Submitted:
08 February 2023
Posted:
09 February 2023
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Materials and Methods
2.1. Cell Lines and Culture Conditions
2.2. CRISPR/Cas9-Mediated TSPO Knockout
2.3. Western Blotting
2.4. RNA Isolation, Reverse Transcription and Quantitative Real-Time RT-PCR of Inflammatory Markers
2.5. ATP Content
2.6. Mitochondrial Membrane Potential
2.7. Cytosolic Ca2+ and Mitochondrial Ca2+ Levels
2.8. Pharmacology/Pro-Inflammatory Stimulation
2.9. Metabolic Profile
2.10. Statistical Analysis
3. Results
3.1. Mitochondrial DNA Copy Number
3.2. VDAC1 Expression
3.3. Intracellular Ca2+ Levels
3.4. Size of C20 Microglia Cells
3.5. Mitochondrial Membrane Potential
3.6. Metabolic Profile
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Prinz, M.; Priller, J., Microglia and brain macrophages in the molecular age: from origin to neuropsychiatric disease. Nat Rev Neurosci 2014, 15, (5), 300-12. [CrossRef]
- Sarma, S. D.; Chatterjee, K.; Dinda, H.; Chatterjee, D.; Sarma, J. D., Cytomorphological and Cytochemical Identification of Microglia. International Scholarly Research Notices 2013, 2013, 1-10. [CrossRef]
- Jang, E.; Kim, J. H.; Lee, S.; Kim, J. H.; Seo, J. W.; Jin, M.; Lee, M. G.; Jang, I. S.; Lee, W. H.; Suk, K., Phenotypic polarization of activated astrocytes: the critical role of lipocalin-2 in the classical inflammatory activation of astrocytes. J Immunol 2013, 191, (10), 5204-19. [CrossRef]
- Orihuela, R.; McPherson, C. A.; Harry, G. J., Microglial M1/M2 polarization and metabolic states. Br J Pharmacol 2016, 173, (4), 649-65. [CrossRef]
- Gordon, S.; Taylor, P. R., Monocyte and macrophage heterogeneity. Nat Rev Immunol 2005, 5, (12), 953-64. [CrossRef]
- Yao, R.; Pan, R.; Shang, C.; Li, X.; Cheng, J.; Xu, J.; Li, Y., Translocator Protein 18 kDa (TSPO) Deficiency Inhibits Microglial Activation and Impairs Mitochondrial Function. Front Pharmacol 2020, 11, 986. [CrossRef]
- Nair, S.; Sobotka, K. S.; Joshi, P.; Gressens, P.; Fleiss, B.; Thornton, C.; Mallard, C.; Hagberg, H., Lipopolysaccharide-induced alteration of mitochondrial morphology induces a metabolic shift in microglia modulating the inflammatory response in vitro and in vivo. Glia 2019, 67, (6), 1047-1061. [CrossRef]
- Papadopoulos, V.; Baraldi, M.; Guilarte, T. R.; Knudsen, T. B.; Lacapere, J. J.; Lindemann, P.; Norenberg, M. D.; Nutt, D.; Weizman, A.; Zhang, M. R.; Gavish, M., Translocator protein (18kDa): new nomenclature for the peripheral-type benzodiazepine receptor based on its structure and molecular function. Trends Pharmacol Sci 2006, 27, (8), 402-9. [CrossRef]
- Cosenza-Nashat, M.; Zhao, M. L.; Suh, H. S.; Morgan, J.; Natividad, R.; Morgello, S.; Lee, S. C., Expression of the translocator protein of 18 kDa by microglia, macrophages and astrocytes based on immunohistochemical localization in abnormal human brain. Neuropathol Appl Neurobiol 2009, 35, (3), 306-28. [CrossRef]
