Immunogenicity and Growth Response of Atlantic Salmon to Dietary Inclusion of Marine Diatom, <em>Skeletonema marinoi</em>

Kala Mallik Meesala; Abigeal Dolapo Adeyemi; Sarah Janson; Jeongwhui Hong; Mark Polinski; Gary Burr; Michael Lomas; Wendy M. Sealey; Deborah A. Bouchard; Michael Habte-Tsion

doi:10.20944/preprints202606.2279.v1

Submitted:

28 June 2026

Posted:

01 July 2026

You are already at the latest version

Abstract

Functional feed ingredients with antimicrobial activities are being explored as a tool to mitigate diseases in Atlantic salmon (Salmo salar L.). Skeletonema marinoi is a marine diatom known to have antimicrobial activity. Here, two separate experiments, including a growth study (Exp.1) and a bacterial challenge (Exp.2), were conducted to evaluate the effects of dietary S. marinoi as a functional feed ingredient on the growth, feed utilization, stress biomarkers, antioxidant defense, and immunogenic responses of Atlantic salmon. In Exp 1, a 16-week growth trial was conducted in a recirculating aquaculture system (RAS) stocked with ten fish (59.6 ± 1.6 g, initial weight) in each of five replicate tanks per treatment. Fish were fed twice daily with either the reference diet or the reference diet supplemented with 0.5% S. marinoi. In Exp. 2, a 27-day bacterial challenge with Vibrio anguillarum Serotype O3 (SO3) was conducted in RAS using 36 fish (100–150 g) per 150 L tank in triplicate. Fish were acclimatized to the RAS for 14 days and fed twice daily with the reference or 0.5% S. marinoi diet prior to the bacterial challenge. Blood plasma, liver, and intestine samples were collected after the growth trial, before (initial, 0 day) and post-challenge (5, 10, 27 days). The results indicated that in Exp. 1, there were no significant differences in survival, final weight, weight gain, feed intake, feed efficiency, condition factor, and hepatosomatic index between fish fed with the reference diet and 0.5% S. marinoi diet. In Exp. 2, before challenge, Atlantic salmon fed the diet with 0.5% S. marinoi showed significantly higher superoxide dismutase (SOD) activity in comparison to fish fed the reference diet. On day 5 post-challenge, significantly higher liver peroxidation or malondialdehyde (MDA) level was measured in the 0.5% S. marinoi group compared to the reference group. Plasma immunoglobulin M (IgM) level and intestinal IgM gene expression increased after challenge in fish fed 0.5% S. marinoi, in contrast to those fed the reference diet at 27 days post-challenge (P < 0.05). Overall, these findings suggest that S. marinoi is more likely to be associated with immune modulation rather than adverse stress response; however, further work is required to confirm pathogen-specific immunity.

Keywords:

Atlantic salmon

;

Skeletonema marinoi

;

Vibrio Anguillarum SO3

;

growth performance

;

stress biomarkers

;

immunoglobulin gene expression

Subject:

Biology and Life Sciences - Aquatic Science

1. Introduction

Aquaculture plays a major role in global food production, providing a reliable source of nutritious seafood to meet the needs of a growing global population. The rapid development of the aquaculture industry has been critical in matching overall fish product supply with rising demand, making a substantial contribution to food security [1]. However, such rapid growth has not been without challenges; the expansion of the aquaculture sector has led to a rise in disease outbreaks, negatively impacting fish health, production capacity, and the sustainability of this sector [2,3,4]. Overuse of antibiotics has raised concerns regarding antibiotic resistance and its adverse environmental consequences, thus emphasizing the need for new approaches to enhance the immunity of aquatic organisms [5]. Consequently, there has been a growing interest in investigating functional feed components with antibacterial capabilities as alternative strategies for managing diseases in aquaculture operations.

Functional feed ingredients have been identified as a promising way to increase disease resistance and support growth and health in aquaculture species [6]. These ingredients are defined as dietary components that provide health benefits beyond nutritional demands. Researchers have investigated marine diatoms as functional feed ingredients due to their bioactive compounds, such as fatty acids, polysaccharides, and phenolic compounds, drawing attention to potential health benefits from their antimicrobial properties [7,8]. A recent study highlighted the antimicrobial properties of marine diatoms as a viable strategy for controlling infectious microorganisms in aquaculture operations [9]. In addition, marine diatoms have been shown to positively correlate with growth parameters and overall health in a variety of aquatic species when incorporated into aquafeeds [10], indicating the potential to enhance both fish welfare and overall productivity.

Skeletonema marinoi, a marine centric diatom, is characterized by its chain-forming structure and silica cell walls (frustules) [11]. It is known to contain bioactive compounds, including ovothiol B, which has been reported to reduce oxidative stress and exhibit antioxidant properties [12]. In addition, extracts of S. marinoi have demonstrated antimicrobial activity [13].

Atlantic salmon (Salmo salar L.) is one of the most valuable fish species in the aquaculture food industry. It is a highly valued finfish due to its high nutritional content, including protein, omega-3 fatty acids, vitamins, and minerals. Infectious disease remains a major constraint in Atlantic salmon production; however, advances in health management, especially vaccination, have markedly reduced the incidence and impact of bacterial diseases, including vibriosis caused by Vibrio species [14]. Nevertheless, in the absence of vaccination or under suboptimal health management, vibriosis outbreaks can still occur, resulting in impaired fish health and substantial economic losses due to increased mortality [1]. Given the vital role of Atlantic salmon in the aquaculture industry and the growing concerns surrounding disease mitigation, it is timely to investigate novel approaches that can prevent disease risks while advancing sustainable aquaculture practices. Furthermore, the use of marine diatoms as a functional feed ingredient represents a promising approach to improving fish health and enhancing the resilience and productivity of Atlantic salmon in aquaculture systems.

This study aimed to assess the effects of Skeletonema marinoi as a functional feed ingredient on the growth performance, feed utilization, condition indices, stress biomarkers, antioxidant defense and immunogenic responses against Vibrio anguillarum SO3 infection of Atlantic salmon through two separate experiments: a growth study (Exp. 1) and a bacterial challenge test with Vibrio anguillarum SO3 (Exp. 2). To the best of our knowledge, this is the first research to assess the effect of S. marinoi as a functional feed ingredient on the growth and immune responses of Atlantic salmon.

2. Materials and Methods

2.1. Experimental Diets

Table 1 presents the formulation of the experimental diets designed to meet the nutritional requirements of Atlantic salmon [15]. Both diets contain 45.7% crude protein (CP) and 22.5% crude lipid, with one diet being supplemented with 0.5% marine microalgae (S. marinoi) to create the test diet. S. marinoi was produced by Bigelow Laboratory for Ocean Sciences (East Boothbay, Maine, USA). Diets were prepared at the Bozeman Fish Technology Center (Bozeman, Montana, USA) using standard commercial feed manufacturing methods. Briefly, all mixed ingredients, including 0.5% S. marinoi for the test diet, were ground to less than 200 μm using an air-swept pulverizer before being processed in a twin-screw extruder (DNDL-44, Bühler AG, Uzwil, Switzerland). After extrusion, the pellets were dried in a pulse bed dryer (Bühler AG, Uzwil, Switzerland) to ensure final moisture levels remained below 10%, followed by a 10-minute cooling period. Oils were then top-coated using a vacuum coater (A.J. Mixing, Ontario, Canada). The final diets were stored in plastic-lined paper bags at room temperature to maintain freshness.

