Submitted:
04 August 2026
Posted:
04 August 2026
You are already at the latest version
Abstract

Keywords:
1. Introduction
2. Materials and Methods
2.1. Bacterial Strains, Growth Media and Conditions
2.2. Isolation of Listeria spp. from Wastewater Using Anti-Listeria Immunomagnetic Beads
2.3. Phenotypic Reaction of Listeria spp. Isolated from Municipal and Dairy Center on Listeria Brilliance Agar
2.4. Identity of Listeria monocytogenes and Listeria Species Isolated from Wastewater
2.4.1. PCR and Sequence Analysis of 16S rRNA, sigB, and iap Genes of Isolates from Municipal and Dairy Wastewater
2.4.2. Agarose Gel Analysis of L. monocytogenes Pathogenic Island (LmPI-1) Genes Involved in Pathogenesis
3. Results and Discussion
3.1. Isolation of Listeria from Wastewater
3.2. Phenotypic Reactions of Listeria spp. on Selective Media Isolated from Municipal and Dairy Center Environmental Sources of Wastewater
3.2.1. Phenotypic Reactions on MOX Agar
3.2.2. Phenotypic Reactions on Listeria Brilliance Agar
3.3. Sequence Analysis of Control Strains and Putative Listeria Isolates from Wastewater
3.3.1. Sequence Analysis of 16S rRNA Genes

3.3.2. Sequence Analysis of Listeria Sigma Factor B Genes
3.3.3. Sequence Analysis of Listeria iap Genes
3.3.4. PCR and Agarose Gel Electrophoresis of Amplimers Involved with Listeria monocytogenes Pathogenic Island 1 (LmPI-1) Genes
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Shamloo, E.; Hosseini, H.; Abdi Moghadam, Z.; Halberg Larsen, M.; Haslberger, A.; Alebouyeh, M. Importance of Listeria monocytogenes in food safety: a review of its prevalence, detection, and antibiotic resistance. Iran J Vet Res 2019, 20, 241–254.
- Troja, F.; Indio, V.; Savini, F.; Seguino, A.; Serraino, A.; Fuschi, A.; Remondini, D.; De Cesare, A. Monitoring and preventing foodborne outbreaks: are we missing wastewater as a key data source? Ital J Food Saf 2024, 13, 12725. [CrossRef]
- National Academies of Sciences, E.; Medicine; Health; Medicine, D.; Board on Population, H.; Public Health, P.; Division on, E.; Life, S.; Water, S.; Technology, B., et al. In Increasing the Utility of Wastewater-based Disease Surveillance for Public Health Action: A Phase 2 Report, National Academies Press (US) Copyright 2024 by the National Academy of Sciences. All rights reserved.: Washington (DC), 2024; 10.17226/27516.
- Grassly, N.C.; Shaw, A.G.; Owusu, M. Global wastewater surveillance for pathogens with pandemic potential: opportunities and challenges. The Lancet Microbe 2025, 6. [CrossRef]
- Singh, S.; Ahmed, A.I.; Almansoori, S.; Alameri, S.; Adlan, A.; Odivilas, G.; Chattaway, M.A.; Salem, S.B.; Brudecki, G.; Elamin, W. A narrative review of wastewater surveillance: pathogens of concern, applications, detection methods, and challenges. Frontiers in Public Health 2024, Volume 12 - 2024. [CrossRef]
- Kayode, A.J.; Semerjian, L.; Osaili, T.; Olapade, O.; Okoh, A.I. Occurrence of Multidrug-Resistant Listeria monocytogenes in Environmental Waters: A Menace of Environmental and Public Health Concern. Frontiers in Environmental Science 2021, Volume 9 - 2021. [CrossRef]
- Stea, E.C.; Purdue, L.M.; Jamieson, R.C.; Yost, C.K.; Hansen, L.T. Comparison of the Prevalences and Diversities of Listeria Species and Listeria monocytogenes in an Urban and a Rural Agricultural Watershed. Applied and Environmental Microbiology 2015, 81, 3812–3822, doi:doi:10.1128/AEM.00416-15.
