The new energy structure needs to balance energy security and dual carbon goals, which has brought major challenges to coal-fired power plants, the pollution reduction and carbon emissions reduction of coal-fired power plants will be a key task in the future. This article proposes an optimization operation of electrostatic precipitators(ESP), based on the working mechanism and historical data of ESP, voltage-current characteristic model and outlet dust concentration prediction model are constructed by deep learning algorithm, Particle Swarm Optimization(PSO) is used to achieve the optimal energy consumption while ensuring stable outlet dust concentration. By training with historical data collected on site, accurate prediction of secondary current and outlet dust concentration of ESP has been achieved, the Mean Absolute Percentage Error(MAPE) of secondary current is less than 1.5%, and the MAPE of outlet dust concentration of ESP on the test set is less than 5.2%. Finally, the optimization experiment is carried out in a 330MW coal-fired power plants, the results showed that the fluctuation of the outlet dust concentration is more stable, and the energy saving is about 43% after optimization, according to the annual operation of 300 days, the annual average carbon reduction is approximately 2621.34 tons. This method is effective and can be applied widely.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Staphylococcus aureus(S. aureus) is associated with mastitis in dairy cows, this study investigates the therapeutic effect of maggot antimicrobial peptides on S. aureus induced mastitis in mice. The maggot AMP was isolated and purified, tested for antimicrobial activity, and used to treat a pathological model of rat mastitis. The concentration of 1.5mg/（Kg. BW）AMP was selected as intramammary treatment in S. aureus-induced mastitis in mice. The mice were divided into four groups of 30 mice each: group I (healthy control), group II (disease control), group III (AMP), and group IV (ciprofloxacin). To evaluate the therapeutic efficacy of maggot AMP in mastitis induced by S. aureus based on clinical presentation, mammary gland structure, bacterial load, histopathology, and cure. During the 7-day treatment period, all the mice in Group II died in the afternoon of the fifth day, and the clinical signs of the mice in Group III began to improve on the third day, as evidenced by the gradual recovery of the mice's mental status, dietary intake, and water intake. During the treatment period, the bacterial load count of Group III was significantly lower than that of Group II but higher than that of Group IV, while the bacterial load count of Group III gradually decreased and approached that of Group IV from the fifth to the seventh day. The levels of TNF-α in groups III and IV were significantly lower than those in group II, suggesting that maggot AMP has a certain inhibitory effect on TNF-α. Treatment with AMP@ 1.5 mg/(Kg. BW) showed restoration of clinical signs, reduced bacterial load, and lower TNF-α levels in mice, leading to significant improvement in histopathological changes as compared to disease controls. The final cure rate was 40% for mice in Group III compared to 70% for mice in Group IV, compared to all mice in Group II that died. From this study, it can be concluded that maggot AMP can be used as a potential alternative treatment option to antibiotics for the treatment of bovine mastitis.

The influence of growth temperature on the crystalline quality and optical properties of AlGaN at 325 nm, grown using plasma-assisted molecular beam epitaxy (MBE), was investigated. The growth temperature exhibited a significant impact on the growth mode and surface morphology. Specifically, at a growth temperature of 750 degrees Celsius, when appropriate Al and Ga flow rates were employed, the AlGaN layer exhibited exceptional surface morphology and favorable optical properties. The optical properties of the AlGaN material were explored, revealing the presence of two distinct non-radiative recombination centers characterized by different activation energies. The minority carrier lifetimes were measured as 560 ps at 10 K and 64 ps at room temperature. The underlying mechanism was analyzed from the perspective of carrier dynamics, shedding light on the observed phenomena.