2.2. Growth Trial

The growth study was conducted at the USDA-National Cold Water Marine Aquaculture Center (Franklin, Maine, USA) using Atlantic salmon parr sourced from the St. Johns River Atlantic salmon strain. The experimental fish were stocked in a recirculating aquaculture system (RAS) consisting of 10 tanks, each filled with 140 liters of saltwater. Each tank was stocked with ten fish, with an initial average weight of 59.6 ± 1.6 g. The two dietary treatments were randomly assigned to ten tanks, with five replicates of each diet. The dietary treatments included a standard reference diet and a test diet (a reference diet supplemented with 0.5% S. marinoi). Fish were fed these diets to satiation twice daily for 16 weeks. Environmental conditions were carefully controlled and monitored daily, maintaining a water temperature of 10 °C, a salinity of 14 ppt, and a photoperiod of 14 hours of light and 10 hours of dark. Temperature and dissolved oxygen levels were continuously monitored using the InWaterTech water quality monitoring system (Campbell River, British Columbia). Weekly measurements included water quality parameters such as pH (Oakton pHTestr 5), ammonia (Hach method 8155), nitrite (Hach method 8507), carbon dioxide (Oxyguard CO2 analyzer), nitrate (Standard Range Kit, NEC Superior Enzymes), and salinity (Extech refractometer RF20). Feed intake and mortalities were recorded daily.

2.2.1. Growth Trial Sampling

At the end of the 16-week growth trial, six fish from each tank were randomly selected for condition factor (K factor) measurement. Additionally, three more fish from each tank were humanely euthanized following approved institutional animal care and use protocols (IACUC #: 2023-01), then dissected aseptically to collect liver and intestine samples. The surface of each fish was disinfected with ethanol before dissection to remove the liver and intestinal tissues. The liver was weighed for hepatosomatic index (HSI) analysis. Liver and intestinal samples (about 200 mg) were placed into sterile 1.5 mL tubes and stored at –80 °C for future analysis. Liver tissues were used to measure hepatic lipid peroxidation and antioxidant activity, specifically malondialdehyde (MDA) and superoxide dismutase (SOD), respectively. The intestinal tissue was used to assess immunoglobulin M (IgM) gene expression.

2.3. Bacterial Challenge

To investigate the immunomodulatory effects of S. marinoi against Vibrio anguillarum SO3 infection, a pathogen challenge was conducted at the University of Maine’s Aquaculture Research Institute - Aquatic Animal Health Lab (Orono, Maine, USA). This trial was carried out in two identical recirculating aquaculture systems (RAS), each consisting of three tanks. These RAS were equipped with individual biofilters and inline UV disinfection units for pathogen reduction prior to water recirculation. The six tanks were randomly assigned to the two dietary treatments, with three tanks per group. Three tanks in the first group were fed the reference diet, while the other three tanks, representing the test group, received the reference diet supplemented with 0.5% S. marinoi. Each tank was stocked with thirty-six post-smolt Atlantic salmon (100-150g/fish) and filled with 150 liters of saltwater (18 ppt) at 14 °C. Before the challenge trial, fish were acclimated to the experimental feed for two weeks. Fish were fed to satiation twice daily prior to the bacterial challenge.

After 14 days of acclimatization, the fish were exposed to Vibrio anguillarum SO3. The challenge trial followed the protocol of a previous study [16]. Briefly, using the cohabitation model, three tanks from each dietary group were infected through intraperitoneal injection with the bacteria. A cohabitation challenge model was used, in which one-third of the fish (12 fish per tank) were randomly selected and intraperitoneally injected with V. anguillarum SO3 and designated as injected shedders, while the remaining two-thirds (24 fish per tank) served as naïve cohabitating sentinel fish. The shedders were anesthetized with 75 mg/L MS-222, buffered with 200 mg/L sodium bicarbonate, and injected intraperitoneally with 0.1 mL of a V. anguillarum SO3 suspension at 5 × 10⁶ CFUs/mL, and then returned to their respective tanks. The shedders were fin-clipped and were not sampled.

2.3.1. Bacterial Challenge Sampling

After the 14-day dietary acclimatization, the initial baseline samples were taken prior to V. anguillarum SO3 exposure (before bacterial challenge), with subsequent samplings at 5, 10, and 27 days post-challenge. Blood, liver, and intestinal samples were collected at each sampling point following approved institutional animal care and use protocols (IACUC #: A2023-02-03). Blood samples were drawn from six fish per tank following sedation with 75 mg/L MS-222 buffered with 200 mg/L sodium bicarbonate. Whole blood was drawn using 3 mL syringes (BD, Franklin Lakes, NJ, USA) and transferred into heparinized tubes. Plasma was separated by microcentrifugation at 3,000 rpm for 10 minutes at 4 °C. Following blood collection, the same six fish were humanely euthanized using 250 mg/L buffered MS-222. The external surface of each fish was disinfected with 70% ethanol prior to aseptic dissection and collection of liver and intestinal tissues. All samples from each fish were collected into 1.5 mL microcentrifuge tubes and stored at –80 °C for subsequent analysis. Plasma samples were used to measure plasma chemistry, including alkaline phosphatase (ALP) activity and immunoglobulin M (IgM). Liver tissues were used to assess hepatic malondialdehyde (MDA) and superoxide dismutase (SOD), and intestinal samples were used to evaluate IgM gene expression.

2.4. Plasma Chemistry and Hepatic Peroxide, Antioxidant Analysis

Plasma chemistry, hepatic MDA, and SOD were analyzed using commercially available assays (BioVision, Milpitas, CA, USA) as described previously [17,18]. Briefly, plasma ALP and IgM were measured quantitatively using assay kits with a spectrophotometric microplate reader (BioTek Synergy H1) at 405 nm and 450 nm, respectively. For hepatic MDA and SOD assay, liver samples (0.1 g) were homogenized in either buffer or 0.85% saline solution using an automated homogenizer (Bead Ruptor Elite, OMNI International), followed by centrifugation for 20 minutes at 4,000 rpm. The clear supernatant was pipetted and stored at -80 °C for MDA and SOD analysis, which were quantitatively measured using assay kits and a spectrophotometric microplate reader (BioTek Synergy H1) at 532 nm and 450 nm, respectively.

2.5. Gene Expression Assay

RNA isolation, reverse transcription, and RT-qPCR were conducted according to previous studies [17,18]. Briefly, 100 mg of intestinal tissue was homogenized in 1 mL of TRIzol reagent using an automated bead homogenizer (Bead Ruptor Elite, OMNI International). Chloroform was then added, mixed, and centrifuged at 12,000 rpm, 4 °C for 15 minutes. The resulting aqueous layer was collected and combined with an equal amount of isopropyl alcohol, followed by another centrifugation at 12,000 rpm for 10 minutes at 4 °C to precipitate RNA. The RNA pellets were washed using 70% ethanol, dried, and resuspended in RNase-free distilled water. The RNA’s quality and quantity were assessed using a NanoDrop™ spectrophotometer (Thermo Scientific, USA), followed by cDNA synthesis using a MiniAmp Thermal-cycler (Applied Biosystems, Thermo Fisher Scientific, USA). RT-qPCR was used to measure the relative IgM gene expression in the intestinal tissue of Atlantic salmon (Salmo salar) following protocols and primers (Forward: AGGCGGAAATTCCCTGACTG; Reverse: CACGGAGTTGACTGACTCCC) described by Habte-Tsion et al. [17]. β-actin (Forward: CCAAAGCCAACAGGGAGAA; Reverse: AGGGACAACACTGCCTGGAT) of Atlantic salmon [19] was used as a reference gene to normalize the expression levels of the target gene. The relative gene expression of IgM in the intestinal tissues was calculated using the 2^−ΔΔCt method [20].