- Fagerlund, A.; Møretrø, T.; Jensen, M.R.; Langsrud, S.; Moen, B. Early detection and population dynamics of Listeria monocytogenes in naturally contaminated drains from a meat processing plant. Frontiers in Microbiology 2025, Volume 16 - 2025. [CrossRef]
- Hellberg, R.S.; Martin, K.G.; Keys, A.L.; Haney, C.J.; Shen, Y.; Smiley, R.D. 16S rRNA partial gene sequencing for the differentiation and molecular subtyping of Listeria species. Food Microbiology 2013, 36, 231–240. [CrossRef]
- Somer, L.; Kashi, Y. A PCR Method Based on 16S rRNA Sequence for Simultaneous Detection of the Genus Listeria and the Species Listeria monocytogenes in Food Products. Journal of Food Protection 2003, 66, 1658–1665. [CrossRef]
- Nightingale, K.; Bovell, L.; Grajczyk, A.; Wiedmann, M. Combined sigB allelic typing and multiplex PCR provide improved discriminatory power and reliability for Listeria monocytogenes molecular serotyping. Journal of Microbiological Methods 2007, 68, 52–59. [CrossRef]
- Liao, J.; Wiedmann, M.; Kovac, J. Genetic Stability and Evolution of the sigB Allele, Used for Listeria Sensu Stricto Subtyping and Phylogenetic Inference. Applied and Environmental Microbiology 2017, 83, e00306–00317, doi:doi:10.1128/AEM.00306-17.
- Bubert, A.; Köhler, S.; Goebel, W. The homologous and heterologous regions within the iap gene allow genus- and species-specific identification of Listeria spp. by polymerase chain reaction. Applied and Environmental Microbiology 1992, 58, 2625–2632. [CrossRef]
- Liu, D. Identification, subtyping and virulence determination of Listeria monocytogenes, an important foodborne pathogen. Journal of Medical Microbiology 2006, 55, 645–659. [CrossRef]
- Wiktorczyk-Kapischke, N.; Skowron, K.; Wałecka-Zacharska, E. Genomic and pathogenicity islands of Listeria monocytogenes—overview of selected aspects. Frontiers in Molecular Biosciences 2023, Volume 10 - 2023. [CrossRef]
- Suresh, D.; Puttananjaiah, M.H.; Dhale, M.A. Listeria monocytogenes isolated on selective chromogenic plating media necessitates further characterization to confirm its presence in dairy foods. International Dairy Journal 2025, 164, 106197. [CrossRef]
- Park, S.-H.; Chang, P.-S.; Ryu, S.; Kang, D.-H. Development of a Novel Selective and Differential Medium for the Isolation of Listeria monocytogenes. Applied and Environmental Microbiology 2014, 80, 1020–1025, doi:doi:10.1128/AEM.02840-13.
- Karolenko, C.; DeSilva, U.; Muriana, P.M. Microbial Profiling of Biltong Processing Using Culture-Dependent and Culture-Independent Microbiome Analysis. Foods 2023, 12, 844.
- Wu, J.; NicAogáin, K.; McAuliffe, O.; Jordan, K.; O’Byrne, C. Phylogenetic and Phenotypic Analyses of a Collection of Food and Clinical Listeria monocytogenes Isolates Reveal Loss of Function of Sigma B from Several Clonal Complexes. Applied and Environmental Microbiology 2022, 88, e00051–00022, doi:doi:10.1128/aem.00051-22.
- Johansson, J.; Freitag, N.E. Regulation of Listeria monocytogenes Virulence. Microbiology Spectrum 2019, 7, 10.1128/microbiolspec.gpp1123–0064–2019, doi:doi:10.1128/microbiolspec.gpp3-0064-2019.
