Submitted:
08 June 2026
Posted:
10 June 2026
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Materials and Methods
2.2. Specimen and Data Collection
2.3. Parasite Processing and Tissue Sampling
2.4. Molecular Analyses
2.5. Sequencing and Data Analysis
3. Results
2.6. Morphological and Diagnostic Findings
2.7. Molecular and Phylogenetic Analyses
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Giarratana, F.; Panebianco, F.; Muscolino, D.; Beninati, C.; Ziino, G.; Giuffrida, A. Effect of Allyl Isothiocyanate against Anisakis Larvae during the Anchovy Marinating Process. J. Food Prot. 2015, 78, 767–771. [Google Scholar] [CrossRef] [PubMed]
- Santoro, M.; Marchiori, E.; Iaccarino, D.; Uberti, B.D.; Cassini, R.; Di Nocera, F.; Cerrone, A.; Galiero, G.; Marcer, F. Epidemiology of Sulcascaris Sulcata (Nematoda: Anisakidae) Ulcerous Gastritis in the Mediterranean Loggerhead Sea Turtle (Caretta Caretta). Parasitol. Res. 2019, 118, 1457–1463. [Google Scholar] [CrossRef] [PubMed]
- Sata, N.; Nakano, T. Molecular Analysis of Larvae Suggests the Existence of a Second Species of Sulcascaris (Nematoda: Anisakidae: Anisakinae) in the Japanese Moon Scallop (Ylistrum Japonicum) from Japanese Waters. Parasitol. Int. 2023, 92, 102674. [Google Scholar] [CrossRef] [PubMed]
- Sprent, J.F.A. Ascaridoid Nematodes of Amphibians and Reptiles: Sulcascaris. J. Helminthol. 1977, 51, 379–387. [Google Scholar] [CrossRef]
- Lichtenfels, J.R.; Bier, J.W.; Madden, P.A. Larval Anisakid (Sulcascaris) Nematodes from Atlantic Molluscs with Marine Turtles as Definitive Hosts. Trans. Am. Microsc. Soc. 1978, 97, 199. [Google Scholar] [CrossRef] [PubMed]
- Greiner, E. Parasites of Marine Turtles; 2013; pp. 427–446. ISBN 978-1-4398-7307-6. [Google Scholar]
- Margaritoulis, D.; Argano, R.; Baran, I.; Bentivegna, F.; Bradai, M.; Camiñas, J.; Casale, P.; Metrio, G.; Demetropoulos, A.; Gerosa, G. Loggerhead Turtles in the Mediterranean Sea: Present Knowledge and Conservation Perspectives. In Loggerhead Sea Turtles; Bolten, A.B., Witherington, B.E., Eds.; Smithsonian Institution Press: Washington DC, 2003; pp. 175–198. [Google Scholar]
- Marcer, F.; Tosi, F.; Franzo, G.; Vetri, A.; Ravagnan, S.; Santoro, M.; Marchiori, E. Updates on Ecology and Life Cycle of Sulcascaris Sulcata (Nematoda: Anisakidae) in Mediterranean Grounds: Molecular Identification of Larvae Infecting Edible Scallops. Front. Vet. Sci. 2020, 7, 64. [Google Scholar] [CrossRef] [PubMed]
- Berry, G.; Cannon, L. The Life History of Sulcascaris Sulcata (Nematoda: Ascaridoidea), a Parasite of Marine Molluscs and Turtles. Int. J. Parasitol. 1981, 11, 43–54. [Google Scholar] [CrossRef]
- Mattiucci, S.; Cipriani, P.; Levsen, A.; Paoletti, M.; Nascetti, G. Molecular Epidemiology of Anisakis and Anisakiasis: An Ecological and Evolutionary Road Map. In Advances in Parasitology; Elsevier, 2018; Vol. 99, pp. 93–263. ISBN 978-0-12-815192-1. [Google Scholar]
- Galadima Dagona, A. BioEdit: A User-Friendly Biological Sequence Alignment Editor and Analysis Program for Windows 95/98/NT. Nucleic Acids Symposium Series. 1999, 1999. [Google Scholar]
- Available online: https://Www.Ncbi.Nlm.Nih.Gov/Nuccore/?Term=sulcascaris+sulcata (accessed on 02/25/26).
- Available online: http://Iqtree.Cibiv.Univie.Ac.at/ (accessed on 02/25/2026).
- Trifinopoulos, J.; Nguyen, L.-T.; von Haeseler, A.; Minh, B.Q. W-IQ-TREE: A Fast Online Phylogenetic Tool for Maximum Likelihood Analysis. Nucleic Acids Res. 2016, 44, W232–235. [Google Scholar] [CrossRef] [PubMed]
- Available online: https://Itol.Embl.de/ (accessed on 08/04/2026).