2.6. Statistical Analysis

All data statistical analyses were conducted using IBM SPSS (Version 29.0, IBM Corp., Chicago, IL, USA). Normality of the data was tested with the Shapiro–Wilk and Kolmogorov–Smirnov tests, while Levene’s test assessed homogeneity of variances. An independent t-test evaluated significant differences between the reference group and the 0.5% S. marinoi group. Two-way repeated measures ANOVA was used to assess the effects of time (Day 0, Day 5, Day 10, and Day 27 post-challenge), dietary treatment (reference diet vs. 0.5% S. marinoi diet), and their interaction on the measured parameters. When significant diet × time interactions were found, post hoc pairwise comparisons were conducted. All data are reported as mean ± standard error (SE). Statistical significance was set at P < 0.05.

3. Results

Growth Study:

3.1. Survival, Growth Performance, Feed Utilization, and Condition Indices

The survival, growth performance, feed utilization, and condition indices of Atlantic salmon fed with the reference diet and the test diet (with 0.5% S. marinoi) are presented in Table 2. At the end of the 16-week growth trial, the survival, final weight, weight gain percentage, feed intake, feed efficiency, K-factor, and HSI analyses showed no significant differences between fish fed the reference and 0.5% S. marinoi diets.

K-factor, Fulton condition factor; HSI, hepatosomatic index. Mean values (n=5) are presented as mean ± SE. Mean values within a row with different superscript letters were significantly different (P<0.05). Calculation:

Survival (%) = (final number ÷ initial number) × 100
Final weight (g) = total group weight ÷ number of fish
Weight gain (%) = [(final weight − initial weight) ÷ initial weight] × 100
Feed efficiency ratio = weight gain (g) ÷ dry feed consumed (g)
K-factor = [body weight (g) ÷ length³ (cm³)] × 100
HSI (%) = [liver weight (g) ÷ body weight (g)] × 100

3.2. Lipid Peroxidation, Antioxidant, and Immune Gene Expression

Table 3 presents the liver MDA content (a stress biomarker), antioxidant activity (SOD), and immune gene expression in Atlantic salmon following 16 weeks of feeding with the experimental diets. No significant differences were found between dietary treatments in MDA content or SOD activity (P = 0.499 and 0.856, respectively). Similarly, the relative expression of intestinal IgM did not differ significantly between the treatments (P = 0.435).

Bacterial challenge:

3.3. Stress and Immune Biomarkers in Plasma and Liver

Plasma ALP, IgM, liver MDA, and SOD were measured at four time points: before challenge (Day 0), and at 5-, 10-, and 27-day post-challenge. Table 4 shows the effects of diets on each day, the effects of time within each dietary group, and the interactive effect of diet and time.

Plasma ALP activity was not significantly affected by diets (Figure 1A). Although a temporary increase in ALP activity was observed at 5-day post-challenge in the control group (P = 0.013; Figure 1B), no consistent or significant diet-related differences were found. Additionally, there was no significant interaction between diet and time on plasma ALP activity (P = 0.072) (Table 4).

Plasma IgM increased following bacterial challenge in all groups, with significantly higher levels observed in fish fed the 0.5% S. marinoi diet compared to the reference diet at 27 days post-challenge (P < 0.05; Figure 2A). IgM levels also increased significantly over time within each dietary group (Figure 2B). In both the reference and S. marinoi groups, IgM concentrations were lowest prior to challenge and increased post-challenge, reaching peak levels at 27 days (P = 0.007 and P < 0.001, respectively). A significant diet × time interaction (P < 0.001) indicates that the temporal IgM response differed between diets (Table 4).

Regarding liver peroxidation, no main effect of diet was found on the hepatic MDA content (P = 0.445) before the bacterial challenge (Figure 3). However, 5 days post-challenge, the 0.5% S. marinoi diet significantly increased the MDA level compared to the reference diet (P = 0.008). At 10- and 27- day post-challenge, there was no significant effect of diet on MDA content. Also, there was no significant difference when looking at the effect of time within each dietary treatment. There was an interactive effect of diet and time on hepatic MDA contents (P = 0.013; Table 4).

For hepatic SOD activity, there was a significant main effect of diet before the challenge, with higher activity in fish fed the 0.5% S. marinoi diet; however, this effect was not significant after the challenge (Figure 4). Within the 0.5% S. marinoi group, significantly higher SOD activity was observed before the challenge compared to 10 days post-challenge. According to the two-way repeated measures ANOVA, a significant interaction between diet and time was measured for the SOD activities (P = 0.028; Table 4).

3.4. Intestinal Gene Expression

Pairwise comparisons between the groups assessing the effect of diet at each time point showed no significant differences before challenge (P = 0.267), 5 days post-challenge (P = 0.437), or 10 days post-challenge (P = 0.973) in IgM expression (Figure 5A). However, at 27 days post-challenge, the relative expression of IgM mRNA was significantly higher in the 0.5% S. marinoi group than in the reference group (P < 0.001; Figure 5A).

Figure 5B shows the effect of time within each dietary treatment. In the reference group, the relative expression of IgM mRNA was significantly higher at 10 days post-challenge than at 27 days post-challenge (P = 0.046). In contrast, no statistically significant changes over time were observed within the 0.5% S. marinoi group (P = 0.319). Furthermore, the two-way repeated measures ANOVA revealed a significant interaction between diet and time (P < 0.001; Table 5).

4. Discussion

Skeletonema marinoi is a widely distributed diatom species found in temperate coastal waters, where it plays a vital role in primary production and supports the marine food web [21]. In addition to its ecological importance, S. marino, like many diatoms, is rich in high-value metabolites and contains a well-balanced profile of proteins, carbohydrates, and lipids [7,22,23]. It has also been reported to exhibit antibacterial properties, acting as a potential source of bioactive compounds for therapeutic use [24,25]. Several studies have evaluated the use of diatoms as feed additives in finfish diets, including in the diets of Atlantic salmon [26,27], Nile Tilapia, Oreochromis niloticus [28], and gilthead sea bream, Sparus aurata [29]. However, their incorporation as functional feed ingredients (additives), providing both nutritional value and bioactive effects, remains largely unexplored in Atlantic salmon, particularly for S. marinoi. To address this gap, two consecutive trials were conducted to evaluate the effects of dietary S. marinoi supplementation on growth performance, feed utilization, stress biomarkers, antioxidant defense, and immune responses of Atlantic salmon, both under normal conditions and following bacterial challenge with Vibrio anguillarum SO3.

In the growth study, conducted without a bacterial challenge, no significant differences were measured between the reference and 0.5% S. marinoi groups, and no detrimental effects were observed on the survival, final weight, weight gain, feed intake, feed efficiency, K-factor, and HSI of Atlantic salmon. These results indicated that including S. marinoi in Atlantic salmon feed at 0.5% does not negatively affect feed efficiency or growth performance. These findings align with those of Sørensen et al. [26], who investigated the effects of Phaeodactylum tricornutum at 3% and 6% inclusion levels and found no effect on growth performance and physiological responses in post-smolt Atlantic salmon. Another study by Kiron et al. [30] reported that supplementing the diet of post-smolt Atlantic salmon with 5% and 10% Nanofrustulium sp. did not affect feed utilization or growth performance. However, Eilertsen et al. [27] reported a higher growth rate in Atlantic salmon juveniles fed with 2% diatom (Porosira glacialis). Huervana et al. [28] also reported that the use of Thalassiosira weissflogii paste at 2.55% yielded the highest weight gain in Nile tilapia, with no significant effects observed at higher inclusion levels (6 and 12%). These results suggest the effects of diatom inclusion on fish growth performance could vary due to (i) type or species of diatoms; (ii) inclusion level of the diatoms; (iii) diatoms processing; (iv) fish size, stock, or strain; and (v) experimental condition. Similar to the growth results, this study found insignificant effects of the 0.5% S. marinoi diet on the health parameters of Atlantic salmon, such as hepatic MDA content, antioxidant (SOD activity), and intestinal IgM gene expression. These findings indicated that the dietary diatoms intervention alone may not induce a baseline physiological, oxidative, or immunological shift in the absence of stressors.