- Rupprecht, R.; Papadopoulos, V.; Rammes, G.; Baghai, T. C.; Fan, J.; Akula, N.; Groyer, G.; Adams, D.; Schumacher, M., Translocator protein (18 kDa) (TSPO) as a therapeutic target for neurological and psychiatric disorders. Nat Rev Drug Discov 2010, 9, (12), 971. [CrossRef]
- Rupprecht, R.; Wetzel, C. H.; Dorostkar, M.; Herms, J.; Albert, N. L.; Schwarzbach, J.; Schumacher, M.; Neumann, I. D., Translocator protein (18kDa) TSPO: a new diagnostic or therapeutic target for stress-related disorders? Mol Psychiatry 2022, 27, (7), 2918-2926. [CrossRef]
- Banati, R. B.; Middleton, R. J.; Chan, R.; Hatty, C. R.; Kam, W. W.; Quin, C.; Graeber, M. B.; Parmar, A.; Zahra, D.; Callaghan, P.; Fok, S.; Howell, N. R.; Gregoire, M.; Szabo, A.; Pham, T.; Davis, E.; Liu, G. J., Positron emission tomography and functional characterization of a complete PBR/TSPO knockout. Nat Commun 2014, 5, 5452. [CrossRef]
- Morohaku, K.; Pelton, S. H.; Daugherty, D. J.; Butler, W. R.; Deng, W.; Selvaraj, V., Translocator protein/peripheral benzodiazepine receptor is not required for steroid hormone biosynthesis. Endocrinology 2014, 155, (1), 89-97. [CrossRef]
- Tu, L. N.; Morohaku, K.; Manna, P. R.; Pelton, S. H.; Butler, W. R.; Stocco, D. M.; Selvaraj, V., Peripheral benzodiazepine receptor/translocator protein global knock-out mice are viable with no effects on steroid hormone biosynthesis. J Biol Chem 2014, 289, (40), 27444-54. [CrossRef]
- Papadopoulos, V.; Fan, J.; Zirkin, B., Translocator protein (18 kDa): an update on its function in steroidogenesis. J Neuroendocrinol 2018, 30, (2). [CrossRef]
- Bader, S.; Wolf, L.; Milenkovic, V. M.; Gruber, M.; Nothdurfter, C.; Rupprecht, R.; Wetzel, C. H., Differential effects of TSPO ligands on mitochondrial function in mouse microglia cells. Psychoneuroendocrinology 2019, 106, 65-76. [CrossRef]
- Milenkovic, V. M.; Slim, D.; Bader, S.; Koch, V.; Heinl, E. S.; Alvarez-Carbonell, D.; Nothdurfter, C.; Rupprecht, R.; Wetzel, C. H., CRISPR-Cas9 Mediated TSPO Gene Knockout alters Respiration and Cellular Metabolism in Human Primary Microglia Cells. Int J Mol Sci 2019, 20, (13), 3359. [CrossRef]
- Germelli, L.; Da Pozzo, E.; Giacomelli, C.; Tremolanti, C.; Marchetti, L.; Wetzel, C. H.; Barresi, E.; Taliani, S.; Da Settimo, F.; Martini, C.; Costa, B., De novo neurosteroidogenesis in human microglia: Involvement of the 18 kDa translocator protein. Int J Mol Sci 2021, 22, (6), 3115. [CrossRef]
- Wolf, L.; Bauer, A.; Melchner, D.; Hallof-Buestrich, H.; Stoertebecker, P.; Haen, E.; Kreutz, M.; Sarubin, N.; Milenkovic, V. M.; Wetzel, C. H.; Rupprecht, R.; Nothdurfter, C., Enhancing neurosteroid synthesis--relationship to the pharmacology of translocator protein (18 kDa) (TSPO) ligands and benzodiazepines. Pharmacopsychiatry 2015, 48, (2), 72. [CrossRef]
- Owen, D. R.; Fan, J.; Campioli, E.; Venugopal, S.; Midzak, A.; Daly, E.; Harlay, A.; Issop, L.; Libri, V.; Kalogiannopoulou, D.; Oliver, E.; Gallego-Colon, E.; Colasanti, A.; Huson, L.; Rabiner, E. A.; Suppiah, P.; Essagian, C.; Matthews, P. M.; Papadopoulos, V., TSPO mutations in rats and a human polymorphism impair the rate of steroid synthesis. Biochem J 2017, 474, (23), 3985. [CrossRef]