- Gentile, A.; Amato, T.; Gustinelli, A.; Fioravanti, M.L.; Gambino, D.; Randazzo, V.; Caracappa, G.; Vicari, D.; Arculeo, M. Helminth Infection of the Loggerhead Sea Turtle Caretta Caretta along the Coasts of Sicily and the North West Adriatic Sea. Animals 2021, 11, 1408. [Google Scholar] [CrossRef] [PubMed]
- Marangi, M.; Carlino, P.; Profico, C.; Olivieri, V.; Totaro, G.; Furii, G.; Marzano, G.; Papini, R.A. First Multicenter Coprological Survey on Helminth Parasite Communities of Free-Living Loggerhead Sea Turtles Caretta Caretta (Linnaeus, 1758) from the Adriatic Sea and Northern Ionian Sea. Int. J. Parasitol. Parasites Wildl. 2020, 11, 207–212. [Google Scholar] [CrossRef] [PubMed]
- Gračan, R.; Buršic, M.; Mladineo, I.; Kučinic, M.; Lazar, B.; Lackovic, G. Gastrointestinal Helminth Community of Loggerhead Sea Turtle Caretta Caretta in the Adriatic Sea. Dis. Aquat. Org. 2012, 99, 227–236. [Google Scholar] [CrossRef] [PubMed]
- Manfredi, M.T.; Piccolo, G.; Meotti, C. Parasites of Italian Sea Turtles. II. Loggerhead Turtles (Caretta Caretta [Linnaeus, 1758]). Parassitologia 1998, 40, 305–308. [Google Scholar] [PubMed]
- Santoro, M.; Marchiori, E.; Palomba, M.; Degli Uberti, B.; Marcer, F.; Mattiucci, S. The Mediterranean Mussel (Mytilus Galloprovincialis) as Intermediate Host for the Anisakid Sulcascaris Sulcata (Nematoda), a Pathogen Parasite of the Mediterranean Loggerhead Turtle (Caretta Caretta). Pathogens 2020, 9, 118. [Google Scholar] [CrossRef] [PubMed]
- Di Renzo, L.; Mariani, G.; Matiddi, M.; Silvestri, C.; Chiesa, S.; Petochi, T.; Marino, G.; Pizzurro, F.; Fazio, S.; Rossi, E.; et al. First Survey on Sea Turtles’ Interactions in Mussel Farms in Italy. Animals 2025, 15, 2909. [Google Scholar] [CrossRef] [PubMed]
- Lazar, B.; Gračan, R.; Katić, J.; Zavodnik, D.; Jaklin, A.; Tvrtković, N. Loggerhead Sea Turtles ( Caretta Caretta ) as Bioturbators in Neritic Habitats: An Insight through the Analysis of Benthic Molluscs in the Diet. Mar. Ecol. 2011, 32, 65–74. [Google Scholar] [CrossRef]
- Casale, P.; Margaritoulis, D. Sea Turtles in the Mediterranean: Distribution, Threats and Conservation Priorities; 2010; ISBN ISBN 978-2-8317-1240-6. [Google Scholar]






| Name | Target region | Sequence (3’-5’) | Size | Reference |
| JB3_Forward | MT-CO1 | TTTTTTGGGCATCCTGAGGTTTAT | 710 | [8] |
| JB4_Reverse | TAAAGAAGAACATAATGAAAATG | |||
| 211 Forward | MT-CO2 | TTTTCTAGTTATATAGATTGRTTYAT | 610 | |
| 210 Reverse | CACCAACTCTTAAAATTATC |
| ID |
Weight kg |
CCLn-t cm |
Gender | Site coordinates | Municipality | Year |
| CcIZSPB_1 | 45,7 | 73,5 | female | 41.45171,16.23941 | Mattinata (FG) | 2024 |
| CcIZSPB_2 | 40 | 69 | female | 40.45913, 17.24854 | Taranto (TA) | 2023 |
| CcIZSPB_3 | 25 | 62 | female | 41.19340, 16.67986 | Giovinazzo (BA) | 2024 |
| CcIZSPB_4 | 39,6 | 79 | female | 41.15343, 16.80242 | Bari (BA) | 2023 |
| CcIZSPB_5 | 48 | 74 | female | 41.60360, 15.89706 | Siponto (FG) | 2022 |
| CcIZSPB_6 | 26 | 56 | female | 41.65992, 16.61517 | Manfredonia (FG) | 2023 |
| CcIZSPB_7 | 18,6 | 54,5 | female | 41.57685, 16.18116 | Zapponeta (FG) | 2024 |
| CcIZSPB_8 | 42 | 71,5 | female | 41.52217, 16.21538 | Margherita di Savoia (BAT) | 2024 |
| CcIZSPB_9 | 55,2 | 79 | female | 41.38428, 16.14100 | Margherita di Savoia (BAT) | 2024 |
| CcIZSPB_10 | 47,2 | 72 | female | 41.52927, 16.41677 | Bisceglie (BAT) | 2024 |
| CcIZSPB_11 | 27,7 | 62 | female | 41.43855, 16.02186 | Margherita di Savoia (BAT) | 2024 |
| CcIZSPB_12 | 48,6 | 74 | female | 41.18271, 16.68226 | Giovinazzo (BA) | 2024 |
| CcIZSPB_13 | 28,7 | 60 | female | 41.35400, 16.44775 | Margherita di Savoia (BAT) | 2024 |
| CcIZSUM_1 | n/a* | 65 | female | 43.84554, 13.02786 | Fano (PU) | 2024 |
| CcIZSUM_2 | n/a* | 40 | n/a* | 43.90466, 12.93360 | Pesaro (PU) | 2022 |
| CcIZSUM_3 | n/a* | 79 | female | 43.78662, 13.11461 | Fano (PU) | 2021 |
| CcIZSUM_4 | n/a* | 70 | female | 43.84472, 13.07608 | Fano (PU) | 2020 |
| CcIZSUM_5 | n/a* | 40 | n/a* | 43.84333, 13.04239 | Fano (PU) | 2020 |
| CcIZSUM_6 | n/a* | 58 | male | 43.92434, 12.90775 | Pesaro (PU) | 2023 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).