Molecular Characteriztion of a Novel Monopartite Begomovirus Infecting Weeds and Important Crops in Yunnan, China

1. Introduction

Begomovirus, a class of plant viruses with circular, single-stranded DNA genomes, cause significant economic losses in the production of vegetable, root, and fiber crops worldwide [1]. Up to now, this genus is the largest genus in the virus kingdom, composed of 445 virus species recognized by the International Committee on Taxonomy of Viruses (ICTV) [2]. Based on their genome components, begomoviruses can be divided into bipartite (consisted DNA-A and DNA-B components) or monopartite (consisted only one component similar to DNA-A of bipartite viruses). The monopartite genome DNA-A is about 2.5-3.0 kb and encompasses 7 ORFs, including V1 and V2 in sense sequence and C1, C2, C3, C4 and C5 in complementary sense sequence [3]. These ORFs encodes proteins functioning in viral replication (C1 and C3), transcription (C2), virion assembly (V1), and suppression gene silencing (V2, C2, C4, C5) [4].

Weeds play an important role in the epidemiology of begomoviruses. Many weed plants have been reported as natural hosts of begomoviruses, and the majority of these weed plants belong to the families Asteraceae, Malvaceae, Amaranthaceae, Euphorbiaceae, Solanaceae, and Leguminosae [4,5,6,7,8,9]. Meanwhile, weeds also serve as “melting pots” for evolving new species and strains [10], such as novel begomoviruses of sida yellow mosaic Gujarat virus [11], chenopodium leaf distortion virus [12], and macroptilium bright yellow interveinal virus [13].

Nevertheless, most of weed-begomoviruses often failed to infect crop in filed (field?) conditions, though it is supposed that the weed-begomoviruses can be spilled over from original hosts (wild plant) to new hosts (crops) and transmitted back from crops to wild plant hosts [14]. Interestingly, it is known that Tomato yellow leaf curl virus (TYLCV), a global geminivirus, has a very diverse host range, not only including 49 plant species under experimental condition [15], but also 25 plant species in filed conditions [4]. Here, we identified and characterized a novel pathogenic monopartite begomovirus which can infect weed species of Bidens Pilosan and Crassocephalum crepidioide, as well as crop species of tomato, common bean and pepper in filed conditions, showing potential threat to the production of important agriculture crops.

2. Materials and Methods

2.1. Sample Collection and Virus Detection

During 2017 to 2018, a field survey of begomovirus diversity has been conducted in Yunnan Province and about a thousand samples were collected from difference growth fields. Total DNA was extracted from these samples by the CTAB method [16]. Initially, PCR with the degenerated primers PA and PB was conducted to detect begomovirus infection, as described by Xie [17]. The PCR products were analyzed on 1% agarose gel and then sequenced at commercial facilities of Life Technologies, Shanghai, China.

2.2. Cloning, sequencing and Sequence Analysis

Based on nucleotide sequence of the obtained fragments, specific primer pairs (F: CCACTCCCGCATCCAAGGTG, R: GGAAATGACTATATCGGCGG) were designed for amplification of the full-length begomovirus DNA from the total DNA. The PCR products were analyzed on 1% agarose gel and the desired band was purified using gel extraction Kit (Axygen, USA), subsequently ligated into the pGEM-T easy vector (Promega, Madison, WI, USA). The ligation mixture was used to transform Escherichia coli strain DH5α. Positive clones were sequenced at commercial facilities of Life Technologies, Shanghai, China. Open reading frames (ORFs) of the nucleotide sequences were identified by DNAMAN Version 7 (Lynnon Biosoft, Quebec, Canada). Similarity alignment was performed by the program SDT version 1.3 [18] or using BLASTn in NCBI nucleotide database.

2.3. Phylogenetic and Recombination Analysis

A phylogenetic tree was built using the maximum likelihood method with 1000 bootstrap replicates in Molecular Evolutionary Genetics Analysis X (MEGA-X). Recombination was analyzed by Recombination Detection Program 4, using RDP, GENECONV, BootScan, MaxChi, Chimaera, SiScan and 3Seq methods.

