Submitted:
07 July 2026
Posted:
09 July 2026
You are already at the latest version
Abstract
Retail food contamination by Listeria species and rising antimicrobial resistance (AMR) among Listeria populations further underscores need for continued surveillance. This study assessed prevalence, species distribution, and AMR profiles of Listeria spp. recovered from retail foods in North Carolina, USA. Food samples (866) collected between 2018 and 2020 were screened and presumptive isolates identified by multiplex PCR, and antimicrobial susceptibility was evaluated against sixteen antimicrobial agents. Listeria spp. were detected in 8.55% (74/866) of samples. Species-level identification was achieved for 68 isolates. Non-pathogenic species predominated, led by Listeria welshimeri (24.32%) and L. innocua (21.62%). Pathogenic species (L. monocytogenes, Listeria ivanovii) accounted for 17.57% of isolates and occurred exclusively in raw commodities. Prevalence was highest in raw milk (14.58%), mushrooms (13.64%), vegetables (11.49%), and raw meats (10.74%); processed foods showed minimal contamination (0.42%). Unprocessed foods were 28-times more likely to harbor Listeria than processed products (RR=28.00; 95% CI: 3.91-200.32; P<0.0001). Resistance was highest to Nitrofurantoin (51.47%) and Penicillin G (39.71%). Multidrug resistance (MDR) was detected in 64.71% of isolates including 84.62% of pathogenic and 60.00% of non-pathogenic species. Raw agricultural commodities are major Listeria reservoirs. Widespread MDR across species underscores the necessity for integrated surveillance and One Health monitoring frameworks.
Keywords:
1. Introduction
2. Materials and Methods
2.1. Sample Collection and Study Design
2.2. Isolation and Phenotypic Identification of Listeria spp.
2.2.1. Genomic DNA Extraction and Multiplex PCR Identification of Listeria Species
2.3. Antibiotic Susceptibility Testing
2.4. Statistical Analysis
3. Results
3.1. Prevalence and Distribution Listeria Species
3.2. Product-Level Distribution of Listeria spp.
3.2.1. Effect of Food Processing on Listeria Contamination
3.2.2. Prevalence of Listeria spp. Across Major Food Categories
3.2.3. Distribution of Pathogenic and Non-Pathogenic Species
3.3. Antimicrobial Susceptibility and Resistance Listeria Isolates
3.3.1. Overall Antimicrobial Resistance Profile
3.3.2. Species-Specific Antibiotic Resistance Patterns
3.3.3. Non-Susceptibility Patterns Across Pathogenic and Non-Pathogenic Listeria spp.
3.3.4. Multidrug Resistance Profiles of Listeria Phenotypes
4. Discussion
4.1. Diversity and Distribution of Listeria Species in Retail Foods
4.2. Impact of Food Processing on Listeria Contamination
4.3. Distribution of Pathogenic and Non-Pathogenic Species
4.4. Antimicrobial Resistance Profiles
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
| AMR | Antimicrobial Resistance |
| MDR | Multidrug Resistance |
| TMP-SMX | Trimethoprim-sulfamethoxazole. |
Appendix A
| Clinical Cohort and Species | Isolation Count (n) |
Proportion of Total Genus Incidence (%) (n=74) |
Incidence/Prevalence in TotalRetail Samples (N=866) |
| Pathogenic Cohort | 13 | 17.57 | 1.50 |
| L. monocytogenes | 7 | 9.46 | 0.81 |
| L. ivanovii | 6 | 8.11 | 0.69 |
| Non-Pathogenic Cohort | 61 | 82.43 | 7.04 |
| L. welshimeri | 18 | 24.32 | 2.08 |
| L. innocua | 16 | 21.62 | 1.85 |
| L. seeligeri | 11 | 14.86 | 1.27 |
| L. grayi | 10 | 13.51 | 1.15 |
| Unidentified Listeria spp. | 6 | 8.11 | 0.69 |
| Total Yield | 74 | 100.00 | 8.55 |
| Food Cohort and Category |
Total Sample Size (N) | Pathogenic Cohort a % (n) |
Non-Pathogenic Cohort b % (n) |
Overall Prevalence % (n) |
| Vegetables | 435 | 1.38% (6) | 10.11% (44) | 11.49% (50) |
| Edible Fungi (Mushrooms) | 22 | 0.00% (0) | 13.64% (3) | 13.64% (3) |
| Raw Meat | 121 | 2.48% (3) | 8.26% (10) | 10.74% (13) |
| Unprocessed Dairy | 48 | 8.33% (4) | 6.25% (3) | 14.58% (7) |