For further insight into the impact of S. marinoi on Atlantic salmon immunity, a bacterial challenge with Vibrio anguillarum SO3 infection was conducted to assess the effects of the 0.5% S. marinoi on plasma biomarkers, hepatic peroxidation and antioxidant, and intestinal gene expression. Before bacterial challenge (Day 0), there were no significant effects of the 0.5% S. marinoi diet on the measured parameters, including plasma health parameters (ALP activity and IgM level), liver MDA content, and intestinal IgM gene expression, which suggests that the dietary intervention alone may not induce stress or immunological responses in the absence of stressors. This aligns with previous findings [26,30], who both reported no significant changes in basal immune markers in Atlantic salmon fed diets supplemented with different diatom-derived additives under normal rearing conditions.

Plasma ALP activity is associated with the release of ALP enzymes from cells to the extracellular fluids, and elevated activity of ALP could occur when there is cell growth, tissue necrosis/ cell death, or leakage of ALP [17,18,31]. In this study, the absence of consistent or significant dietary effects suggests that the observed variations in ALP activity may reflect physiological fluctuations rather than a clear response to the dietary inclusion of S. marinoi or the experimental challenge conditions. These findings are consistent with previous studies reporting changes in ALP activity under prolonged stress [32,33], suggesting that ALP activity in fish could also vary over time.

Plasma IgM production is a key component of the specific immune response triggered by antigenic stimulation, with IgM being the predominant immunoglobulin in fish [17,34]. In the present study, plasma IgM levels increased over time following bacterial challenge, which is consistent with the expected antibody response observed in other fish [35]. Plasma IgM levels increased after challenge, with significantly higher levels in fish fed the 0.5% S. marinoi diet compared to those fed the reference diet at 27 days post-challenge. Although the timing is consistent with the delayed antibody kinetics typical of cold-water species [36], the observed increase in IgM levels at 27 days post-challenge indicates that diet may have modulated humoral response in Atlantic salmon.

Fish liver typically has high concentrations of unsaturated fatty acids, with a risk of oxidative damage, which can result in an imbalance of reactive oxygen species [37,38,39]. MDA results from lipid peroxidation and adversely affects fish health at high levels [40], and it is a well-known oxidative stress biomarker in fish [17,41]. In this study, before the challenge, MDA levels were slightly higher in fish fed with the reference diet compared to those fed the 0.5% S. marinoi diet, suggesting that S. marinoi supplementation may have a mild antioxidant effect under unstressed conditions. However, a significant divergence in MDA levels was observed after the bacterial challenge. At 5 days post-challenge, fish fed with the 0.5% S. marinoi diet exhibited higher MDA levels than those in the reference group, suggesting that the immune response and oxidative burst were more pronounced in the algal-supplemented fish during the early stages of infection. This may represent an early defense mechanism, a pattern similarly observed in stressed or pathogen-challenged fish receiving immunostimulant diets [42]. Interestingly, at 10-day post-challenge, the trend reversed, with MDA levels decreasing in the 0.5% S. marinoi group, whereas they increased in the reference group. This could indicate that the antioxidant mechanisms in the algal-supplemented fish became more effective at mitigating oxidative stress over time, leading to a faster recovery phase. Ibrahim et al. [43] investigated the effects of a microalgae-based diet on catfish (Clarias gariepinus) and observed similar results, showing that fish fed with microalgae exhibited significantly lower MDA levels compared to those on a reference diet. This could indicate reduced lipid peroxidation and oxidative stress, suggesting that the antioxidant compounds present in microalgae effectively mitigate oxidative damage in fish [44,45]. At 27-day post-challenge, MDA levels stabilized in both groups, indicating that oxidative stress resolution had occurred with a more controlled oxidative response in fish fed the 0.5% S. marinoi diet, possibly due to improved immune modulation (antioxidant defense).

Superoxide dismutase (SOD) is a crucial enzyme that catalyzes the dismutation of superoxide radicals, thereby limiting the spread of oxidative damage [46,47]. In this study, before the challenge, a significant main effect of diet was observed, with higher hepatic SOD activity in fish fed the 0.5% S. marinoi diet compared to those fed the reference diet. However, after the challenge, a non-significant transient decrease in SOD activity was measured until 10 days post-challenge, and then it increased in fish fed the 0.5% S. marinoi diet. This finding aligns with Teixeira et al. [29], who reported temporal fluctuations in gilthead seabream fed a diatom-derived β-glucan extract. The trend observed in this study suggests that S. marinoi supplementation might help maintain hepatic antioxidant capacity. However, the effect of dietary diatom inclusion on SOD activity in fish appears to fluctuate over time and may be influenced by physiological or environmental stressors. Reis et al. [48] documented increased SOD activity in gilthead seabream fed β-glucan-rich extract from the diatom Phaeodactylum tricornutum. These findings imply that diatoms could support antioxidant enzyme activity during bacterial challenges. Nonetheless, further research is needed to understand how diatoms modulate baseline and extended hepatic antioxidant responses in fish post-pathogen challenge.

Similar to plasma IgM, the intestinal IgM gene is also a powerful immune marker that is activated upon exposure to disease, playing a crucial role in the immune response and helping to identify and neutralize harmful antigens [46,49]. In the present study, the relative expression of the IgM gene in the intestine of Atlantic salmon on Day 27 post-challenge revealed a significant up-regulation in fish fed the 0.5% S. marinoi diet compared to those fed the reference diet. This finding indicates that dietary supplementation with S. marinoi could enhance the immune response of Atlantic salmon. Previous research has shown that the bioactive compounds found in S. marinoi, including β-glucans, polyunsaturated fatty acids (PUFAs), and antioxidants, have the potential to improve immune function in fish [12,50,51]. Although no significant differences in IgM gene expression in the dietary groups were observed at earlier time points (Day 0, 5-, and 10-days post challenge), the 0.5% S. marinoi group maintained up-regulated IgM gene expression throughout this period, pointing to the possibility of S. marinoi serving as a functional dietary component that could support immune defense in fish following pathogen exposure. Consistent with the findings of Bhattacharjya et al. [52], this study further highlights the antibacterial properties of S. marinoi against Vibrio anguillarum SO3 infection in Atlantic salmon, emphasizing its promise as a beneficial dietary supplement in aquaculture. Additionally, this work emphasizes the importance of evaluating time-dependent responses when assessing dietary interventions in aquaculture, suggesting that S. marinoi may not only provoke early immune responses against Vibrio anguillarum SO3 infection, but also facilitate more sustained and adaptive immunity during prolonged stress or infection recovery.

