Submitted:
14 May 2026
Posted:
15 May 2026
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Materials and Methods
2.1. Bacterial Isolates
2.2. Multiplex PCR-Based Identification of S. argenteus
2.3. MALDI-TOF MS Analysis
2.3.1. Development
2.3.2. Validation
2.3.3. Application
2.4. Phylogenetic Typing
2.4.1. Multilocus Sequence Typing (MLST)
2.4.2. Pulsed-Field Gel Electrophoresis (PFGE)
3. Results
3.1. MALDI-TOF MS Identification Model: Development
3.2. MALDI-TOF MS Identification Model: Validation
3.3. MALDI-TOF MS Identification Model: Clinical Application
3.4. MLST Analysis of S. argenteus
4. Discussion
5. Conclusion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- McDonald, M.; Dougall, A.; Holt, D.; Huygens, F.; Oppedisano, F.; Giffard, P.M.; Inman-Bamber, J.; Stephens, A.J.; Towers, R.; Carapetis, J.R. Use of a single-nucleotide polymorphism genotyping system to demonstrate the unique epidemiology of methicillin-resistant Staphylococcus aureus in remote aboriginal communities. J. Clin. Microbiol. 2006, 44, 3720–3727. [Google Scholar] [CrossRef]
- Ng, J.W.; Holt, D.C.; Lilliebridge, R.A.; Stephens, A.J.; Huygens, F.; Tong, S.Y.; Currie, B.J.; Giffard, P.M. Phylogenetically distinct Staphylococcus aureus lineage prevalent among indigenous communities in northern Australia. J. Clin. Microbiol. 2009, 47, 2295–2300. [Google Scholar] [CrossRef]
- Ruimy, R.; Armand-Lefevre, L.; Barbier, F.; Ruppé, E.; Cocojaru, R.; Mesli, Y.; Maiga, A.; Benkalfat, M.; Benchouk, S.; Hassaine, H. Comparisons between geographically diverse samples of carried Staphylococcus aureus. J. Bacteriol. 2009, 191, 5577–5583. [Google Scholar] [CrossRef]
- Tong, S.Y.; Lilliebridge, R.A.; Bishop, E.J.; Cheng, A.C.; Holt, D.C.; McDonald, M.I.; Giffard, P.M.; Currie, B.J.; Boutlis, C.S. Clinical correlates of Panton-Valentine leukocidin (PVL), PVL isoforms, and clonal complex in the Staphylococcus aureus population of Northern Australia. J. Infect. Dis. 2010, 202, 760–769. [Google Scholar] [CrossRef]
- Tong, S.Y.; Schaumburg, F.; Ellington, M.J.; Corander, J.; Pichon, B.; Leendertz, F.; Bentley, S.D.; Parkhill, J.; Holt, D.C.; Peters, G. Novel staphylococcal species that form part of a Staphylococcus aureus-related complex: the non-pigmented Staphylococcus argenteus sp. nov. and the non-human primate-associated Staphylococcus schweitzeri sp. nov. Int. J. Syst. Evol. Microbiol. 2015, 65, 15–22. [Google Scholar] [CrossRef]
- Akoua-Koffi, C.; Kacou N’Douba, A.; Djaman, J.A.; Herrmann, M.; Schaumburg, F.; Niemann, S. Staphylococcus schweitzeri—An Emerging One Health Pathogen? Microorganisms 2022, 10, 770. [Google Scholar] [CrossRef]
- Chen, S.-Y.; Lee, H.; Wang, X.-M.; Lee, T.-F.; Liao, C.-H.; Teng, L.-J.; Hsueh, P.-R. High mortality impact of Staphylococcus argenteus on patients with community-onset staphylococcal bacteraemia. Int. J. Antimicrob. Agents 2018, 52, 747–753. [Google Scholar] [CrossRef]
- Zhang, D.-F.; Xu, X.; Song, Q.; Bai, Y.; Zhang, Y.; Song, M.; Shi, C.; Shi, X. Identification of Staphylococcus argenteus in Eastern China based on a nonribosomal peptide synthetase (NRPS) gene. Future Microbiol. 2016, 11, 1113–1121. [Google Scholar] [CrossRef]
- Thaipadungpanit, J.; Amornchai, P.; Nickerson, E.K.; Wongsuvan, G.; Wuthiekanun, V.; Limmathurotsakul, D.; Peacock, S.J. Clinical and molecular epidemiology of Staphylococcus argenteus infections in Thailand. J. Clin. Microbiol. 2015, 53, 1005–1008. [Google Scholar] [CrossRef]