| Processed Meat | 39 | 0.00% (0) | 0.00% (0) | 0.00% (0) |
| Processed Dairy | 201 | 0.00% (0) | 0.50% (1) | 0.50% (1) |
| TOTAL STUDIED | 866 | 1.50% (13) | 6.35% (55) | 8.55% (74) |
| Antibiotics | Resistant (R) % (n) | Intermediate (I) % (n) | Susceptible (S) % (n) |
| Amikacin | 0.00 (0) | 4.41 (3) | 95.59 (65) |
| Azithromycin | 7.35 (5) | 13.24 (9) | 79.41 (54) |
| Chloramphenicol | 10.29 (7) | 16.18 (11) | 73.53 (50) |
| Ciprofloxacin | 14.71 (10) | 14.71 (10) | 70.59 (48) |
| Clindamycin | 23.53 (16) | 13.24 (9) | 63.24 (43) |
| Erythromycin | 7.35 (5) | 7.35 (5) | 85.29 (58) |
| Kanamycin | 26.47 (18) | 23.53 (16) | 50.00 (34) |
| Levofloxacin | 22.06 (15) | 32.35 (22) | 45.59 (31) |
| Moxifloxacin | 17.65 (12) | 11.76 (8) | 70.59 (48) |
| Nitrofurantoin | 51.47 (35) | 10.29 (7) | 38.24 (26) |
| Penicillin G | 39.71 (27) | 0.00 (0) | 60.29 (41) |
| Rifampin | 14.71 (10) | 5.88 (4) | 79.41 (54) |
| Tetracycline | 1.47 (1) | 0.00 (0) | 98.53 (67) |
| Tobramycin | 1.47 (1) | 0.00 (0) | 98.53 (67) |
| Trimethoprim | 19.12 (13) | 5.88 (4) | 75.00 (51) |
| TMP-SMX a | 1.47 (1) | 0.00 (0) | 98.53 (67) |
| Antibiotic Screening Panel |
Pathogenic Cohort (N=3) a Non-Susceptible Frequency % (n) |
Non-Pathogenic Cohort (N=55) b Non-Susceptible Frequency % (n) |
Two-Sided Fisher’s Exact P-Value | Significance Summary |
| Amikacin | 7.69 (1) [1.37-33.31] | 3.64 (2) [1.00-12.32] | 0.4497 | ns |
| Azithromycin | 0.00 (0) [0.00-22.81] | 25.45 (14) [15.81-38.30] | 0.0461 | * |
| Chloramphenicol | 30.77 (4) [12.63-58.29] | 14.55 (8) [7.56-26.16] | 0.1332 | ns |
| Ciprofloxacin | 23.08 (3) [8.18-50.25] | 32.73 (18) [21.81-45.90] | 0.7423 | ns |
| Clindamycin | 58.85 (7) [29.13-76.79] | 23.64 (13) [11.55-32.37] | 0.0175 | * |
| Erythromycin | 7.69 (1) [1.37-33.31] | 16.36 (9) [8.86-28.26] | 0.6726 | ns |
| Kanamycin | 30.77 (4) [12.63-58.29] | 50.91 (28) [38.08-63.62] | 0.2227 | ns |
| Levofloxacin | 46.15 (6) [23.21-70.87] | 43.64 (24) [31.37-56.73] | 0.9999 | ns |
| Moxifloxacin | 15.38 (2) [4.33-42.23] | 30.91 (17) [20.28-44.03] | 0.3341 | ns |
| Nitrofurantoin | 69.23 (9) [42.37-87.37 | 56.36 (31) [43.27-68.63] | 0.5401 | ns |
| Penicillin G | 61.54 (8) [35.53-82.28] | 34.55 (19) [23.36-47.75] | 0.0768 | ns |
| Rifampin | 23.08 (3) [8.18-50.25] | 16.36 (9) [8.86-28.26] | 0.6702 | ns |
| Tetracycline | 0.00 (0) [0.00-22.81] | 1.82 (1) [0.32-9.61] | >0.9999 | ns |
| Tobramycin | 0.00 (0) [0.00-22.81] | 1.82 (1) [0.32-9.61] | >0.9999 | ns |
| Trimethoprim | 15.38 (2) [4.33-42.23] | 23.64 (13) [14.47-36.35] | 0.7180 | ns |
| TMP-SMX d | 0.00 (0) [0.00-22.81] | 1.82 (1) [0.32-9.61] | >0.9999 | ns |
| Taxonomy and Species Line | Total Isolates Tested (N) | Multidrug Resistant Isolates a Count (n) | Species-Specific MDR Incidence (%) | Primary Phenotypic Co-Resistance Signature Tracks b |
| Pathogenic Cohort | 13 | 11 | 84.62% | Penicillins + Fluoroquinolones + Lincosamides |
| L. monocytogenes | 7 | 5 | 71.43% | Penicillin G + Levofloxacin + Clindamycin |
| L. ivanovii | 6 | 6 | 100.00% | Penicillin G + Levofloxacin + Nitrofurantoin + Chloramphenicol |
| Non-Pathogenic Cohort | 55 | 33 | 60.00% | Penicillins + Fluoroquinolones + Aminoglycosides |
| L. welshimeri | 18 | 4 | 22.22% | Kanamycin + Levofloxacin + Azithromycin [Intermediate] |
| L. innocua | 16 | 12 | 75.00% | Kanamycin + Penicillin G + Levofloxacin + Azithromycin |
| L. seeligeri | 11 | 7 | 63.64% | Penicillin G + Kanamycin + Levofloxacin |
| L. grayi | 10 | 10 | 100.00% | Penicillin G + Clindamycin + Levofloxacin + Nitrofurantoin |
| Combined Genus Total | 68 | 44 | 64.71% | Overarching Retail Resistome Saturation Footprint |
References
- Yang, Y.; Xu, F.-R.; Zhou, Y.-B.; Hu, L.-Q.; Lu; Zhang, W.; Hu, S.-H.; Huang, H.; X.-R. Epidemiological Characteristics of Foodborne Disease Outbreaks in a Hospital: A 5-Year Retrospective Study. Int. J. Gen. Med. 2025. 18, 1529–1542. [Google Scholar] [CrossRef]