- de Bruin, O.M.; Birnboim, H.C. A method for assessing efficiency of bacterial cell disruption and DNA release BMC Microbiology 2016, 16, 197. [CrossRef]
- Anderson, S.R.; Thompson, L.R. Optimizing an enclosed bead beating extraction method for microbial and fish environmental DNA. Environmental DNA 2022, 4, 291–303. [CrossRef]
- Coton, E.; Coton, M. Multiplex PCR for colony direct detection of Gram-positive histamine- and tyramine-producing bacteria. Journal of Microbiological Methods 2005, 63, 296–304. [CrossRef]
- Yang, B.; Wang, Y.; Qian, P.-Y. Sensitivity and correlation of hypervariable regions in 16S rRNA genes in phylogenetic analysis. BMC Bioinformatics 2016, 17, 135. [CrossRef]
- Vlaemynck, G.; Lafarge, V.; Scotter, S. Improvement of the detection of Listeria monocytogenes by the application of ALOA, a diagnostic, chromogenic isolation medium. Journal of Applied Microbiology 2000, 88, 430–441.
- Reissbrodt, R. New chromogenic plating media for detection and enumeration of pathogenic Listeria spp.—an overview. International Journal of Food Microbiology 2004, 95, 1–9. [CrossRef]
- Smith, P.A.; Mellors, D.; Holroyd, A.; Gray, C. A new chromogenic medium for the isolation of Listeria spp. Letters in Applied Microbiology 2001, 32, 78–82. [CrossRef]
- Yeung, P.S.M.; Na, Y.; Kreuder, A.J.; Marquis, H. Compartmentalization of the Broad-Range Phospholipase C Activity to the Spreading Vacuole Is Critical for Listeria monocytogenes Virulence. Infection and Immunity 2007, 75, 44–51, doi:doi:10.1128/iai.01001-06.
- Petrišič, N.; Adamek, M.; Kežar, A.; Hočevar, S.B.; Žagar, E.; Anderluh, G.; Podobnik, M. Structural basis for the unique molecular properties of broad-range phospholipase C from Listeria monocytogenes. Nature Communications 2023, 14, 6474. [CrossRef]
- Greenwood, M.; Willis, C.; Doswell, P.; Allen, G.; Pathak, K. Evaluation of chromogenic media for the detection of Listeria species in food. Journal of Applied Microbiology 2005, 99, 1340–1345. [CrossRef]
- Stessl, B.; Luf, W.; Wagner, M.; Schoder, D. Performance testing of six chromogenic ALOA-type media for the detection of Listeria monocytogenes. Journal of Applied Microbiology 2009, 106, 651–659. [CrossRef]
- Carlin, C.R.; Liao, J.; Weller, D.; Guo, X.; Orsi, R.; Wiedmann, M. Listeria cossartiae sp. nov., Listeria immobilis sp. nov., Listeria portnoyi sp. nov. and Listeria rustica sp. nov., isolated from agricultural water and natural environments. International Journal of Systematic and Evolutionary Microbiology 2021, 71. [CrossRef]
- Orsi, R.H.; Liao, J.; Carlin, C.R.; Wiedmann, M. Taxonomy, ecology, and relevance to food safety of the genus Listeria with a particular consideration of new Listeria species described between 2010 and 2022. mBio 2024, 15, e00938–00923, doi:doi:10.1128/mbio.00938-23.
- Sibanda, T.; Buys, E.M. Listeria monocytogenes Pathogenesis: The Role of Stress Adaptation. Microorganisms 2022, 10, 1522.
- Liu, Y.; Orsi, R.H.; Gaballa, A.; Wiedmann, M.; Boor, K.J.; Guariglia-Oropeza, V. Systematic Review of the Listeria Monocytogenes σB Regulon Supports a Role in Stress Response, Virulence and Metabolism. Future Microbiology 2019, 14, 801–828. [CrossRef]
- Cai, S.; Kabuki, D.Y.; Kuaye, A.Y.; Cargioli, T.G.; Chung, M.S.; Nielsen, R.; Wiedmann, M. Rational Design of DNA Sequence-Based Strategies for Subtyping Listeria monocytogenes. Journal of Clinical Microbiology 2002, 40, 3319–3325, doi:doi:10.1128/jcm.40.9.3319-3325.2002.