- Hansen, T.A.; Bartels, M.D.; Høgh, S.V.; Dons, L.E.; Pedersen, M.; Jensen, T.G.; Kemp, M.; Skov, M.N.; Gumpert, H.; Worning, P. Whole genome sequencing of Danish Staphylococcus argenteus reveals a genetically diverse collection with clear separation from Staphylococcus aureus. Front. Microbiol. 2017, 8, 1512. [Google Scholar] [CrossRef]
- Kitagawa, H.; Ohge, H.; Hisatsune, J.; Masuda, K.; Aziz, F.; Hara, T.; Kuroo, Y.; Sugai, M. Low incidence of Staphylococcus argenteus bacteremia in Hiroshima, Japan. J. Infect. Chemother. 2020, 26, 140–143. [Google Scholar] [CrossRef]
- Chen, S.-Y.; Lee, H.; Teng, S.-H.; Wang, X.-M.; Lee, T.-F.; Huang, Y.-C.; Liao, C.-H.; Teng, L.-J.; Hsueh, P.-R. Accurate differentiation of novel Staphylococcus argenteus from Staphylococcus aureus using MALDI-TOF MS. Future Microbiol. 2018, 13, 997–1006. [Google Scholar] [CrossRef]
- Holt, D.C.; Holden, M.T.; Tong, S.Y.; Castillo-Ramirez, S.; Clarke, L.; Quail, M.A.; Currie, B.J.; Parkhill, J.; Bentley, S.D.; Feil, E.J. A very early-branching Staphylococcus aureus lineage lacking the carotenoid pigment staphyloxanthin. Genome Biol. Evol. 2011, 3, 881–895. [Google Scholar] [CrossRef] [PubMed]
- Eshaghi, A.; Bommersbach, C.; Zittermann, S.; Burnham, C.-A.D.; Patel, R.; Schuetz, A.N.; Patel, S.N.; Kus, J.V. Phenotypic and genomic profiling of Staphylococcus argenteus in Canada and the United States and recommendations for clinical result reporting. J. Clin. Microbiol. 2021, 59. [Google Scholar] [CrossRef]
- Wang, H.-Y.; Chung, C.-R.; Tseng, Y.-J.; Yu, J.-R.; Chen, C.-J.; Wu, M.-H.; Lin, T.-W.; Huang, W.-T.; Liu, T.-P.; Lee, T.-Y. Extensive validation and prospective observation of the impact of an AI-based rapid antibiotics susceptibility prediction platform in multiple medical centers. medRxiv 2021, 2021.2006. 2023.21259391.
- Yu, J.-R.; Chen, C.-H.; Huang, T.-W.; Lu, J.-J.; Chung, C.-R.; Lin, T.-W.; Wu, M.-H.; Tseng, Y.-J.; Wang, H.-Y. Energy efficiency of inference algorithms for clinical laboratory data sets: green artificial intelligence study. J. Med. Internet Res. 2022, 24, e28036. [Google Scholar] [CrossRef]
- Chantratita, N.; Wikraiphat, C.; Tandhavanant, S.; Wongsuvan, G.; Ariyaprasert, P.; Suntornsut, P.; Thaipadungpanit, J.; Teerawattanasook, N.; Jutrakul, Y.; Srisurat, N. Comparison of community-onset Staphylococcus argenteus and Staphylococcus aureus sepsis in Thailand: a prospective multicentre observational study. Clin. Microbiol. Infect. 2016, 22, 458. e411–458. e419. [Google Scholar] [CrossRef]
- Rong, D.; Liu, Z.; Huang, J.; Zhang, F.; Wu, Q.; Dai, J.; Li, Y.; Zhao, M.; Li, Q.; Zhang, J. Prevalence and characterization of Staphylococcus aureus and Staphylococcus argenteus isolated from rice and flour products in Guangdong, China. Int. J. Food Microbiol. 2023, 406, 110348. [Google Scholar] [CrossRef]
- Hao, S.; Abdelghany, M.; Lyden, A.; Sit, R.; Tan, M.; Tato, C.M.; DeRisi, J.L.; Miller, S.; Doernberg, S.B.; Langelier, C. Genomic profiling of evolving daptomycin resistance in a patient with recurrent Staphylococcus argenteus sepsis. Antimicrob. Agents Chemother. 2020, 64. [Google Scholar] [CrossRef]