- Mohapi; D. A. Nkhebenyane, S. J. Listeria monocytogenes and Listeria ivanovii Virulence and Adaptations Associated with Leafy Vegetables from Small-Scale Farm and a Shift of Microbiota to a New Niche at Markets: A Systematic Review. Microorganisms 2025, 14(1), 76. [Google Scholar] [CrossRef] [PubMed]
- Osek, J.; Wieczorek, K. Why does Listeria monocytogenes survive in food and food-production environments? J. Vet. Res. 2023, 67(4), 537–544. [Google Scholar] [CrossRef] [PubMed]
- Mazaheri, T.; Cervantes-Huaman, B. R. H.; Bermudez-Caodevila, M.; Ripolles-Avila, C.; Rodriguez-Jerez, J. J. Listeria monocytogenes Biofilms in the Food Industry: Is the Current Hygiene Program Sufficient to Combat the Persistence of the Pathogen? Microorganisms 2021, 9(1), 182. [Google Scholar] [CrossRef]
- Manyi-Loh, C. E.; Lues, R. Listeria monocytogenes and Listeriosis: The Global Enigma. Foods 2025, 14(7), 1266. [Google Scholar] [CrossRef] [PubMed]
- Orsi, R. H.; Liao, J.; Carlin, C. R.; Weidmann, M. Taxonomy, ecology, and relevance to food safety of the genus Listeria with a particular consideration of new Listeria species described between 2010 and 2022. MBio. 2023, 15, e00938-23. [Google Scholar] [PubMed]
- Kathariou, S.; Kanenaka, R.; Allen, R. D.; Fok, A. K.; Mizumoto, C. Repression of motility and flagellin production at 37 degrees C is stronger in Listeria monocytogenes than in the nonpathogenic species Listeria innocua. Can. J. Microbiol. 1995, 41(7), 572–577. [Google Scholar] [CrossRef] [PubMed]
- Reis, J. O.; Teixeira, L. A. C.; Cunha-Neto, A.; Castro, V. S.; Figueiredo, E. E. S. Listeria monocytogenes in beef: a hidden risk. Res. Microbiol. 2024, 175(7), 104215. [Google Scholar] [CrossRef] [PubMed]
- Quereda, J. J.; Moron-Garcia, A.; Palacios-Gorba, C.; Dessaux, C.; Garcia-del Portillo, F.; Pucciarelli, M. G.; Ortega, A. D. Pathogenicity and virulence of Listeria monocytogenes: A trip from environmental to medical microbiology. Virulence 2021, 12(1), 2509–2545. [Google Scholar] [CrossRef] [PubMed]
- Su, Y.; Liu; A. Zhu, M. J. Mapping the landscape of listeriosis outbreaks (1998-2023): Trends, challenges, and regulatory responses in the United States. Trends Food Sci. Technol. 2024, 154, 104750. [Google Scholar] [CrossRef]
- D’Ambrosio, G.; Schirone, M.; Paparella, A. Listeria monocytogenes in Ready-to-Eat Foods: Risk Perspectives Across Different Regulatory Systems. Foods. 2026, 15(3), 470. [Google Scholar] [CrossRef] [PubMed]
- Scallan, W. E. J.; Cui, Z.; Tierney, R.; Griffin, P. M.; Hoekstra, R. M.; Payne, D. C.; et al. Foodborne Illness Acquired in the United States—Major Pathogens, 2019. Emerg. Infect. Dis. 2025, 31(4), 669–677. [Google Scholar] [CrossRef]
- Zhu, Q.; Gooneratne, R.; Hussain, M. A. Listeria monocytogenes in Fresh Produce: Outbreaks, Prevalence and Contamination Levels. Foods 2017, 6(3), 21. [Google Scholar] [CrossRef] [PubMed]
- Orsi, R. H.; Wiedmann, M. Characteristics and distribution of Listeria spp., including Listeria species newly described since 2009. Appl. Microbiol. Biotechnol. 2016, 100, 5273–5287. [Google Scholar] [CrossRef] [PubMed]
- Law, J. W.-F.; Mutalib, N.-S. A.; Chan, K.-G.; Lee, L.-H. An insight into the isolation, enumeration, and molecular detection of Listeria monocytogenes in food. Front Microbiol. 2015, 6, 1227. [Google Scholar] [CrossRef] [PubMed]
- Li, F.; Ye, Q.; Chen, M.; Zhang, J.; Xue, L.; Wang, J.; Wu, S.; et al. Multiplex PCR for the Identification of Pathogenic Listeria in Flammulina velutipes Plant Based on Novel Specific Targets Revealed by Pan-Genome Analysis. Front Microbiol. 2021, 11, 634255. [Google Scholar] [CrossRef] [PubMed]
- Soltysiuk, M.; Przyborowska, P.; Wiszniewska-Laszczch, A.; Tobolski, D. Prevalence and antimicrobial resistance profile of Listeria spp. isolated from raw fish. BMC Vet. Res. 2025, 21, 333. [Google Scholar] [CrossRef] [PubMed]