- Liu, G. J.; Middleton, R. J.; Kam, W. W.; Chin, D. Y.; Hatty, C. R.; Chan, R. H.; Banati, R. B., Functional gains in energy and cell metabolism after TSPO gene insertion. Cell Cycle 2017, 16, (5), 436-447. [CrossRef]
- Tu, L. N.; Zhao, A. H.; Hussein, M.; Stocco, D. M.; Selvaraj, V., Translocator Protein (TSPO) Affects Mitochondrial Fatty Acid Oxidation in Steroidogenic Cells. Endocrinology 2016, 157, (3), 1110-21. [CrossRef]
- Gatliff, J.; East, D.; Crosby, J.; Abeti, R.; Harvey, R.; Craigen, W.; Parker, P.; Campanella, M., TSPO interacts with VDAC1 and triggers a ROS-mediated inhibition of mitochondrial quality control. Autophagy 2014, 10, (12), 2279. [CrossRef]
- Gatliff, J.; East, D. A.; Singh, A.; Alvarez, M. S.; Frison, M.; Matic, I.; Ferraina, C.; Sampson, N.; Turkheimer, F.; Campanella, M., A role for TSPO in mitochondrial Ca(2+) homeostasis and redox stress signaling. Cell Death Dis 2017, 8, (6), e2896. [CrossRef]
- Papadopoulos, V.; Lecanu, L., Translocator protein (18 kDa) TSPO: an emerging therapeutic target in neurotrauma. Exp Neurol 2009, 219, (1), 53-7. [CrossRef]
- Shoshan-Barmatz, V.; Pittala, S.; Mizrachi, D., VDAC1 and the TSPO: Expression, interactions, and associated functions in health and disease states. Int J Mol Sci 2019, 20, (13), 3348. [CrossRef]
- Davis, R. L.; Buck, D. J.; McCracken, K.; Cox, G. W.; Das, S., Interleukin-1β-induced inflammatory signaling in C20 human microglial cells. Neuroimmunology and Neuroinflammation 2018, 2018. [CrossRef]
- Garcia-Mesa, Y.; Jay, T. R.; Checkley, M. A.; Luttge, B.; Dobrowolski, C.; Valadkhan, S.; Landreth, G. E.; Karn, J.; Alvarez-Carbonell, D., Immortalization of primary microglia: a new platform to study HIV regulation in the central nervous system. J Neurovirol 2017, 23, (1), 47-66. [CrossRef]
- Ran, F. A.; Hsu, P. D.; Wright, J.; Agarwala, V.; Scott, D. A.; Zhang, F., Genome engineering using the CRISPR-Cas9 system. Nat Protoc 2013, 8, (11), 2281-2308. [CrossRef]
- Schneider, C. A.; Rasband, W. S.; Eliceiri, K. W., NIH Image to ImageJ: 25 years of image analysis. Nat Methods 2012, 9, (7), 671-5. [CrossRef]











| Primer name | Forward primer (5´-3´) | Reverse primer (5´-3´) |
|---|---|---|
| TSPO-ex1 | GAGGTGGCTTTGAGGAGTGA | GCAGGGTTGTCCAAGTTTTC |
| TSPO-ex2 | CTGGAAATGCGTTCACTCAG | GCCTGGAGAAGACCCTCTGT |
| TSPO-ex3 | GAAGCACTGCCAATGTGCTA | GCTTCGTGTGGGTTTTCCTA |
| TSPO-ex4 | AGTTGGGCAGTGGGACAG | GCAGATCCTGCAGAGACGA |
| TNFA | CCCCAGGGACCTCTCTCTAA | CAGCTTGAGGGTTTGCTACA |
| IL1B | CTGTCCTGCGTGTTGAAAGA | TGAAGACAAATCGCTTTTCCA |
| TSPO | TCTTTGGTGCCCGACAAAT | GGTACCAGGCCACGGTAGT |
| IL6 | CTCAGCCCTGAGAAAGGAGA | AGGTTGTTTTCTGCCAGTGC |
| IL12A | CATGCTGGCAGTTATTGATGA | TCAAGGGAGGATTTTTGTGG |
| NOS2 | GTATCCTGGAGCGAGTGGTG | GACCCAGTAGCTGCCACTCT |
| CXCL8 | TGCGCCAACACAGAAATTAT | TGAATTCTCAGCCCTCTTCAA |
| HPRT1 | TTGCTTTCCTTGGTCAGGCA | ATCCAACACTTCGTGGGGTC |
| Mt-TL1 | CACCCAAGAACAGGGTTTGT | TGGCCATGGGTATGTTGTTA |
| B2M | TGCTGTCTCCATGTTTGATGTATCT | TCTCTGCTCCCCACCTCTAAGT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).