5. Conclusion

In conclusion, while the observed increase in plasma IgM and the up-regulation of intestinal IgM gene expression suggest activation of the humoral immune response, plasma total IgM levels were measured and therefore cannot distinguish between antigen-specific responses and non-specific immune stimulation. Although elevated IgM is often interpreted as an indicator of enhanced immune responsiveness, it may also reflect generalized immune activation associated with physiological stress. In the present study, the absence of negative effects on growth performance, feed efficiency, condition indices, and other physiological indicators suggests that the increased plasma IgM levels and up-regulated IgM gene expression in fish fed S. marinoi are more likely associated with immune modulation rather than adverse stress responses. However, further work is required to confirm pathogen-specific immunity using graded levels of S. marinoi as a functional ingredient in the diet of Atlantic salmon.

Funding

Laboratory analysis and salaries of M. H.-T., J.H., K.-M.M., and A.A. were supported by the U.S. Department of Agriculture, Agricultural Research Service by NACA Agreement Number 58–8030–0-004 with the University of Maine’s Aquaculture Research Institute. The externship program of S.J. was supported by the USDA-NIFA (Award Number: 2021-68012-35922). Mention of trade names or commercial products in this publication is solely for the purpose of providing specific information and does not imply recommendation or endorsement by the U.S. Department of Agriculture (USDA). USDA is an equal opportunity provider and employer.

Institutional Review Board Statement

The University of Maine holds the Office of Laboratory Animal Welfare (OLAW) of the National Institutes of Health assurance for vertebrate animals used in research, teaching, and outreach (Assurance #: A3754–01). The use of experimental fish was under scientific research protocols of the University of Maine and the USDA - National Cold Water Marine Aquaculture Center, Institutional Animal Care and Use Committees (IACUC Protocols #: A2023-02-03; IACUC #: 2023-01, respectively), that complied with all relevant international animal welfare laws, guidelines, and policies.

Data Availability Statement

Data will be available from the corresponding author upon request.

Acknowledgments

The authors would like to thank the University of Maine, the Aquaculture Research Institute (ARI) – Aquatic Animal Health Lab, and the Fish Nutrition and Nutrigenomics Lab (Orono, ME, USA), the USDA-ARS, National Cold Water Marine Aquaculture Center (Franklin, ME, USA) and USDA-ARS facility in Bozman MT, USA, for allowing their facility and laboratories to complete this study. The authors are thankful to Bigelow Lab for providing the test ingredient. Finally, the authors are very grateful to Sarah Turner, Robert Harrington, Alex Sullivan, Demitri Lifgren, and the ARI team for their help during sample collection.

Conflicts of Interest

All authors declare that there are no conflicts of interest.