- Byathut, A.; Das, M.; Chowdhury, G.; Mukhopadhyay, A. K.; Khati, R.; Das, S.; Ramamorthy, T.; Dolma, K. G. Exploring the prevalence and antibiotic resistance of Listeria of Listeria monocytogenes in diverse food commodities across Sikkim, India. Braz. J. Microbiol.. 2026, 57, 23. [Google Scholar]
- Zawiasa, A.; Olejnik-Schmidt, A. Antibiotic Resistance Profiles and Genetic Determinants of Listeria innocua Isolated from Food Sources in Poland. Genes . 2025, 16(12), 1455. [Google Scholar] [CrossRef] [PubMed]
- Mazza, R.; Piras, F.; Ladu, D.; Putzolu, M.; Consolati, S. G.; Mazzette, R. Identification of Listeria spp. strains isolated from meat products and meat production plants by multiplex polymerase chain reaction. Ital. J. Food Saf.. 2016, 5, 5498. [Google Scholar]
- Clinical and Laboratory Standards Instititute (CLSI). Performance Standards for Antimicrobial Susceptibility Testing, 26th ed.; CLSI Supplement M100-S26: Wayne, PA, USA, 2016; pp. 1–204. [Google Scholar]
- Vatopoulos, A.; Weber, J. T.; Monnet, D. L. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance. Clin. Microbiol. Infect. 2012, 18(3), 268–81. [Google Scholar] [CrossRef]
- Jagadeesan, B.; Baert, L.; Wiedmann, M.; Orsi, R. H. Comparative Analysis of Tools and Approaches for Source Tracking Listeria monocytogenes in a Food Facility Using Whole-Genome Sequence Data. Front. Moicrobiol. 2019, 10, 947. [Google Scholar] [CrossRef]
- Sullivan, G.; Orsi, R. H.; Estrada, E.; Strawn, L.; Wiedmann, M. Whole-Genome Sequencing-Based Characterization of Listeria Isolates from Produce Packinghouses and Fresh-Cut Facilities Suggests Both Persistence and Reintroduction of Fully Virulent L. monocytogenes. Appl. Env. Microbiol. 2022, 88(22), e01177-22. [Google Scholar] [CrossRef]
- Li, F.; Ye, Q.; Chen, M.; Zhang, J.; Xue, L.; Wang, J.; Wu, S.; Zeng, H.; Gu, Q.; et al. Multiplex PCR for the Identification of Pathogenic Listeria in Flammulina velutipes Plant Based on Novel Specific Targets Revealed by Pan-Genome Analysis. Front Microbiol. 2021, 11, 634255. [Google Scholar] [CrossRef] [PubMed]
- Simmons, C.; Stasiewicz, M. J.; Wright; Warchocki, E.; Roof, S.; Kause, S.; Bauer, J. R.; et al. Listeria monocytogenes and Listeria spp. Contamination Patterns in Retail Delicatessen Establishments in Three U.S. States. J. Food Prot. 2014, 77(11), 1929–1939. [Google Scholar] [CrossRef] [PubMed]
- Korsak, D.; Szuplewska, M. Characterization of nonpathogenic Listeria species isolated from food and food processing environment. Int. J. Food Microbiol. 2016, 238, 274–280. [Google Scholar] [CrossRef] [PubMed]
- Burnett, J.; Wu, S. T.; Bakker, H. D.; Cook, P. W.; Veenhuizen, D. R.; Hammons, S. R.; Singh, M.; Oliver, H. F. Listeria monocytogenes is prevalent in retail produce environments but Salmonella enterica is rare. Food Control. 2020, 113(2), 107173. [Google Scholar] [CrossRef]
- Ryzhova, E.; Janine, W.; Chantelle, H. D.; Holy, O. Listeria monocytogenes in organic and conventional farming: Epidemiology, risks, and solutions within a One Health framework. One Health 2025, 101173. [Google Scholar] [CrossRef] [PubMed]
- Schoder, D.; Pelz, A.; Paulsen, P. Transmission Scenarios of Listeria monocytogenes on Small Ruminant On-Farm Dairies. Foods 2023, 12, 265. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Zheng, J.; Zhao, W.; Wu, Y. Prevalence of Listeria monocytogenes in Milk and Dairy Product Supply Chains: A Global Systematic Review and Meta-analysis. Foodborne Patho Dis. 2024, 21(9), 526–535. [Google Scholar] [CrossRef]
- Borena, B. M.; Dilgasa, L.; Gebremedhin, E. Z.; Sarba, E. J.; Marami, L. M.; Kelbesa, K. A.; Tadese, N. D. Listeria Species Occurrence and Associated Risk Factors and Antibiogram of Listeria Monocytogenes in Milk and Milk Products in Ambo, Holeta, and Bako Towns, Oromia Regional State, Ethiopia. Vet. Med. Int. 2022, 5643478. [Google Scholar] [PubMed]
