Submitted:
25 July 2026
Posted:
30 July 2026
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Results and Discussion
2.1. Preparation Process and Component Analysis of JP
2.2. In Vitro Cytotoxicity and Anti-Migration Activity of JP
2.3. JP Induces Apoptosis in HeLa Cells and Its Molecular Mechanism
2.4. JP Regulates the Expression of Cell Cycle-Related Genes
2.5. Physicochemical and Antibacterial Performance of JP-H
2.6. Analysis of Migration Inhibition and Cytotoxicity of JP-H Against HeLa Cells
3. Conclusion
4. Experimental Section
Author Contributions
Funding
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Filho, A.M.; Laversanne, M.; Ferlay, J.; Colombet, M.; Piñeros, M.; Znaor, A.; Parkin; Soerjomataram, I.; Bray, F. The GLOBOCAN 2022 cancer estimates: Data sources, methods, and a snapshot of the cancer burden worldwide. Int. J. Cancer 2025, 156, 1336–1346. [Google Scholar] [CrossRef] [PubMed]
- Sahasrabuddhe, V.V. Cervical Cancer: Precursors and Prevention. Hematol. Oncol. Clin. N 2024, 38, 771–781. [Google Scholar] [CrossRef] [PubMed]
- Xu, M.; Cao, C.; Wu, P.; Huang, X.; Ma, D. Advances in cervical cancer: current insights and future directions. Cancer Commun. 2025, 45, 77–109. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z. Regulation of Cell Cycle Progression by Growth Factor-Induced Cell Signaling. Cells 2021, 10, 3327. [Google Scholar] [CrossRef] [PubMed]
- Tollis, S. The G1/S repressor WHI5 is expressed at similar levels throughout the cell cycle. BMC Res. Notes 2022, 15, 248. [Google Scholar] [CrossRef] [PubMed]
- Palmer, N.; Kaldis, P. Less-well known functions of cyclin/CDK complexes. Semin Cell Dev. biol. 2020, 107, 54–62. [Google Scholar] [CrossRef] [PubMed]
- Wendel, S.O.; Snow, J.A.; Gu, L.; Banerjee, N.S.; Malkas, L.; Wallace, N.A. The potential of PCNA inhibition as a therapeutic strategy in cervical cancer. J. Med. Virol. 2023, 95, e29244. [Google Scholar] [CrossRef] [PubMed]
- Fatma, H.; Maurya, S.K.; Siddique, H.R. Epigenetic modifications of c-MYC: Role in cancer cell reprogramming, progression and chemoresistance. Semin. Cancer Biol. 2022, 83, 166–176. [Google Scholar] [CrossRef] [PubMed]
- Gao, F.Y.; Li, X.T.; Xu, K.; Wang, R.T.; Guan, X.X. c-MYC mediates the crosstalk between breast cancer cells and tumor microenvironment. Cell commun. signal. 2023, 21 28. [Google Scholar] [CrossRef] [PubMed]
- Marvalim, C.; Datta, A.; Lee, S.C. Role of p53 in breast cancer progression: An insight into p53 targeted therapy. Theranostics 2023, 13, 1421–1442. [Google Scholar] [CrossRef] [PubMed]
- Mao, Y.; Jiang, P. The crisscross between p53 and metabolism in cancer. Acta Bioch Bioph Sin. 2023, 55, 914–922. [Google Scholar] [CrossRef]
- Chen, C.; Chen, L.; Mao, C.; Jin, L.; Wu, S.; Zheng, Y.; Cui, Z.; Li, Z.; Zhang, Y.; Zhu, S.; Jiang, H.; Liu, X. Natural Extracts for Antibacterial Applications. Small 2024, 20, e2306553. [Google Scholar] [CrossRef] [PubMed]
- Lu, Y.; Bao, T.; Mo, J.; Ni, J.; Chen, W. Research advances in bioactive components and health benefits of jujube (Ziziphus jujuba Mill.) fruit. J. Zhejiang Univ. Sci. B 2021, 22, 431–449. [Google Scholar] [CrossRef] [PubMed]
- Gou, B.; Chen, G.; Huang, S.; Ning, N.; Gu, Q.; Duan, S.; Du, Y.; Nan, Y.; Yuan, L. Review: performance of jujube and its extracts in cancer: therapeutic, toxicity-reducing and potentiating effects. Front Oncol. 2025, 15, 1489974. [Google Scholar] [CrossRef] [PubMed]