- Huang, C.-H.; Huang, L. Rapid species-and subspecies-specific level classification and identification of Lactobacillus casei group members using MALDI Biotyper combined with ClinProTools. J. Dairy Sci. 2018, 101, 979–991. [Google Scholar] [CrossRef]
- Wang, H.-Y.; Lien, F.; Liu, T.-P.; Chen, C.-H.; Chen, C.-J.; Lu, J.-J. Application of a MALDI-TOF analysis platform (ClinProTools) for rapid and preliminary report of MRSA sequence types in Taiwan. PeerJ 2018, 6, e5784. [Google Scholar] [CrossRef]
- Huang, Y.; Xu, Y.; Huang, Y.; Sun, F.; Tian, H.; Hu, N.; Shi, L.; Hua, H. Identification of newly developed advanced schistosomiasis with MALDI-TOF mass spectrometry and ClinProTools analysis. Parasite 2019, 26, 33. [Google Scholar] [CrossRef]
- Kubo, Y.; Ueda, O.; Nagamitsu, S.; Yamanishi, H.; Nakamura, A.; Komatsu, M. Novel strategy of rapid typing of Shiga toxin-producing Escherichia coli using MALDI Biotyper and ClinProTools analysis. J. Infect. Chemother. 2021, 27, 1137–1142. [Google Scholar] [CrossRef]
- Nakayama, A.; Morinaga, Y.; Izuno, R.; Morikane, K.; Yanagihara, K. Evaluation of MALDI-TOF mass spectrometry coupled with ClinProTools as a rapid tool for toxin-producing Clostridioides difficile. J. Infect. Chemother. 2024, 30, 847–852. [Google Scholar] [CrossRef]
- Zhang, T.; Ding, J.; Rao, X.; Yu, J.; Chu, M.; Ren, W.; Wang, L.; Xue, W. Analysis of methicillin-resistant Staphylococcus aureus major clonal lineages by matrix-assisted laser desorption ionization–time of flight mass spectrometry (MALDI–TOF MS). J. Microbiol. Methods 2015, 117, 122–127. [Google Scholar] [CrossRef]
- Enright, M.C.; Day, N.P.; Davies, C.E.; Peacock, S.J.; Spratt, B.G. Multilocus sequence typing for characterization of methicillin-resistant and methicillin-susceptible clones of Staphylococcus aureus. J. Clin. Microbiol. 2000, 38, 1008–1015. [Google Scholar] [CrossRef]
- Feil, E.J.; Cooper, J.E.; Grundmann, H.; Robinson, D.A.; Enright, M.C.; Berendt, T.; Peacock, S.J.; Smith, J.M.; Murphy, M.; Spratt, B.G. How clonal is Staphylococcus aureus? J. Bacteriol. 2003, 185, 3307–3316. [Google Scholar] [CrossRef]
- Park, K.-H.; Greenwood-Quaintance, K.E.; Uhl, J.R.; Cunningham, S.A.; Chia, N.; Jeraldo, P.R.; Sampathkumar, P.; Nelson, H.; Patel, R. Molecular epidemiology of Staphylococcus aureus bacteremia in a single large Minnesota medical center in 2015 as assessed using MLST, core genome MLST and spa typing. PLoS ONE 2017, 12, e0179003. [Google Scholar] [CrossRef]
- Hsu, J.-C.; Wan, T.-W.; Lee, H.; Wang, X.-M.; Lin, Y.-T.; Jung, C.-J.; Lee, T.-F.; Hsueh, P.-R.; Teng, L.-J. Heterogeneity of molecular characteristics among Staphylococcus argenteus clinical isolates (ST2250, ST2793, ST1223, and ST2198) in northern Taiwan. Microorganisms 2020, 8, 1157. [Google Scholar] [CrossRef]
- Chen, J.H.; Leung, H.-Y.; Wong, C.M.; Yuen, K.-Y.; Cheng, V.C. Prevalence and characteristics of invasive Staphylococcus argenteus among patients with bacteremia in Hong Kong. Microorganisms 2023, 11, 2435. [Google Scholar] [CrossRef]
- Francisco, A.P.; Bugalho, M.; Ramirez, M.; Carriço, J.A. Global optimal eBURST analysis of multilocus typing data using a graphic matroid approach. BMC Bioinform. 2009, 10, 152. [Google Scholar] [CrossRef]
- Rocha Balzan, L.d.L.; Rossato, A.M.; Riche, C.V.W.; Cantarelli, V.V.; D’Azevedo, P.A.; Valério de Lima, A.; Rodrigues, B.; Franca e Silva, I.L.A.; Dias, C.A.G.; Sampaio, J.L.M. Staphylococcus argenteus Infections, Brazil. Microbiol. Spectr. 2023, 11, e01179–01122. [Google Scholar] [CrossRef]