- Williams, E. N.; Van Doren, J. M.; Leonard, C. L.; Datta, A. R. Prevalence of Listeria monocytogenes, Salmonella spp., Shiga toxin-producing Escherichia coli, and Campylobacter spp. in raw milk in the United States between 2000 and 2019: A systematic review and meta-analysis. J. Food Prot. 2023, 86(2), 100014. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Q.; Hu, P.; Li, Q.; Zhang, S.; Li, H.; Chang, J.; Jiang, Q.; Zheng, Y.; Li, Y.; et al. Prevalence and transmission characteristics of Listeria species from ruminants in farm and slaughtering environments in China. Emerg. Microbes Infect. 2021, 10(1), 356–364. [Google Scholar] [CrossRef] [PubMed]
- Shaaban, S. I.; Awwad, N.; Nossair, M.; Ayoub, M.; El-Majeed Eid, A. Gene profiling and serotyping of multidrug-resistant Listeria monocytogenes isolated from humans, animals and dairy products. BMC Vet. Res.. 2025, 21, 702. [Google Scholar] [CrossRef] [PubMed]
- Zhu, Q.; Gooneratne, R.; Hussain, M. A. Listeria monocytogenes in Fresh Produce: Outbreaks, Prevalence and Contamination Levels. Foods 2017, 6(3), 21. [Google Scholar] [CrossRef] [PubMed]
- Troung, H. N.; Garmyn, D.; Gal, L.; Fournier, C.; Sevellec, Y.; Jeandroz, S.; Piveteau, P. Plants as a realized niche for Listeria monocytogenes. MicrobiologyOPen 2021, 10(6), e1255. [Google Scholar] [CrossRef]
- Sullivan, G.; Wiedmann, M. Detection and Prevalence of Listeria in U.S. Produce Packinghouses and Fresh-Cut Facilities. J. Food Prot. 2020, 83(10), 1656–1666. [Google Scholar] [CrossRef] [PubMed]
- Weller, D.; Weidmann, M.; Strawn, L. K. Irrigation Is Significantly Associated with an Increased Prevalence of Listeria monocytogenes in Produce Production Environments in New York State. J. Food Prot. 2015, 78(6), 1132–1141. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Luo, X.; Aspridou, Z.; Misiou, O.; Dong, P.; Zhang, Y. The Prevalence and Antibiotic-Resistant of Listeria monocytogenes in Livestock and Poultry Meat in China and the EU from 2001 to 2022: A Systematic Review and Meta-Analysis. Foods 2023, 12(4), 769. [Google Scholar] [CrossRef] [PubMed]
- Matle, I.; Mbatha, K. R.; Madoroba, E. A review of Listeria monocytogenes from meat and meat products: Epidemiology, virulence factors, antimicrobial resistance and diagnosis. Onderstepoort J. Vet. Res. 2020, 87(1), 1869. [Google Scholar] [CrossRef] [PubMed]
- Tu, T.; Liu, Z.; Li, X.; Guo, C.; Chen, Z.; Wang, H.; Wang, L. Survival of Listeria monocytogenes on growing and harvested Trumpet Royale (Pleurotus eryngii), Alba Clamshell (Hypsizygus tessellatus), and Brown Clamshell (Hypsizygus tessellatus) mushrooms. Food Microbiol. 2025, 130, 104778. [Google Scholar] [CrossRef] [PubMed]
- Viswanath, P.; Murugesan, L.; Knabel, S. J.; Verghese, B.; Chikthimmah, N.; Laborde, L. F. Incidence of Listeria monocytogenes and Listeria spp. in a Small-Scale Mushroom Production Facility. J. Food Prot. 2013, 76(4), 608–615. [Google Scholar] [CrossRef] [PubMed]
- Townsend, A.; Strawn, L. K.; Chapman, B. J.; Dunn, L. L. A Systematic Review of Listeria Species and Listeria monocytogenes Prevalence, Persistence, and Diversity throughout the Fresh Produce Supply Chain. Foods 2021, 10(6), 1427. [Google Scholar] [CrossRef] [PubMed]
- Estrada, E. M.; Hamilton, A. M.; Sullivan, G. B.; Wiedmann, M.; Critzer, F. J.; Strawn, L. K. Prevalence, Persistence, and Diversity of Listeria monocytogenes and Listeria Species in Produce Packinghouses in Three U.S. States. J. Food Prot. 2020, 83(2), 277–286. [Google Scholar] [CrossRef] [PubMed]
- Soltysiuk, M.; Przyborowska, P.; Wiszniewska-Laszcych, A.; Tobolski, D. Prevalence and antimicrobial resistance profile of Listeria spp. isolated from raw fish. BMC Vet. Res. 2025, 21, 333. [Google Scholar] [CrossRef] [PubMed]
- Nikolaou, F. G.; Colobatiu, L. M.; Ciupescu, L. M.; Tabaran, A.; Hategan, A. R.; Mihaiu, R.; Tanassuica, R.; Poenaru, M. M.; Mihaiu, M. Prevalence and Antimicrobial Resistance of Listeria monocytogenes Isolated from Dairy Products in Romania. Antibiotics 2025, 14(5), 482. [Google Scholar] [CrossRef] [PubMed]