2.4. Construction of the Infectious Clone and Agrobacterium-Mediated Inoculation

The full-length genome of YN6330-2 was amplified using specific primer pairs YN6330FL-BF/BR (BF: CGGGATCCATTATTAAATGAGTTTCCTG, BR: CGGGATCCCACATAGTGCGGAGTGCA), and cloned into pGEM-T Easy Vector to obtain pGEM-T-YN6330-2-1A. Meanwhile, the PCR fragment (1.37 kb) of YN6330-2, including the IR of the virus, was amplified using specific primer pairs YN6330FL-BF and YN6330PL-SalI-R (YN6330PL-SalI-R: GCGTCGACGTTTGTGACGAGGACAGTGGG), and cloned into pGEM-T Easy Vector to obtain pGEM-T-YN6330-2-0.5A. After sequencing, the pGEM-T-YN6330-2-0.5A digested with EcoRI and SalI restriction enzymes (Fermentas, USA) and cloned into the binary vector pBinPLUS to obtain pBinPLUS-YN6330-2-0.5A. The full-length YN6330-2 was digested with EcoRI from the pGEM-T-YN6330-2-1A and cloned into the pBinPLUS-YN6330-2-0.5A to produce pBinPLUS-YN6330-2-1.5A, containing a head-to-tail 1.5 dimer of BpLCrV genome. Subsequently, the pBinPLUS-YN6330-2-1.5A was transformed into A. tumefaciens strain EHA105 to produce an infectious clone of YN6330-2. Agroinfiltration of Nicotiana benthamiana (N. bethamiana), Nicotiana glutinosa (N. glutinosa) and Datura stramonium (D. stramonium) plants was performed as previously described [19].

3. Results

3.1. Symptoms and Virus Detection

During the field survey in Yunnan, we obtained over 200 samples from plants with typical symptoms induced by begomovirus, such as leaf curling, stunted growth, vein yellowing and enation. Among them, leaf curl disease was first observed in Bidens Pilosa with about 5% disease incidence in Honghe, Yunnan (Figure 1c). Meanwhile, seven leaf samples were also collected from tomato, common bean, Bidens Pilosa, pepper and Crassocephalum crepidioides plants exhibiting the typical begomovirus-induced symptoms (Figure 1, Table S1). An approximately 500 bp DNA fragment was amplified from these seven leaf samples and a total of 14 samples were subjected to sequence. Sequence comparison showed that all these 14 sequences shared 91.5% identity with the CP gene of tomato yellow leaf curl Vietnam virus (TYLCVV).

3.2. Cloning, Sequencing and Sequencing Analysis

DNA-A fragment of the begomvirus was amplified through PCR and a total of 12 sequences were obtained. These 12 sequences of DNA-A composing of 2,735 nucleotides, have been submitted to Genbank under accestion numbers given in Table S2. All sequences showed a genome organization typical of monopartite begomovirus reported from Old World: two virus-sense genes encoding the capsid protein (CP/V1) and V2 protein (V2) and four complementary-sense genes encoding the replication-associated protein (Rep/C1), a transcriptional activator protein (TrAP/C2), a replication enhancer protein (REn/C3), and the C4 protein (C4) (Table S2). Additionally, an unknown gene (103 amino acids) in virus-sense and C5 protein (99 amino acids) were also found for all of these DNA-A (Table S2). All these sequences also have an intergenic region (IR), which includes the stem loop-structured non-nucleotide sequence TAATATT↓AC, TATA box, and iteron sequences (GGTGT).

Both the results of BLAST and SDT (Figure 2a) showed these sequences share the highest nucleotide identity (88.73-88.95%) with the known isolate of CraYVVYN-5958 (MK626676). Based on the recommended criteria, a 91% identity as a demarcation threshold for defining new begomovirus species [20], these isolates were therefore classified as a new begomovirus, and it was named as bidens pilosa leaf crumple virus (BpLCrV).

The results of pairwise sequence comparisons showed sequences of BpLCrV revealed 99.63 to 100.00% identity with each other (Table S3). Based on a sequence identity threshold of 94% for strain demarcation [20], these twelve clones are a same strain of BpLCrV. Thus, the sequence of BpLCrV-6330-2 (MT364270) isolate was selected for further multiple alignments. The result showed that BpLCrV-6330-2 sequence can be divided into two parts (Table S4). Part 1 includes the IR, V1 (CP), C1 (Rep) and C4 genes. The predicted amino acid sequences of the CP, Rep and C4 proteins show the highest amino acid sequence identity with CraYVV-YN5958 (93.8%, 96.1% and 94.9%, respectively). Part 2 includes the V2, C2 (TrAp) and C3 (REn) genes. The predicted amino acid sequences of the V2, TrAp and REn proteins show the highest amino acid sequence identity with ToLCHaV or TYLCHniV (94.0%, 88.1% and 88.1%, respectively). Consistently, the sequence from 1386 to 57 nt of BpLCrV-6330-2 shares 95.5% sequence identity with CraYVV-YN5958, but the sequence from 1083 to 1371 nt of BpLCrV-6330-2 shows only 68.9% sequence identity with CraYVV-YN5958, aligning with the highest amino acid sequence identity between the Rep and C4 proteins of BpLCrV-6330-2 and CraYVV-YN5958, but low amino acid sequence identity (72.6%) between the REn protein (Table S4). Thus, it is very likely that BpLCrV-6330-2 is originated by recombination between CraYVV-YN5958 and other begomoviruses.