- Bank, L.E.; Bosch, T.; Schouls, L.M.; Weersink, A.J.; Witteveen, S.; Wolffs, P.F.; Nijhuis, R.H. Methicillin-resistant Staphylococcus argenteus in the Netherlands: not a new arrival. Eur. J. Clin. Microbiol. Infect. Dis. 2021, 40, 1583–1585. [Google Scholar] [CrossRef]
- Witteveen, S.; Hendrickx, A.P.; de Haan, A.; Notermans, D.W.; Landman, F.; van Santen-Verheuvel, M.G.; de Greeff, S.C.; Kuijper, E.J.; van Maarseveen, N.M.; Vainio, S. Genetic characteristics of methicillin-resistant Staphylococcus argenteus isolates collected in the dutch national MRSA surveillance from 2008 to 2021. Microbiol. Spectr. 2022, 10, e01035–01022. [Google Scholar] [CrossRef]





| Primer name | Primer sequence (5’ to 3’) | Reference |
| crtM-F | 5’ CGTAGAATCATGATGGCGCTTC 3’ | Designed in this study |
| crtM-R | 5’ TAGCCTGTCTCACTTCGTCCA3’ | Designed in this study |
| NRPS-F | 5’ TGARWCGACATTACCAGT 3’ | [8] |
| NRPS-R | 5’ ATWRCRTACATYTCRTTATC 3’ | [8] |
| arcC-F | 5’ TTGATTCACCAGCGCGTATTGTC 3’ | [26] |
| arcC-R | 5’ AGGTATCTGCTTCAATCAGCG 3’ | [26] |
| aroE-F | 5’ CCGTCGATGCATAGTGCAAA 3’ | Designed in this study |
| aroE-R | 5’ GCCATACCTGCCGGAGTAG 3’ | Designed in this study |
| glpF-F | 5’ CTTGGAACTGCAATCTTAATCC 3’ | Designed in this study |
| glpF-R | 5’ AGGTAAAATAGCATGTGCTATTC 3’ | Designed in this study |
| gmk-F | 5’ ATCGTTTTATCGGGACCATC 3’ | [26] |
| gmk-R | 5’ TCATTAACTACAACGTAATCGTA 3’ | [26] |
| pta-F | 5’ GTTAAAATCGTATTACCTGAAGG 3’ | [26] |
| pta-R | 5’ GACCCTTTTGTTGAAAAGCTTAA 3’ | [26] |
| tpi-F | 5’ GCGGTTTGGGCAATTTATGC 3’ | Designed in this study |
| tpi-R | 5’ TCGGCGTCAATACTTCACCT 3’ | Designed in this study |
| yqiL-F | 5’ CATATAGAACACCAATTGGC 3’ | Designed in this study |
| yqiL-R | 5’ GAATTGATACCGGAACAATC 3’ | Designed in this study |
| Peak | 5005 | 5285 | 5323 | 6440 | 6526 |
| Tolerance (m/z) | ±5 | ±5 | ±5 | ±5 | ±5 |
| S. argenteus | ≧4 peaks in the 5 peaks | ||||
| S .aureus | < 4 peaks in the 5 peaks | ||||
| Reference standard (PCR) | ||||
| S. argenteus | S. aureus | Total | ||
| Identification model | S. argenteus | 40 | 0 | 40 |
| S. aureus | 0 | 80 | 80 | |
| Total | 40 | 80 | 120 | |
| Reference standard (PCR) | ||||
| S. argenteus | S. aureus | Total | ||
| Prediction by conventional MALDI-TOF MS | S. argenteus | 29 | 1 | 30 |
| S. aureus | 6 | 94 | 100 | |
| Total | 35 | 95 | 130 | |
| Reference standard (PCR) | ||||
| S. argenteus | S. aureus | Total | ||
| Prediction by our identificaiton model | S. argenteus | 35 | 0 | 35 |
| S. aureus | 0 | 95 | 95 | |
| Total | 35 | 95 | 130 | |
| arcC | aroE | glpF | gmk | pta | tpi | yqiL | ST type | Isolate numbers (%) |
| 151 | 325 | 215 | 34 | 175 | 180 | 169 | 2250 | 23 (57.5%) |
| 151 | 187 | 20 | 101 | 145 | 150 | 131 | 1223 | 9 (22.5%) |
| 151 | 187 | 270 | 101 | 145 | 150 | 131 | 1223* | |
| 151 | 187 | 321 | 101 | 145 | 150 | 131 | 1223* | |
| 151 | 187 | 43 | 101 | 145 | 150 | 131 | 1223* | |
| 36 | 269 | 43 | 34 | 107 | 116 | 105 | 2198 | 2 (5%) |
| 36 | 406 | 321 | 34 | 287 | 52 | 302 | 2854 | 2 (5%) |
| 36 | 406 | 270 | 34 | 287 | 52 | 302 | 2854* | |
| 151 | 325 | 448 | 34 | 175 | 180 | 169 | 3326 | 2 (5%) |
| 151 | 406 | 43 | 34 | 256 | 261 | 323 | 2793 | 1 (2.5%) |
| 151 | 325 | 43 | 34 | 175 | 180 | 169 | 7299 | 1 (2.5%) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).