- Volokhov, D.; Rasooly, A.; Chumakov, K.; Chizhikov, V. Identification of Listeria Species by Microarray-Based Assay. Journal of Clinical Microbiology 2002, 40, 4720–4728, doi:doi:10.1128/jcm.40.12.4720-4728.2002.
- Yoshikawa, Y.; Ochiai, Y.; Mochizuki, M.; Fujita, O.; Takano, T.; Hondo, R.; Ueda, F. Genetic subtyping of Listeria monocytogenes via multiple-locus sequence typing using iap, sigB and actA. Journal of Veterinary Medical Science 2016, 78, 1831–1839. [CrossRef]
- Cocolin, L.; Rantsiou, K.; Iacumin, L.; Cantoni, C.; Comi, G. Direct Identification in Food Samples of Listeria spp. and Listeria monocytogenes by Molecular Methods. Applied and Environmental Microbiology 2002, 68, 6273–6282, doi:doi:10.1128/AEM.68.12.6273-6282.2002.
- Pilgrim, S.; Kolb-Maurer, A.; Gentschev, I.; Goebel, W.; Kuhn, M. Deletion of the gene encoding p60 in Listeria monocytogenes leads to abnormal cell division and loss of actin-based motility. Infect Immun 2003, 71, 3473–3484.
- Baumforth, K.R.; Nelson, P.N.; Digby, J.E.; O'Neil, J.D.; Murray, P.G. Demystified ... the polymerase chain reaction. Mol Pathol 1999, 52, 1–10. [CrossRef]
- Welch, H.M. The Polymerase Chain Reaction. In Metastasis Research Protocols, Dwek, M., Brooks, S.A., Schumacher, U., Eds. Humana Press: Totowa, NJ, 2012; 10.1007/978-1-61779-854-2_5pp. 71–88.
- Lorenz, T.C. Polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies. J Vis Exp 2012, 10.3791/3998, e3998. [CrossRef]
- Starčič Erjavec, M. Annealing Temperature of 55°C and Specificity of Primer Binding in PCR Reactions. In Synthetic Biology - New Interdisciplinary Science, Nagpal, M.L., Boldura, O.-M., Balta, C., Enany, S., Eds. IntechOpen: London, 2019; 10.5772/intechopen.85164.
- Yang, I.; Kim, Y.-H.; Byun, J.-Y.; Park, S.-R. Use of multiplex polymerase chain reactions to indicate the accuracy of the annealing temperature of thermal cycling. Analytical Biochemistry 2005, 338, 192–200. [CrossRef]





| Organism (closest species)1 |
Strain Designation | Source |
|---|---|---|
| Listeria monocytogenes | EGDe; ATCC BAA-679 | Muriana Culture Collection |
| Listeria monocytogenes | ScottA; ATCC 45954 45954 | Muriana Culture Collection |
| Listeria monocytogenes | ATCC 19111 | Muriana Culture Collection |
| Listeria innocua | ATCC 33090 | Muriana Culture Collection |
| Listeria seeligeri | ATCC 35967 | Muriana Culture Collection |
| Listeria welshimeri | ATCC 35897 | Muriana Culture Collection |
| Listeria monocytogenes | CQ0A0 | City Municipal Wastewater |
| Listeria spp. | CQ0A1 | City Municipal Wastewater |
| Listeria spp. | CQ0A2 | City Municipal Wastewater |
| Listeria monocytogenes | CQ1 | City Municipal Wastewater |
| Listeria spp. | CQ2 | City Municipal Wastewater |