- Zhuang, H.; Jing, N.; Wang, L.; Jiang, G.; Liu, Z. Jujube Powder Enhances Cyclophosphamide Efficiency against Murine Colon Cancer by Enriching CD8+ T Cells While Inhibiting Eosinophilia. Nutrients 2021, 13, 2700. [Google Scholar] [CrossRef] [PubMed]
- Guo, M.; Zhang, Z.; Li, S.; Lian, Q.; Fu, P.; He, Y.; Qiao, J.; Xu, K.; Liu, L.; Wu, M.; Du, Z.; Li, S.; Wang, J.; Shao, P.; Yu, Q.; Xu, G.; Li, D.; Wang, Y.; Tian, S.; Zhao, J.; Zhao, X. Genomic analyses of diverse wild and cultivated accessions provide insights into the evolutionary history of jujube. Plant Biotechnol. J. 2021, 19, 517–531. [Google Scholar] [CrossRef] [PubMed]
- Duan, Y.; Liu, S.; Zhu, Y.; Wang, Y.; Yan, F.; Liu, Z.; Shi, X.; Liu, P.; Liu, M. The Influences of Soil and Meteorological Factors on the Growth and Fruit Quality of Chinese Jujube (Ziziphus jujuba Mill.). Plants 2023, 12, 4107. [Google Scholar] [CrossRef] [PubMed]
- Dou, J.F.; Wu, C.E.; Fan, G.J. Insights into the pigment and non-pigment phenolic profile of polyphenol extracts of jujube peel and their antioxidant and lipid-lowering activities. Food Biosci. 2023, 52, 102493. [Google Scholar] [CrossRef]
- Tang, K.; Karamat, U.; Li, G.; Guo, J.; Jiang, S.; Fu, M.; Yang, X. Integrated metabolome and transcriptome analyses reveal the role of BoGSTF12 in anthocyanin accumulation in Chinese kale (Brassica oleracea var. alboglabra). BMC Plant Biol. 2024, 24, 335. [Google Scholar] [CrossRef] [PubMed]
- Zhu, H.; Wu, X.; Tan, Y.; Shi, L.; Bai, W.; Li, X. Anthocyanin-functionalized selenocysteine nanotherapeutics alleviate cisplatin nephrotoxicity by inhibiting oxidative stress and ferroptosis. J. Nanobiotechnol 2025, 23, 703. [Google Scholar] [CrossRef] [PubMed]
- Han, L.; Yan, Y.; Fan, M.; Gao, S.; Zhang, L.; Xiong, X.; Li, R.; Xiao, X.; Wang, X.; Ni, L.; Tong, D.; Huang, C.; Cao, Y.; Yang, J. Pt3R5G inhibits colon cancer cell proliferation through inducing ferroptosis by down-regulating SLC7A11. Life Sci. 2022, 306, 120859. [Google Scholar] [CrossRef] [PubMed]
- Liang, Y.; Chen, W.M.; Zhang, Y.; Li, L. Remodeling the tumor dormancy ecosystem to prevent recurrence and metastasis. Signal Transduct. Target Ther. 2026, 11 1. [Google Scholar] [CrossRef] [PubMed]
- Din, Z.U.; Cui, B.; Wang, C.; Zhang, X.; Mehmood, A.; Peng, F.; Liu, Q. Crosstalk between lipid metabolism and EMT: emerging mechanisms and cancer therapy. Mol. Cell Biochem. 2025, 480, 103–118. [Google Scholar] [CrossRef] [PubMed]
- Saad, S.H.; Kashanchi, A.; Zadeh, M.A.; Williams, A.; Batrakova, E.V. Exosome-Mediated Crosstalk Between Cancer Cells and Tumor Microenvironment. Cells 2025, 14, 1750. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Q.; Cui, K.; Yang, X.; He, Q.; Yu, J.; Yang, L.; Yao, G.; Guo, W.; Luo, Z.; Liu, Y.; Chen, Y.; He, Z.; Lan, P. c-Myc-IMPDH1/2 axis promotes tumourigenesis by regulating GTP metabolic reprogramming. Clin. Transl. Med. 2023, 13, e1164. [Google Scholar] [CrossRef] [PubMed]
- Hsu, C.M.; Lin, J.J.; Su, J.H.; Liu, C.I. 13-Acetoxysarcocrassolide induces apoptosis in human hepatocellular carcinoma cells through mitochondrial dysfunction and suppression of the PI3K/AKT/mTOR/p70S6K signalling pathway. Pharm. Biol. 2022, 60, 2276–2285. [Google Scholar] [CrossRef] [PubMed]
- Ahmed, Z.S.O.; Khan, E.; Elias, N.; Elshebiny, A.; Dou, Q. Updated Review on Natural Polyphenols: Molecular Mechanisms, Biological Effects, and Clinical Applications for Cancer Management. Biomolecules 2025, 15, 629. [Google Scholar] [CrossRef] [PubMed]