References

Food and Agriculture Organization of the United Nations. The State of World Fisheries and Aquaculture 2020: Sustainability in action; FAO: Rome, Italy, 2020; Available online: https://www.un.org/en/global-issues/population.
Bondad-Reantaso, M. G.; Subasinghe, R. P.; Arthur, J. R.; Ogawa, K.; Chinabut, S.; Adlard, R.; Tan, Z.; Shariff, M. Disease and health management in Asian aquaculture. Vet. Parasitol. 2005, 132(3), 249–272. [Google Scholar] [CrossRef] [PubMed]
Olesen, I.; Myhr, A. I.; Rosendal, G. K. Sustainable Aquaculture: Are We Getting There? Ethical Perspectives on Salmon Farming. J. Agric. Environ. Ethics 2011, 24(4), 381–408. [Google Scholar] [CrossRef]
Naylor, R. L.; Hardy, R. W.; Buschmann, A. H.; Bush, S. R.; Cao, L.; Klinger, D. H.; Little, D. C.; Lubchenco, J.; Shumway, S. E.; Troell, M. A 20-year retrospective review of global aquaculture. Nature 2021, 591(7851), 551–563. [Google Scholar] [CrossRef] [PubMed]
Defoirdt, T.; Sorgeloos, P.; Bossier, P. Alternatives to antibiotics for the control of bacterial disease in aquaculture. Curr. Opin. Microbiol. 2011, 14(3), 251–258. [Google Scholar] [CrossRef] [PubMed]
Dawood, M.A.O.; Koshio, S. Recent advances in the role of probiotics and prebiotics in carp aquaculture: A review. Aquaculture 2016, 454, 243–251. [Google Scholar] [CrossRef]
Nieri, P.; Carpi, S.; Esposito, R.; Costantini, M.; Zupo, V. Bioactive molecules from marine diatoms and their value for the nutraceutical industry. Nutrients 2023, 15(2), 464. [Google Scholar] [CrossRef] [PubMed]
Stonik, V.A.; Stonik, I.V. Some bioactive natural products from diatoms: Structures, biosyntheses, biological roles, and properties (2015–2025). Mar. Drugs 2026, 24(1), 23. [Google Scholar] [CrossRef] [PubMed]
García-Beltrán, J.M.; Arizcun, M.; Chaves-Pozo, E. Antimicrobial Peptides from Photosynthetic Marine Organisms with Potential Application in Aquaculture. Mar. Drugs 2023, 21(5), 0290. [Google Scholar] [CrossRef] [PubMed]
Ahmad, A.W.; Hassan, S.; Banat, F. An overview of microalgae biomass as a sustainable aquaculture feed ingredient: Food security and circular economy. Bioengineered 2022, 13(4), 9521–9547. [Google Scholar] [CrossRef] [PubMed]
Zulfiqar, M.; Stettin, D.; Schmidt, S.; Nikitashina, V.; Pohnert, G.; Steinbeck, C.; Peters, K.; Sorokina, M. Untargeted metabolomics to expand the chemical space of the marine diatom Skeletonema marinoi. Front. Microbiol. 2023, 14, 1295994. [Google Scholar] [CrossRef] [PubMed]
Milito, A.; Castellano, I.; Burn, R.; Seebeck, F.P.; Brunet, C.; Palumbo, A. First evidence of ovothiol biosynthesis in marine diatoms. Free Radic. Biol. Med. 2020, 152, 680–688. [Google Scholar] [CrossRef] [PubMed]
Bérard, J.B.; Ouk, T.S.; Sol, V.; Lefoulon, L.; Landolt, C.; Grenier, K.; Saad, N.; Robert, E.; Sibat, M.; Schreiber, N.; Guenin, S.; Picot, L. Phototoxicity of the ethanolic extract of Skeletonema marinoi for the dermocosmetic improvement of acne. Mar. Drugs 2024, 22(8), 343. [Google Scholar] [CrossRef] [PubMed]
Chukwu-Osazuwa, J.; Cao, T.; Vasquez, I.; Gnanagobal, H.; Hossain, A.; Machimbirike, V. I.; Santander, J. Comparative Reverse Vaccinology of Piscirickettsia salmonis, Aeromonas salmonicida, Yersinia ruckeri, Vibrio anguillarum and Moritella viscosa, Frequent Pathogens of Atlantic Salmon and Lumpfish Aquaculture. Vaccines 2022, 10(3), 0473. [Google Scholar] [CrossRef] [PubMed]
National Research Council (NRC). Nutrient Requirements of Fish and Shrimp; The National Academies Press: Washington, DC, 2011. [Google Scholar] [CrossRef] [PubMed]
Lifgren, D.; Turner, S.M.; Welch, T.J.; Bouchard, D.; Polinski, M.P. Limited Experimental Susceptibility of Post-Smolt Atlantic salmon (Salmo salar) to an Emergent Strain of Vibrio Anguillarum Serotype O3. Aquac. J. 2024, 4(4), 0021. [Google Scholar] [CrossRef]
Habte-Tsion, H.M.; Hawkyard, M.; Sealey, W.M.; Bradshaw, D.; Meesala, K.M.; Bouchard, D.A. Effects of Fishmeal Substitution with Mealworm Meals (Tenebrio molitor and Alphitobius diaperinus) on the Growth, Physiobiochemical Response, Digesta Microbiome, and Immune Genes Expression of Atlantic Salmon (Salmo salar). Aquac. Nutr. 2024, 6618117. [Google Scholar] [CrossRef] [PubMed]
Meesala, K.-M.; Hong, J.; Sealey, W.M.; Popa, R.; Bouchard, D.A.; Habte-Tsion, M. Effects of fishmeal substitution with defatted black soldier fly larvae and soy protein meals on the growth, physio-biochemical responses, and immune-related gene expression of Atlantic salmon (Salmo salar). Aquaculture 2025, 602, 742335. [Google Scholar] [CrossRef]
Olsvik, P.A.; Torstensen, B.E.; Hemre, G.I.; Sanden, M.; Waagbø, R. Hepatic oxidative stress in Atlantic salmon (Salmo salar L.) transferred from a diet based on marine feed ingredients to a diet based on plant ingredients. Aquac. Nutr. 2011, 17, 424–436. [Google Scholar] [CrossRef]
Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2^-ΔΔCT method. Methods 2001, 25(4), 402–408. [Google Scholar] [CrossRef] [PubMed]
Johansson, O.N.; Töpel, M.; Pinder, M.I.M.; Kourtchenko, O.; Blomberg, A.; Godhe, A.; Clarke, A.K. Skeletonema marinoi as a new genetic model for marine chain-forming diatoms. Sci. Rep. 2019, 9(1), 5391. [Google Scholar] [CrossRef] [PubMed]
Putra, D.F.; Mariana; Sanani; Abidin, M.Z. Effect of Various Feeding of Live Feeds on the Growth and Survival Rate of Black Tiger Shrimp Larvae (Penaeus Monodon). In Proceedings of the 7th International Conference on Multidisciplinary Research; 2018; pp. 128–132. [Google Scholar] [CrossRef]
Yarnold, J.; Karan, H.; Oey, M.; Hankamer, B. Microalgal Aquafeeds As Part of a Circular Bioeconomy. Trends Plant Sci. 2019, 24(10), 959–970. [Google Scholar] [CrossRef] [PubMed]
Prartono, T.; Mujizat, K.; Kawaroe, M.; Katili, V. Fatty Acid Composition of Three Diatom Species Skeletonema costatum, Thalassiosira sp. and Chaetoceros gracilis. Int. J. Environ. Bioenergy 2013, 6(1), 28–43. [Google Scholar]
Dolganyuk, V.; Belova, D.; Babich, O.; Prosekov, A.; Ivanova, S.; Katserov, D.; Patyukov, N.; Sukhikh, S. Microalgae: A Promising Source of Valuable Bioproducts. Biomolecules 2020, 10(8), 1153. [Google Scholar] [CrossRef] [PubMed]
Sørensen, M.; Berge, G.; Reitan, K.; Ruyter, B. Microalga Phaeodactylum tricornutum in feed for Atlantic salmon (Salmo salar) -Effect on nutrient digestibility, growth and utilization of feed. Aquaculture 2016, 460, 116–123. [Google Scholar] [CrossRef]
Eilertsen, H.C.; Elvevoll, E.; Giæver, I.H.; Svenning, J.B.; Dalheim, L.; Svalheim, R.A.; Vang, B.; Siikavuopio, S.; Dragøy, R.; Ingebrigtsen, R.A.; Hansen, E.; Hustad, A.; Eilertsen, K.E. Inclusion of photoautotrophic cultivated diatom biomass in salmon feed can deter lice. PLoS ONE 2021, 16, 0255370. [Google Scholar] [CrossRef] [PubMed]
Huervana, F.H.; Dionela, C.S.; De La Torre, E.D.S.; Del Castillo, C.S.; Traifalgar, R.F.M. Utilization of marine diatom Thalassiosira weissflogii as a feed additive in seawater-tolerant Nile tilapia (Oreochromis niloticus, Linnaeus 1758) strain. Front. Sustain. Food Syst. 2022, 6, 1052951. [Google Scholar] [CrossRef]
Teixeira, C.; Peixoto, D.; Hinzmann, M.; Santos, P.; Ferreira, I.; Pereira, G.V.; Dias, J.; Costas, B. Dietary Strategies to Modulate the Health Condition and Immune Responses in Gilthead Seabream (Sparus aurata) Juveniles Following Intestinal Inflammation. Animals 2022, 12, 12213019. [Google Scholar] [CrossRef] [PubMed]
Kiron, V.; Phromkunthong, W.; Huntley, M.; Archibald, I.; De Scheemaker, G. Marine microalgae from biorefinery as a potential feed protein source for Atlantic salmon, common carp and whiteleg shrimp. Aquac. Nutr. 2012, 18(5), 521–531. [Google Scholar] [CrossRef]
Savova, M.; Kirev, T. Alkaline phosphatase activity in serum of guinea fowl bearing bone tumours induced by osteopetrosis virus strain PTS-56. Avian Pathol. 1992, 21(4), 667–673. [Google Scholar] [CrossRef] [PubMed]
Molina, R.; Moreno, I.; Pichardo, S.; Jos, A.; Moyano, R.; Monterde, J.G.; Cameán, A. Acid and alkaline phosphatase activities and pathological changes induced in Tilapia fish (Oreochromis sp.) exposed subchronically to microcystins from toxic cyanobacterial blooms under laboratory conditions. Toxicon Off. J. Int. Soc. Toxinology 2005, 46(7), 725–735. [Google Scholar] [CrossRef] [PubMed]
Xia, H.; Tang, Y.; Lu, F.; Luo, Y.; Yang, P.; Wang, W.; Jiang, J.; Li, N.; Han, Q.; Liu, F.; Liu, L. The effect of Aeromonas hydrophila infection on the non-specific immunity of blunt snout bream (Megalobrama amblycephala). Cent.-Eur. J. Immunol. 2017, 42(3), 239–243. [Google Scholar] [CrossRef] [PubMed]
Bag, M.R.; Makesh, M.; Rajendran, K.V.; Mukherjee, S.C. Characterization of IgM of Indian major carps and their cross-reactivity with anti-fish IgM antibodies. Fish. Shellfish Immunol. 2009, 26(2), 275–278. [Google Scholar] [CrossRef] [PubMed]
Wu, L.; Yang, Y.; Gao, A.; Li, J.; Ye, J. Teleost fish IgM⁺ plasma-like cells possess IgM-secreting, phagocytic, and antigen-presenting capacities. Front. Immunol. 2022, 13, 1016974. [Google Scholar] [CrossRef] [PubMed]
Jung, M.H.; Park, C.S.; Kole, S.; Ryu, J.W.; Jung, S.J. Water temperature and immunization period required to establish immunity against the viral hemorrhagic septicemia virus vaccine in olive flounder (Paralichthys olivaceus). Aquaculture 2024, 591, 741118. [Google Scholar] [CrossRef]
Bayir, A.; Sirkecioglu, A.N.; Bayir, M.; Haliloglu, H.I.; Kocaman, E.M.; Aras, N.M. Metabolic responses to prolonged starvation, food restriction, and refeeding in the brown trout, Salmo trutta: Oxidative stress and antioxidant defenses. Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2011, 159(4), 191–196. [Google Scholar] [CrossRef] [PubMed]
Liu, Y.; Han, S.L.; Luo, Y.; Li, L.Y.; Chen, L.Q.; Zhang, M.L.; Du, Z.Y. Impaired peroxisomal fat oxidation induces hepatic lipid accumulation and oxidative damage in Nile tilapia. Fish. Physiol. Biochem. 2020, 46(4), 1229–1242. [Google Scholar] [CrossRef] [PubMed]
Habte-Tsion, H.-M.; Kolimadu, G.D.; Rossi, W., Jr.; Filer, K.; Kumar, V. Effects of Schizochytrium and micro-minerals on the immune, antioxidant, inflammatory, and lipid-metabolism status of Micropterus salmoides fed high- and low-fishmeal diets. Sci. Rep. 2020, 10, 7457. [Google Scholar] [CrossRef] [PubMed]
Fan, J.; Zhang, Y.; Zhou, H.; Liu, Y.; Cao, Y.; Dou, X.; Fu, X.; Deng, J.; Tan, B. Dietary Malondialdehyde Damage to the Growth Performance and Digestive Function of Hybrid Grouper (Epinephelus fuscoguttatus♀ × E. lanceolatu♂). Animals 2023, 13(19), 3145. [Google Scholar] [CrossRef] [PubMed]
Song, C.; Liu, B.; Li, H.; Tang, Y.; Ge, X.; Liu, B.; Xu, P. Protective Effects of Emodin on Oxidized Fish Oil-Induced Metabolic Disorder and Oxidative Stress through Notch-Nrf2 Crosstalk in the Liver of Teleost Megalobrama amblycephala. Antioxidants 2022, 11(6), 11061179. [Google Scholar] [CrossRef] [PubMed]
Adel, M.; Yeganeh, S.; Dadar, M.; Sakai, M.; Dawood, M.A.O. Effects of dietary Spirulina platensis on growth performance, humoral and mucosal immune responses and disease resistance in juvenile great sturgeon (Huso huso Linnaeus, 1754). Fish. Shellfish Immunol. 2016, 56, 436–444. [Google Scholar] [CrossRef] [PubMed]
Ibrahim, H.A.; Reda, R.M.; Galal, A.A.A.; Mahmoud, S.H.; Abdallah, S.H. Efficacy of Amphora coffeaeformis supplemented diets in improving growth performance, health status, and resistance to Aeromonas sobria in Oreochromis niloticus exposed to suboptimal temperature conditions. J. Appl. Phycol. 2025, 37, 1041–1057. [Google Scholar] [CrossRef]
Marques, A.E.M.L.; Balen, R.E.; da Silva Pereira Fernandes, L.; Motta, C.M.; de Assis, H.C.S.; Taher, D.M.; Meurer, F.; Vargas, J.V.C.; Mariano, A.B.; Cestari, M.M. Diets containing residual microalgae biomass protect fishes against oxidative stress and DNA damage. J. Appl. Phycol. 2019, 31(5), 2933–2940. [Google Scholar] [CrossRef]
Vignaud, J.; Loiseau, C.; Hérault, J.; Mayer, C.; Côme, M.; Martin, I.; Ulmann, L. Microalgae Produce Antioxidant Molecules with Potential Preventive Effects on Mitochondrial Functions and Skeletal Muscular Oxidative Stress. Antioxidants 2023, 12(5), 1050. [Google Scholar] [CrossRef] [PubMed]
Habte-Tsion, H.M. A review on fish immuno-nutritional response to indispensable amino acids in relation to TOR, NF-κB and Nrf2 signaling pathways: Trends and prospects. Comp. Biochem. Physiol. Part B. 2020, 241, 110389. [Google Scholar] [CrossRef] [PubMed]
Zheng, M.; Liu, Y.; Zhang, G.; Yang, Z.; Xu, W.; Chen, Q. The Applications and Mechanisms of Superoxide Dismutase in Medicine, Food, and Cosmetics. Antioxidants 2023, 12(9), 1675. [Google Scholar] [CrossRef] [PubMed]
Reis, B.; Gonçalves, A.T.; Santos, P.; Sardinha, M.; Conceição, L.E.C.; Serradeiro, R.; Pérez-sánchez, J.; Calduch-giner, J.; Schmid-staiger, U.; Frick, K.; Dias, J.; Costas, B. Immune status and hepatic antioxidant capacity of gilthead seabream Sparus aurata juveniles fed yeast and microalga derived β-glucans. Mar. Drugs 2021, 19(12), 19120653. [Google Scholar] [CrossRef] [PubMed]
Gong, S.; Ruprecht, R.M. Immunoglobulin M: An Ancient Antiviral Weapon – Rediscovered. Front. Immunol. 2020, 11, 01943. [Google Scholar] [CrossRef] [PubMed]
Smerilli, A.; Balzano, S.; Maselli, M.; Blasio, M.; Orefice, I.; Galasso, C.; Sansone, C.; Brunet, C. Antioxidant and Photoprotection Networking in the Coastal Diatom Skeletonema marinoi. Antioxidants 2019, 8(6), 8060154. [Google Scholar] [CrossRef] [PubMed]
Mueller, J.; Pauly, M.; Molkentin, J.; Ostermeyer, U.; van Muilekom, D.R.; Rebl, A.; Goldammer, T.; Lindemeyer, J.; Schultheiß, T.; Seibel, H.; Schulz, C. Microalgae as functional feed for Atlantic salmon: effects on growth, health, immunity, muscle fatty acid and pigment deposition. Front. Mar. Sci. 2023, 10, 1273614. [Google Scholar] [CrossRef]
Bhattacharjya, R.; Kiran Marella, T.; Tiwari, A.; Saxena, A.; Kumar Singh, P.; Mishra, B. Bioprospecting of marine diatoms Thalassiosira, Skeletonema and Chaetoceros for lipids and other value-added products. Bioresour. Technol. 2020, 318, 124073. [Google Scholar] [CrossRef] [PubMed]