- Moabelo, K.; Gana, J.; Ngoshe, Y.; Moerane, R.; Adesiyun, A. Antimicrobial-Resistant Listeria Species Isolated From Beef and Beef Products Sold in Mpumalanga Province, South Africa. J. Food Prot. 2026, 89(5), 100767. [Google Scholar] [CrossRef] [PubMed]
- Kiss, R.; Marosi, B.; Petrik, B.; Lakatos, B.; Szabo, B. G. Clinical and microbiological characteristics and follow-up of invasive Listeria monocytogenes infection among hospitalized patients: real-world experience of 16 years from Hungary. BMC Microbiol. 2024, 24, 324. [Google Scholar] [CrossRef] [PubMed]
- Zawiasa, A.; Olejnik-Schmidt, A. Antibiotic Resistance Profiles and Genetic Determinants of Listeria innocua Isolated from Food Sources in Poland. Genes. 2025, 16(12), 1455. [Google Scholar] [CrossRef] [PubMed]
- Kozytska, T.; Neubauer, H.; Wareth, G. Listeria ivanovii-an underestimated pathogen in veterinary medicine. Front. Vet. Sci. 2026, 13, 1844936. [Google Scholar] [CrossRef] [PubMed]
- Nyenje, M. E.; Tanih, N. F.; Green, E.; Ndip, R. N. Current Status of Antibiograms of Listeria ivanovii and Enterobacter cloacae Isolated from Ready-to-Eat Foods in Alice, South Africa. Int. J. Env. Res. Public Heal. 2012, 9(9), 3101–3114. [Google Scholar] [CrossRef]
- Bertsch, D.; Muelli, M.; Weller, M.; Uruty, A.; Lacroix, C.; Meile, L. Antimicrobial susceptibility and antibiotic resistance gene transfer analysis of foodborne, clinical, and environmental Listeria spp. isolates including Listeria monocytogenes. MicrobiologyOpen 2014, 3(1), 118–127. [Google Scholar] [CrossRef] [PubMed]
- Anupama, A.; Pattapulavar, V.; Christopher, J. G. The past, present, future of Listeria monocytogenes: Understanding the molecular pathways, antibiotic resistance and public health implications. Med. Microecol. 2025, 100127. [Google Scholar] [CrossRef]
- Kayode, A. J.; Okoh, A. I. Assessment of multidrug-resistant Listeria monocytogenes in milk and milk product and One Health perspective. PLoS ONE 2022, 17(7), e270993. [Google Scholar] [CrossRef] [PubMed]
- Wartha, S.; Bretschneider, N.; Dangel, A.; Hobmaier, B.; Hormansdorfer, S.; Huber, I.; Murr, L.; Pavlovic, M.; et al. Genetic Characterization of Listeria from Food of Non-Animal Origin Products and from Producing and Processing Companies in Bavaria, Germany. Foods 2023, 12(6), 1120. [Google Scholar] [CrossRef] [PubMed]



|
Target Group/ Species |
Target Gene |
Primer Name |
Sequence (5′ → 3′) |
Product Size (bp) |
Diagnostic Role/Interpretation |
| Listeria Genus | prs | prs-F prs-R |
GCTGAAGAGATTGCGAAAGAAG CAAAGAAACCTTGGATTTGCGG |
370 | Positive control/Genus validation |
| L. monocytogenes | hlyA | hly-F hly-R |
GCAGTTGCAAGCGCTTGGAGTGAA GCAACGTATCCTCCAGAGTGATCG |
456 | Clinical human pathogen tracking |
| L. ivanovii | namA | liv22228F liv22228R |
CGAATTCCTTATTCACTTGAGC GGTGCTGCGAACTTAACTCA |
463 | Veterinary ruminant pathogen tracking |
| L. innocua | Lin0464 | Lin0464F Lin0464R |
CGCATTTATCGCCAAAACTC TGCTGACATAGACGCGATTG |
749 | Saprophytic environmental indicator |
| L. seeligeri | Lmo0333 | lseelinF lseelinR |
GTACCTGCTGGAGTACATA CTGTCTCCATATCCGTACAG |
290 | Saprophytic environmental indicator |
| L. grayi | Oxidoreductase | JOgrayiF JOgrayiR |
GCGGATAAAGGTGTTCGGTCAA ATTTGCTATCGTCCGAGGCTAGG |
201 | Saprophytic environmental indicator |
| L. welshimeri | scrA | Lwe1801F Lwe1801R |
CGTGGCACAATAGCAATCTG GACATGCCTGCTGAACTAGA |
281 | Saprophytic environmental indicator |
| Compound | Volume (µL) | Concentration |
| dH2O | 11.8 | - |
| 5× Green GoTaq buffer | 5 | 1× |
| PCR Nucleotide mix | 0.5 | 0.2mM |
| MgCl2, 25mM solution | 4 | 4mM |
| Forward prs primer, 15 µM | 1 | 0.6 µM |
| Reverse prs primer, 15 µM | 1 | 0.6 µM |
| GoTaq DNA, polymerase, 5 U/µL | 0.2 | 1 u/25 µL |
| Sum (master mix) | 23.5 | - |
