Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

The cytosolic PNGase (peptide:N-glycanase; Png1 in yeast; NGLY1/Ngly1 in human/mice), also known as peptide-N4-(N-acetyl-beta-glucosaminyl)-asparagine ami-dase, is a well-conserved deglycosylation enzyme (EC 3.5.1.52) which catalyzes the non-lysosomal hydrolysis of an N(4)-(acetyl-β-D-glucosaminyl) asparagine residue into N-acetyl-β-D-glucosaminylamine and a peptide containing an aspartate residue. This enzyme (NGLY1) plays essential roles in clearance of misfolded or unassembled gly-coproteins through a process named ER-associated degradation (ERAD). Accumulating evidence also points out that NGLY1 deficiency can cause an autosomal recessive hu-man genetic disorder associated with abnormal development and congenital disorder of deglycosylation. In addition, the loss of NGLY1 can affect multiple cellular pathways, including but not limited to NFE2L1 pathway, Creb1/Atf1-AQP pathway, BMP path-way, AMPK pathway, and SLC12A2 ion transporter, which might be the underlying reasons for a constellation of clinical phenotypes of NGLY1 deficiency. The current comprehensive review indeed uncovers the detailed NGLY1’s structure and its im-portant roles for participation in ERAD, involvement in CDDG and potential treatment for NGLY1 deficiency.