Figure 1. Effect of dietary Skeletonema marinoi on the plasma alkaline phosphatase (ALP) activity of Atlantic salmon, before and after bacterial challenge with Vibrio anguillarum SO3 (5-, 10-, and 27-days post-challenge) (A). Effect of time within each dietary group on the plasma ALP of Atlantic salmon before and after bacterial challenge (B). Values are means with standard errors represented by vertical bars. Sample size: three tanks per treatment (n=3) and six sub-samples per tank. Mean values with different letters are significantly different (P<0.05).

Figure 2. Effect of dietary Skeletonema marinoi on the plasma immunoglobulin M (IgM) level of Atlantic salmon, before and after bacterial challenge with Vibrio anguillarum SO3 (5-, 10-, and 27-days post-challenge) (A). The effect of time within each diet group on the plasma IgM of Atlantic salmon before and after bacterial challenge (B). Values are means with standard errors represented by vertical bars. Sample size: three tanks per treatment (n=3) and six sub-samples per tank. Asterisk (*) indicates a significant difference at P < 0.05. Mean values with different letters are significantly different (P < 0.05).

Figure 3. The effect of dietary Skeletonema marinoi on the liver malondialdehyde (MDA) content of Atlantic salmon before and after bacterial challenge with Vibrio anguillarum SO3 (5-, 10-, and 27-days post-challenge). Sample size: three tanks per treatment (n=3) and six sub-samples per tank. Mean value with an asterisk (*) is significantly different (P<0.05).

Figure 4. The effect of dietary Skeletonema marinoi on the liver superoxide dismutase (SOD) activity of Atlantic salmon before and after bacterial challenge with Vibrio anguillarum SO3 (5-, 10-, and 27-days post-challenge). Sample size: three tanks per treatment (n=3) and four sub-samples per tank. Mean value with an asterisk (*) is significantly different (P<0.05).