| Listeria innocua | CQ3 | OSU Dairy Wastewater |
| Listeria innocua | CQ4 | OSU Dairy Wastewater |
| Listeria innocua | CQ5 | OSU Dairy Wastewater |
| Listeria innocua | CQ6 | OSU Dairy Wastewater |
| Listeria innocua | CQ7 | City Municipal Wastewater |
| Listeria innocua | CQ8 | City Municipal Wastewater |
| Listeria spp. | CQ9 | City Municipal Wastewater |
| Listeria innocua | CQ10 | City Municipal Wastewater |
| Listeria innocua | CQ11 | OSU Dairy Wastewater |
| Listeria innocua | CQ12 | OSU Dairy Wastewater |
| Listeria innocua | CQ13 | City Municipal Wastewater |
| Listeria spp. | CQ14 | City Municipal Wastewater |
| Listeria innocua | CQ15 | OSU Dairy Wastewater |
| Listeria innocua | CQ16 | OSU Dairy Wastewater |
| Listeria innocua | CQ17 | City Municipal Wastewater |
| Listeria innocua | CQ18 | City Municipal Wastewater |
| Listeria monocytogenes | CQ19 | City Municipal Wastewater |
| Listeria spp. | CQ20 | OSU Dairy Wastewater |
| Listeria monocytogenes | CQ21 | City Municipal Wastewater |
| Listeria monocytogenes | CQ22 | OSU Dairy Wastewater |
| Listeria monocytogenes | CQ23 | OSU Dairy Wastewater |
| Listeria monocytogenes | CQ24 | City Municipal Wastewater |
| Primer Pairs | Target Gene | Primer Sequence (5’→ 3’) |
Product size (bp) | (NCBI) Primer Tm (oC) |
(IDT) Primer Tm (oC) |
|---|---|---|---|---|---|
| Primer 1 | Hemolysin (hlyA) | ||||
| Forward | TGAACCTACAAGACCTTCCA | 560 | 55.7 | 53.0 | |
| Reverse | CAATTTCGTTACCTTCAGGA | 53.2 | 50.1 | ||
| Primer 2 | Internalin A (inlA) | ||||
| Forward | GCTTCAGGCGGATAGATTAG | 575 | 55.5 | 52.6 | |
| Reverse | AACTCGCCAATGTGCC | 54.7 | 53.3 | ||
| Primer 3 | Positive regulatory factor (prfA) | ||||
| Forward | ATTTTTAACCAATGGGATCC | 590 | 51.2 | 48.2 | |
| Reverse | CATTCATCTAATTTAGGGGC | 51.3 | 48.3 | ||
| Primer 4 | Actin mobility (actA1) | ||||
| Forward | AATACGAACAAAGCAGACCTAATAG | 500 | 57.2 | 52.9 | |
| Reverse | GGTCAATTAACCCTGCACTTTTA | 57.3 | 53.5 | ||
| Primer 6 | Universal 16 S rRNA – front half | ||||
| Forward (7F) | RAGAGTTTGATCHTGGCTCAG | ~920-930 | 54 | 53.5 | |
| Reverse (928R) | CCCCGTCAATTCHTTTGA | 47 | 50.8 | ||
| Primer 7 | Universal 16 S rRNA – back half | ||||
| Forward (759F) | CAGGATTAGATACCCTGGTAGTCC | ~782 | 59.2 | 55.8 | |
| Reverse (1541R) | AAGGAGGTGATCCARCCGC | 59.7 | 58.8 | ||
| Primer 8 | Sigma Factor B (sigB) | ||||
| Forward | AAAGCAGGTGGAGGAGAATG | ~749 | 57.5 | 54.8 | |
| Reverse | TTGACGTTGGATTCTAGACACAT | 57.9 | 54.0 | ||
| Primer 9 | Invasion Associated Protein (iap) | ||||
| Forward | GAATATGAAAAAAGCAACTATCGC | ~1,286 | 51.6 | 51.1 | |
| Reverse | CTAAATCACCAGGTTTTGCTTG | 51.1 | 52.4 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.