| DNA Template | 1.5 | 1.5 ng/25 µL |
| Total | 25.0 | - |
|
Food Category and Individual Item Subtype |
Total Listeria isolates (N) |
L. mono % (n) |
L. ivanovii % (n) |
L. innocua % (n) |
L. seeligeri % (n) |
L. grayi % (n) |
L. welshimeri % (n) |
Unknown Listeria spp. % (n) |
Overall Prevalence % (n) |
| VEGETABLES | 435 | 0.46 (2) | 1.15 (5) | 2.76 (12) | 1.61 (7) | 1.84 (8) | 2.99 (13) | 0.46 (2) | 11.49 (50) |
| Cucumber | 58 | 0.00 (0) | 1.72 (1) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 1.72 (1) | 3.45 (2) | 6.90 (4) |
| Lettuce | 22 | 0.00 (0) | 0.00 (0) | 4.55 (1) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 9.09 (2) |
| Alpha Sprouts + Alfalfa | 23 | 4.35 (1) | 0.00 (0) | 4.35 (1) | 0.00 (0) | 4.35 (1) | 4.35 (1) | 0.00 (0) | 17.39 (4) |
| Kale | 36 | 0.00 (0) | 2.78 (1) | 5.56 (2) | 2.78 (1) | 8.34 (3) | 2.78 (1) | 0.00 (0) | 22.22 (8) |
| Green onion | 45 | 0.00 (0) | 2.22 (1) | 2.22 (1) | 2.22 (1) | 0.00 (0) | 4.45 (2) | 0.00 (0) | 11.11 (5) |
| Spinach | 60 | 0.00 (0) | 0.00 (0) | 3.33 (2) | 5.00 (3) | 1.66 (1) | 3.33 (2) | 0.00 (0) | 13.33 (8) |
| Collard green | 19 | 5.26 (1) | 5.26 (1) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 5.26 (1) | 0.00 (0) | 15.79 (3) |
| Romaine lettuce + Heart | 36 | 0.00 (0) | 0.00 (0) | 2.78 (1) | 2.78 (1) | 5.56 (2) | 5.56 (2) | 0.00 (0) | 16.67 (6) |
| Cilantro | 24 | 0.00 (0) | 0.00 (0) | 8.33 (2) | 0.00 (0) | 0.00 (0) | 4.17 (1) | 0.00 (0) | 12.50 (3) |
| Mixed lettuce | 9 | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 11.11 (1) | 0.00 (0) | 11.11 (1) |
| Carrot | 9 | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) |
| Mixed vegetables | 40 | 0.00 (0) | 2.50 (1) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 2.50 (1) | 0.00 (0) | 5.00 (2) |
| Tomato | 54 | 0.00 (0) | 0.00 (0) | 3.70 (2) | 1.85 (1) | 1.85 (1) | 0.00 (0) | 0.00 (0) | 7.41 (4) |
| EDIBLE FUNGI | 22 | 0.00 (0) | 0.00 (0) | 9.09 (2) | 4.55 (1) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 13.64 (3) |
| Mushrooms | 22 | 0.00 (0) | 0.00 (0) | 9.09 (2) | 4.55 (1) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 13.64 (3) |
| RAW MEAT | 121 | 2.48 (3) | 0.00 (0) | 1.65 (2) | 1.65 (2) | 1.65 (2) | 2.48 (3) | 0.83 (1) | 10.74 (13) |
| Raw Ground Beef | 36 | 2.78 (1) | 0.00 (0) | 0.00 (0) | 3.33 (1) | 0.00 (0) | 3.33 (1) | 2.78 (1) | 13.89 (5) |
| Raw Beef | 30 | 0.00 (0) | 0.00 (0) | 3.33 (1) | 0.00 (0) | 0.00 (0) | 3.33 (1) | 0.00 (0) | 6.67 (2) |
| Raw Chicken | 42 | 2.38 (1) | 0.00 (0) | 2.38 (1) | 2.38 (1) | 2.38 (1) | 0.00 (0) | 0.00 (0) | 9.52 (4) |
| Ground Pork | 3 | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) |
| Raw Pork | 10 | 10.00 (1) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 10.00 (1) | 0.00 (0) | 0.00 (0) | 20.00 (2) |
| UNPROCESSED DAIRY | 48 | 4.17 (2) | 2.08 (1) | 0.00 (0) | 2.08 (1) | 0.00 (0) | 4.17 (2) | 2.08 (1) | 12.50 (7) |
| Raw Milk | 48 | 4.17 (2) | 2.08 (1) | 0.00 (0) | 2.08 (1) | 0.00 (0) | 4.17 (2) | 2.08 (1) | 12.50 (7) |
| PROCESSED MEAT | 39 | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) |
| Pork Ham | 11 | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) |
| Pork Sausage | 9 | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) |
| Beef Hotdog | 16 | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) |
| Smoked Pork | 3 | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) |
| PROCESSED DAIRY | 201 | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.50 (1) | 0.50 (1) |
| Whole Milk | 25 | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) |
| Milk (2%) | 25 | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) |
| Mozzarella Cheese | 17 | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) |
| Cream Cheese | 14 | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 7.14 (1) | 7.14 (1) |
| Sandwich Cheese | 9 | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) |