Figure 5. The effect of dietary Skeletonema marinoi on the relative gene expression of immunoglobulin M (IgM) in the intestine of Atlantic salmon, before and after bacterial challenge with Vibrio anguillarum SO3 (5-, 10-, and 27-days post-challenge) (A). The effect of time within each dietary group on the intestinal IgM gene expression of Atlantic salmon before and after bacterial challenge (B). Values are means with standard errors represented by vertical bars. Sample size: three tanks per treatment (n=3) and six sub-samples per tank. Asterisk (*) indicates a significant difference at P < 0.05. Mean values with different letters are significantly different (P<0.05).

Table 1. Experimental formulations for reference and 0.5% S. marinoi diets.

Ingredient index	% of diet dry
	Control	Marine Diatom
Fishmeal	21.00	21.00
Skeletonema marinoi	0.00	0.50
Wheat flour	21.39	20.89
Fish oil	19.00	19.00
Poultry by-product meal	16.00	16.00
Squid meal	7.00	7.00
Corn protein concentrate	6.00	6.00
Monocalcium phosphate	3.00	3.00
Lysine HCl	1.20	1.20
Lecithin	1.00	1.00
Vitamin premix ARS 702*	1.00	1.00
Choline Cl 50%	1.00	1.00
Potassium chloride	0.56	0.56
Taurine	0.50	0.50
Threonine	0.30	0.30
NaCl	0.28	0.28
DL-Methionine	0.20	0.20
Stay-C 35	0.20	0.20
Calcium proprionate	0.15	0.15
Trace mineral premix ARS 1440*	0.10	0.10
Magnesium oxide	0.06	0.06
Astaxanthin	0.06	0.06
Sum with oil:	100.00	100.00

*ARS702 contributed, per kg diet; vitamin A 9650 IU; vitamin D 6600 IU; vitamin E 132 IU; vitamin K3 1.1 g: thiamin mononitrate 9.1 mg; riboflavin 9.6 mg; pyridoxine hydrochloride 13.7 mg; pantothenate DL-calcium 46.5; cyancobalamin 0.03 mg; nicotinic acid 21.8 mg; biotin 0.34 mg; folic acid 2.5; inostitol 600. Produced by Star Milling Perris, Ca. TM ARS 1440 contributed in mg/kg of diet; zinc 40; manganese 13; iodine 5; copper 9. Produced by Star Milling Perris, Ca.

Table 2. Growth performance, feed utilization, and condition indices of Atlantic salmon fed with the reference and 0.5% S. marinoi diets for 16 weeks.

Growth parameters	Reference diet	0.5% S. marinoi diet	P-values
Initial weight (g)	59.50 ± 1.60	60.30 ± 2.90
Survival (%)	96.00 ± 2.40	98.00 ± 2.00	0.648
Final weight (g)	170.40 ± 4.00	166.10 ± 6.30	0.582
Weight gain (%)	175.20 ± 7.20	170.20 ± 5.20	0.507
Feed intake (g/fish/day)	0.98 ± 0.03	1.00 ± 0.05	0.744
Feed efficiency	0.99 ± 0.03	0.94 ± 0.01	0.111
K – factor (%)	0.93 ± 0.01	0.91 ± 0.01	0.075
HSI (%)	1.28± 0.10	1.55± 0.10	0.381

Table 3. Liver lipid peroxidation and antioxidant activity, and intestinal IgM gene expression of Atlantic salmon fed with reference and 0.5% S. marinoi diets for 16 weeks.

Parameters	Reference diet	0.5% S. marinoi diet	P-values
MDA (nmol/ mg)	4.04 ± 0.27	4.64 ± 0.35	0.499
SOD (U/ mg)	1.68 ± 0.02	1.64 ± 0.03	0.856
IgM expression (fold changes)	2.79 ± 0.12	3.02 ± 0.27	0.435

MDA, malondialdehyde; SOD, superoxide dismutase; IgM, immunoglobulin M. Mean values (n=5) are presented as mean ± SE. Mean values within a row with different superscript letters were significantly different (P<0.05).

Table 4. The interactive effects of dietary treatments and time on biochemical and immunological parameters of Atlantic salmon before and post-bacterial challenge with Vibrio anguillarum SO3.

Diets	Time (Days)	Plasma ALP activity (U/L)	Plasma IgM level (μg/mL)	Liver MDA content (nmol/mg)	Liver SOD activity (U/ mL)
Reference diet	Before challenge	88.07 ± 28.49^b	299.34 ± 26.11^c	38.97 ± 3.9	3.04 ± 0.19^B
	5-day post challenge	247.54 ± 52.35^a	327.22 ± 32.92^b	28.77 ± 1.7^B	3.12 ± 0.09
	10-day post challenge	114.41 ± 11.93^ab	620.92 ± 104.62^ab	36.87 ± 1.3	3.14 ± 0.09
	27-day post challenge	194.01 ± 6.1^ab	678.69 ± 126.39^aB	37.36 ± 1.5	2.92 ± 0.12
0.5% S. marinoi diet	Before challenge	94.71 ± 44.77	271.01 ± 26.11^c	35.06 ± 3.1	3.26 ± 0.06 ^aA
	5-day post challenge	187.37 ± 48.91	347.58 ± 36.13^b	39.30 ± 2.7^A	3.10 ±0.13 ^ab
	10-day post challenge	181.94 ± 35.28	579.53 ± 39.07^b	33.80 ± 2.0	3.01 ± 0.06 ^b
	27-day post challenge	185.44 ± 30.48	1050.95 ± 49 ^aA	34.68 ± 1.6	3.09 ± 0.15^ab
Two-way repeated measures ANOVA (P value)
Diet		0.964	0.219	0.900	0.174
Time		0.027	<0.001	0.646	0.161
Diet x Time		0.072	< 0.001	0.013	0.028

ALP, alkaline phosphatase; IgM, immunoglobulin M; MDA, malondialdehyde; SOD, superoxide dismutase. Mean values (n=3) are presented as mean ± SE. Mean values within a column with different lowercase superscript letters indicate significant differences among sampling times within the same diet, whereas uppercase superscript letters indicate significant differences between dietary treatments at the same sampling time (P < 0.05).

Table 5. The interactive effect of dietary treatments and time on the intestinal IgM gene expression of Atlantic salmon before and post-bacterial challenge with Vibrio anguillarum SO3.

Diets	Time (Days)	IgMgene expression (fold changes)
Reference diet	Before challenge	1.39 ± 0.2^ab
	5-day post challenge	2.09 ± 0.5^ab
	10-day post challenge	2.54 ± 0.3^a
	27-day post challenge	1.33 ± 0.2^bB
0.5% S. marinoi diet	Before challenge	1.96 ± 0.5
	5-day post challenge	2.69 ± 0.6
	10-day post challenge	2.52 ± 0.5
	27-day post challenge	2.63± 0.2^A
Two-way repeated measures ANOVA (P value)
Diet		0.093
Time		0.071
Diet x Time		< 0.001

IgM, immunoglobulin M. Mean values (n=3) are presented as mean ± SE. Mean values within a column with different lowercase superscript letters indicate significant differences among sampling times within the same dietary treatment, whereas uppercase superscript letters indicate significant differences between dietary treatments at the same sampling time (P < 0.05).

Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).

Copyright: This open access article is published under a Creative Commons CC BY 4.0 license, which permit the free download, distribution, and reuse, provided that the author and preprint are cited in any reuse.

Immunogenicity and Growth Response of Atlantic Salmon to Dietary Inclusion of Marine Diatom, Skeletonema marinoi