3.3. Phylogenetic and Recombination Analysis

The phylogenetic analysis showed that BpLCrV is clustered with TYLCTHV and TYLCCNV from China (Figure 2b), indicating the BpLCrV closely related to the species of TYLCTHV and TYLCCNV. RDP analysis revealed strong evidences of a recombination event in the sequence of BpLCrV-6330-2 isolate, with putative recombination breakpoints located in the V2 regions (Figure 2c). It is predicted that BpLCrV-6330-2 is generated by recombination between CraYVV-YN5958 (MK626676) and ALCuV-G52 (NC_006384) by six different methods available in RDP with a high degree of confidence (Figure 2c). The results are also supported by previous results of multiple alignments (Table S4).

3.4. Infectivity and Symptoms Induced by YN6330-2

To investigate the infectivity of this novel begomovirus, an infectious clone of BpLCrV-6330-2 was constructed (Figure 3a) and agroinfiltrated to 16 plants of N. bethamiana, N. glutinosa and D. stramonium, respectively (Figure 3). In N.benthamiana, all infiltrated plants exhibited obvious downward leaf curling at 21 days post infiltration (dpi) (Figure 3). In N. glutinosa, severe downward leaf curling symptoms was also observed at 21 dpi in 14 plants infected with BpLCrV (Figure 3b,c). In D. stramonium, mild downward leaf curling developed at 23 dpi, but only 2 plants were successfully infected by BpLCrV and exhibited the clear symptoms (Figure 3b,c). Therefore, a BpLCrV infectious clone was developed to infect and cause disease symptom in different host plants, which also validated the virulence of the new begomovirus to plants.

4. Discussion

Bidens Pilosan is a widely distributed weed specie and used for treating diseases associated with immune response disorders in the world [21]. Weeds play an important role in the epidemiology of begomoviruses, serving both as alternative hosts and as ’melting pots’ for recombination and satellites exchange [10]. In this study, a novel monopartite begomovirus was firstly identified from leaf crumple disease of Bidens Pilosan and found to cause severe symptoms in N. benthamiana, N. glutinosa and D. stramonium. Previously report showed that Bidens Pilosan cannot be infected by begomovirus tomato yellow leaf curl virus (TYLCV)TYLCV [22]. Our results indicate that weed Bidens Pilosan also serves as an alternative host. To the best of our knowledge, this is the first report of the Bidens Pilosan as the host of begomovirus. This study also showed that tomato, common bean, pepper and Crassocephalum crepidioides are hosts of BpLCrV. These findings provided convincing evidences that the BpLCrV, a novel begomoviruse identified, not only infected weeds of Bidens Pilosan and Crassocephalum crepidioides, but also crops of tomato, pepper and common bean.

It is well known that Geminiviridae shows the highest evolutionary success among plant virus largely due to inter-and intra-species recombination [2]. Yunnan (south of China) is one of a reservoir of geminiviruses with the greatest diversity of geminiviruses and their satellites [23]. Based on recently published reports, the emergence of new begomovirus species by recombination are increasing in the Yunnan, such as tomato leaf curl Yunnan virus (TLCYnV) [24], pepper yellow leaf curl virus (PepYLCV) [25], tomato yellow leaf curl Shuangbai virus (TYLCSbV) [26] and tomato yellow leaf curl Chuxiong virus (TYLCCxV) [27]. In this study, we also founf that probably BpLCrV was originated from the recombination of CraYVV and ALCuV. These findings also further hint that more diverse of begomoviruses more possibilly evolves new species through recombination. Previous study showed that a new specie emerged by recombination usually possessed high pathogenicity, a broader host range, or higher transmission efficiency compared with parental viruses [4,24,26]. Further research should be conducted to explore pathogenicity, host range and transmission efficiency of BpLCrV.

5. Conclusions

In summary, a novel monopartite begomovirus (BpLCrV), probably originated from the recombination between CraYVV-YN5958 and ALCuV-G52, was identified from tomato, common bean, Bidens Pilosa, pepper and Crassocephalum crepidioides plants in Yunnan. A BpLCrV infectious clone was further developed to effectively infect N. bethamiana, N. glutinosa and D. stramonium, and validated the pathogenicity of the new begomovirus. Our findings provide further support that weed could play an important role in the epidemiology and evolution of begomoviruses, and recombination might be a dominant force to evolve new geminiviruses.