; Gocmen, B.; Niedermoser, M.; Rhein, K.; Jahn, J.; Cascante, I.; Scholer, F.; Moser, N.; Neubauer, B.; et al. Wildtype heterogeneity contributes to clonal variability in genome edited cells. Sci Rep 2022, 12, 18211. [Google Scholar] [CrossRef]
- Winzer, P.; Müller, J.; Aguado-Martinez, A.; Rahman, M.; Balmer, V.; Manser, V.; Ortega-Mora, L.M.; Ojo, K.K.; Fan, E.; Maly, D.J.; et al. In vitro and in vivo effects of the bumped kinase inhibitor 1294 in the related cyst-forming apicomplexans Toxoplasma gondii and Neospora caninum. Antimicrob Agents Chemother 2015, 59, 6361–6374. [Google Scholar] [CrossRef] [PubMed]
- Cox, J.; Mann, M. MaxQuant enables high peptide identification rates, individualized p.p.b.-range mass accuracies and proteome-wide protein quantification. Nat Biotechnol 2008, 26, 1367–1372. [Google Scholar] [CrossRef] [PubMed]
- Uldry, A.C.; Maciel-Dominguez, A.; Jornod, M.; Buchs, N.; Braga-Lagache, S.; Brodard, J.; Jankovic, J.; Bonadies, N.; Heller, M. Effect of sample transportation on the proteome of human circulating blood extracellular vesicles. Int J Mol Sci 2022, 23, 4515. [Google Scholar] [CrossRef] [PubMed]
- Müller, J.; Schlange, C.; Heller, M.; Uldry, A.C.; Braga-Lagache, S.; Haynes, R.K.; Hemphill, A. Proteomic characterization of Toxoplasma gondii ME49 derived strains resistant to the artemisinin derivatives artemiside and artemisone implies potential mode of action independent of ROS formation. Int J Parasitol Drugs Drug Resist 2022, 21, 1–12. [Google Scholar] [CrossRef]
- Vandesompele, J.; De Preter, K.; Pattyn, F.; Poppe, B.; Van Roy, N.; De Paepe, A.; Speleman, F. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol 2002, 3, RESEARCH0034. [Google Scholar] [CrossRef]
- Hellemans, J.; Mortier, G.; De Paepe, A.; Speleman, F.; Vandesompele, J. qBase relative quantification framework and software for management and automated analysis of real-time quantitative PCR data. Genome Biol 2007, 8, R19. [Google Scholar] [CrossRef]
- R_Core_Team R: A Language and Environment for Statistical Computing, Vienna, Austria, 2012.







| GN | Annotation | WT/C6 | WT/C18 | WT/C30 | WT/C33 |
|---|---|---|---|---|---|
| TGRH88_003360 | Unspecified product (putative transmembrane protein) | down | down | ||
| TGRH88_006930 | SAG-related sequence srs16C | up | |||
| TGRH88_012840 | Unspecified product (putative transmembrane protein) | up | |||
| TGRH88_016110 | SAG-related sequence srs36D | up | up | up | |
| TGRH88_017250 | Unspecified product | up | up | up | |
| TGRH88_021190 | cAMP-dependent protein kinase | down | |||
| TGRH88_029080 | Gamma-glutamyl hydrolase | up | |||
| TGRH88_029100 | Unspecified product | down | |||
| TGRH88_036500 | Multi-pass transmembrane protein | down | down | ||
| TGRH88_042260 | Unspecified product (putative transmembrane protein) | up | up | ||
| TGRH88_043760 | Putative translation elongation and release factors (GTPase) | down | down | ||
| TGRH88_046380 | Histone lysine methyltransferase set1 | down | down | ||
| TGRH88_055240 | Putative myosin heavy chain | up | |||
| TGRH88_062920 | Bifunctional dihydrofolate reductase - thymidylate synthase | down | down | ||
| TGRH88_073870 | MaoC family domain-containing protein | up | |||
| TGRH88_077450 | SAG-related sequence srs29B | up | up | up | up |
| GN | Annotation | C6/ C18 | C6/C30 | C6/ C33 | C18/C30 | C18/C33 | C30/ C33 |
|---|---|---|---|---|---|---|---|
| TGRH88_004120 | PRELI family protein | up | |||||
| TGRH88_006930 | SAG-related sequence srs16C | up | up | ||||
| TGRH88_008350 | Unspecified product ( putative iron-sulfur cluster assembly accessory protein) | down | down | ||||
| TGRH88_009830 | SAG-related sequence srs19F | down | |||||
| TGRH88_012840 | Unspecified product(putative transmembrane protein) | down | down | ||||
| TGRH88_014370 | Cathepsin cpc1 | down | up | ||||
| TGRH88_016110 | SAG-related sequence srs36D | down | down | down | up | ||
| TGRH88_016870 | Unspecified product | up | up | ||||
| TGRH88_017250 | Unspecified product | down | down | ||||
| TGRH88_021190 | cAMP-dependent protein kinase | up | up | up | |||
| TGRH88_046380 | Histone lysine methyltransferase set1 | down | down | ||||
| TGRH88_076630 | Unspecified product | down |
| Gene ID (ToxoDB) | Gene name | Forward primer (5’-3’) | Reverse primer (5’-3’) | Taqman - hydrolysis probe |
|---|---|---|---|---|
| TGRH88_014440 | Glyceraldehyde-3-phosphate dehydro-genase GAPDH1 | TGGAGGTTTTGGCGAT | ATGGCAGTTGGCTCCTT | HEX-TACCCCGGC-GAAGTCAGC-BHQ |
| TGRH88_016080 | SAG-related sequence SRS36B (SAG 5D) | TCAGAGGTCACCCGAGT | TCGTGGTGTCCTGGTTAC | FAM-CACCATCCAG-GTGATCCAGCC-BHQ |
| TGRH88_016110 | SAG-related sequence SRS36D (SAG 5C) | TGTATGGCAAGCGACAA | TGTGCACACCTCAGTTAGTG | FAM-ACGGGCAG-AGTGACAGCGCA-BHQ |
| TGRH88_040330 | SAG-related sequence SRS46 | TGCAGACGTACCGACAGT | TCTGCGTCGACGAGTG | FAM-TCTTCGCTG-CGGCAAAAACTT-BHQ |
| TGRH88_055140 | Alpha tubulin TUBA1 | GACGCCTTCAACACCTTC | TTGTTCGCAGCATCCT | Cy5-TTACCGCCA-CCTGTTCCACCC-BHQ |
| TGRH88_057630 | SAG-related sequence SRS57 (SAG 3) | TGCGATCTTGGGAAC | TCAGGGTGCTCTTTGTTC | FAM-TGTTCGTCG-CCGCAGGGA-BHQ |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).