- Yang, F.; Ma, Q.; Huang, B.; Wang, X.; Pan, X.; Yu, T.; Ran, L.; Jiang, S.; Li, H.; Chen, Y.; Liu, Y.; Liang, C.; Ren, J.; Zhang, Y.; Wang, S.; Li, W.; Xiao, B. CircNFATC3 promotes the proliferation of gastric cancer through binding to IGF2BP3 and restricting its ubiquitination to enhance CCND1 mRNA stability. J. Transl. Med. 2023, 21, 402. [Google Scholar] [CrossRef] [PubMed]
- Jiang, H.; Li, H.; Wang, C.; Wang, Y.; Liu, Y. PCNA’s dual legacy in ciliates: Conserved replication scaffold and lineage-specific genome architect. Eur. J. Protistol. 2025, 100, 126162. [Google Scholar] [CrossRef] [PubMed]
- Sun, Z.; Wu, R.; Liang, X.; Shi, T.; Zhang, Y.; Pan, Z.; Zhang, W.; Luan, X. MLCK inhibition induces synthetic lethality in MYC-driven cancer. Cancer Lett. 2025, 625, 217803. [Google Scholar] [CrossRef] [PubMed]
- Ameer, S.F.; Mohamed, M.Y.; Elzubair, Q.A.; Sharif, E.A.M.; Ibrahim, W.N. Curcumin as a novel therapeutic candidate for cancer: can this natural compound revolutionize cancer treatment? Front Oncol. 2024, 14, 1438040. [Google Scholar] [CrossRef] [PubMed]
- Tang, S.M.; Deng, X.T.; Zhou, J.; Li, Q.P.; Ge, X.X.; Miao, L. Pharmacological basis and new insights of quercetin action in respect to its anti-cancer effects. BioMed Pharmacother. 2020, 121, 109604. [Google Scholar] [CrossRef] [PubMed]
- Silva-Reis, R.; Silva, V.L.M.; Cardoso, S.M.; Michalak, I.; Püsküllüoğlu, M.; Calina, D.; Sharifi-Rad, J. Moscatilin, a potential therapeutic agent for cancer treatment: insights into molecular mechanisms and clinical prospects. Med. Oncol. 2024, 41, 228. [Google Scholar] [CrossRef] [PubMed]
- Chen, G.; Zhu, X.; Li, J.; Zhang, Y.; Wang, X.; Zhang, R.; Qin, X.; Chen, X.; Wang, J.; Liao, W.; Wu, Z.; Lu, L.; Wu, W.; Yu, H.; Ma, L. Celastrol inhibits lung cancer growth by triggering histone acetylation and acting synergically with HDAC inhibitors. Pharmacol. Res. 2022, 185, 106487. [Google Scholar] [CrossRef] [PubMed]
- Victoir, B.; Croix, C.; Gouilleux, F.; Prié, G. Targeted Therapeutic Strategies for the Treatment of Cancer. Cancers 2024, 16, 461. [Google Scholar] [CrossRef] [PubMed]
- Wang, F.; Zeng, Y.; Yan, M.; Zhou, Z.; Feng, L.; Yang, F.; Zhao, W.; Hu, Y. Self-transforming hydrogel mimicking tertiary lymph nodes to activate cGAS-STING pathway for enhanced antitumor immunotherapy. Sci. Adv. 2026, 12, eadz5078. [Google Scholar] [CrossRef] [PubMed]








| Gene | Orientation and Sequences |
|---|---|
| CCND1 | Forward:5’TTCGTGGCCTCTAAGATGAAG 3’ |
| Reverse:5’GTAGGACAGGAAGTTGTTGGG 3’ | |
| CDK2 | Forward:5’TCAAGCTAGCAGACTTTGGAC 3’ |
| Reverse:5’ACTTGGCTTGTAATCAGGCAT 3’ | |
| CDK4 | Forward:5’AATTGCATCGTTCACCGAGAT 3’ |
| Reverse:5’CAGCCCAATCAGGTCAAAGAT 3’ | |
| CDK6 | Forward:5’CAGTGTCACGAACAGACAGAG 3’ |
| Reverse:5’GGTTAGAGCCATCTGGAAACT 3’ | |
| PCNA | Forward:5’TTGGCGCTAGTATTTGAAGCA 3’ |
| Reverse:5’CAGGTACCTCAGTGCAAAAGT 3’ | |
| MYC | Forward:5’CTTCTCTCCGTCCTCGGATTC 3’ |
| Reverse:5’GGATAGTCCTTCCGAGTGGAG 3’ | |
| TP53 | Forward:5’CCTGTCATCTTCTGTCCCTTC3’ |
| Reverse:5’CTCGGATAAGATGCTGAGGAG3’ | |
| ACTB | Forward:5’TCTACAATGAGCTGCGTGTGG3’ |
| Reverse:5’GAGGTAGTCAGTCAGGTCCCG3’ |
| Component | Volume (µL) |
|---|---|
| 2×F8 PCR Master MIX | 10 |
| Forward Primer(10 μ M) | 0.5 |
| Reverse Primer(10 μ M) | 0.5 |
| cDNA Template | 0.8 |
| DMSO | 5 |
| Nuclease-free Water | To 20 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).