| Pepper Jack Cheese | 12 | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) |
| Snack Cheese | 3 | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) |
| Parmesan Cheese | 9 | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) |
| Skimmed Milk Cheese | 6 | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) |
| Cheddar Cheese | 12 | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) |
| Feta Cheese | 30 | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) |
| Yogurt | 34 | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) | 0.00 (0) |
| TOTAL STUDIED POOL | 866 | 0.81 (7) | 0.69 (6) | 1.85 (16) | 1.27 (11) | 1.15 (10) | 2.08 (18) | 0.69 (6) | 8.55 (74) |
|
L. MONOCYTOGENES (N = 7) R/I/S % (N) |
L. IVANOVII (N = 6) R/I/S % (N) |
L. INNOCUA (N = 16) R/I/S % (N) |
L. SEELIGERI (N = 11) R/I/S % (N) |
L. GRAYI (N = 10) R/I/S % (N) |
L. WELSHIMERI (N = 18) R/I/S % (N) |
|
| AMIKACIN | 0.0 (0)/0.0 (0)/100 (7) | 0.0 (0)/16.7 (1)/83.3 (5) | 0.0 (0)/0.0 (0)/100 (16) | 0.0 (0)/0.0 (0)/100 (11) | 0.0 (0)/20.0 (2)/80.0 (8) | 0.0 (0)/0.0 (0)/100 (18) |
| AZITHROMYCIN | 0.0 (0)/0.0 (0)/100 (7) | 0.0 (0)/0.0 (0)/100 (6) | 12.5 (2)/6.3 (1)/81.3 (13) | 9.1 (1)/18.2 (2)/72.7 (8) | 10.0 (1)/20.0 (2)/70.0 (7) | 5.6 (1)/22.2 (4)/72.2 (13) |
| CHLORAMPHENICOL | 0.0 (0)/14.3 (1)/85.7 (6) | 16.7 (1)/50.0 (3)/33.3 (2) | 18.8 (3)/18.8 (3)/62.5 (10) | 0.0 (0)/0.0 (0)/100 (11) | 0.0 (0)/0.0 (0)/100 (10) | 5.6 (1)/5.6 (1)/88.9 (16) |
| CIPROFLOXACIN | 14.3 (1)/0.0 (0)/85.7 (6) | 33.3 (2)/16.7 (1)/50.0 (3) | 12.5 (2)/25.0 (4)/62.5 (10) | 0.0 (0)/0.0 (0)/100 (11) | 30.0 (3)/30.0 (3)/40.0 (4) | 22.2 (4)/11.1 (2)/66.7 (12) |
| CLINDAMYCIN | 28.6 (2)/14.3 (1)/57.1 (4) | 16.7 (1)/66.7 (4)/16.7 (1) | 18.8 (3)/12.5 (2)/68.8 (11) | 0.0 (0)/18.2 (2)/81.8 (9) | 40.0 (4)/20.0 (2)/40.0 (4) | 0.0 (0)/0.0 (0)/100 (18) |
| ERYTHROMYCIN | 14.3 (1)/0.0 (0)/85.7 (6) | 0.0 (0)/0.0 (0)/100 (6) | 0.0 (0)/0.0 (0)/100 (16) | 18.2 (2)/27.3 (3)/54.5 (6) | 20.0 (2)/20.0 (2)/60.0 (6) | 0.0 (0)/0.0 (0)/100 (18) |
| KANAMYCIN | 14.3 (1)/14.3 (1)/71.4 (5) | 50.0 (3)/0.0 (0)/50.0 (3) | 25.0 (4)/25.0 (4)/50.0 (8) | 27.3 (3)/36.4 (4)/36.4 (4) | 30.0 (3)/20.0 (2)/50.0 (5) | 16.7 (3)/27.8 (5)/55.6 (10) |
| LEVOFLOXACIN | 42.9 (3)/0.0 (0)/57.1 (4) | 66.7 (4)/0.0 (0)/33.3 (2) | 18.8 (3)/31.3 (5)/50.0 (8) | 18.2 (2)/36.4 (4)/45.5 (5) | 40.0 (4)/20.0 (2)/40.0 (4) | 0.0 (0)/22.2 (4)/77.8 (14) |
| MOXIFLOXACIN | 14.3 (1)/0.0 (0)/85.7 (6) | 16.7 (1)/16.7 (1)/66.7 (4) | 18.8 (3)/12.5 (2)/68.8 (11) | 18.2 (2)/9.1 (1)/72.7 (8) | 20.0 (2)/0.0 (0)/80.0 (8) | 16.7 (3)/22.2 (4)/61.1 (11) |
| NITROFURANTOIN | 42.9 (3)/14.3 (1)/42.9 (3) | 83.3 (5)/0.0 (0)/16.7 (1) | 37.5 (6)/12.5 (2)/50.0 (8) | 36.4 (4)/18.2 (2)/45.5 (5) | 60.0 (6)/20.0 (2)/20.0 (2) | 44.4 (8)/5.6 (1)/50.0 (9) |
| PENICILLIN G | 57.1 (4)/0.0 (0)/42.9 (3) | 66.7 (4)/0.0 (0)/33.3 (2) | 25.0 (4)/0.0 (0)/75.0 (12) | 36.4 (4)/18.2 (2)/45.5 (5) | 50.0 (5)/10.0 (1)/40.0 (4) | 11.1 (2)/5.6 (1)/83.3 (15) |
| RIFAMPIN | 42.9 (3)/0.0 (0)/57.1 (4) | 16.7 (1)/0.0 (0)/83.3 (5) | 12.5 (2)/0.0 (0)/87.5 (14) | 0.0 (0)/0.0 (0)/100 (11) | 10.0 (1)/10.0 (1)/80.0 (8) | 11.1 (2)/16.7 (3)/72.2 (13) |
| TETRACYCLINE | 0.0 (0)/0.0 (0)/100 (7) | 0.0 (0)/0.0 (0)/100 (6) | 6.3 (1)/0.0 (0)/93.8 (15) | 0.0 (0)/0.0 (0)/100 (11) | 0.0 (0)/0.0 (0)/100 (10) | 0.0 (0)/0.0 (0)/100 (18) |
| TOBRAMYCIN | 0.0 (0)/0.0 (0)/100 (7) | 0.0 (0)/0.0 (0)/100 (6) | 0.0 (0)/0.0 (0)/100 (16) | 0.0 (0)/0.0 (0)/100 (11) | 0.0 (0)/0.0 (0)/100 (10) | 5.6 (1)/0.0 (0)/94.4 (17) |
| TRIMETHOPRIM | 14.3 (1)/0.0 (0)/85.7 (6) | 16.7 (1)/0.0 (0)/83.3 (5) | 12.5 (2)/6.3 (1)/81.3 (13) | 18.2 (2)/0.0 (0)/81.8 (9) | 30.0 (3)/30.0 (3)/40.0 (4) | 11.1 (2)/0.0 (0)/88.9 (16) |
| TMP-SMX B | 0.0 (0)/0.0 (0)/100 (7) | 0.0 (0)/0.0 (0)/100 (6) | 0.0 (0)/0.0 (0)/100 (16) | 0.0 (0)/0.0 (0)/100 (11) | 0.0 (0)/0.0 (0)/100 (10) | 5.6 (1)/0.0 (0)/94.4 (17) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.