Submitted:
22 April 2026
Posted:
22 April 2026
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Materials and Methods
Specimen Collection and Preservation
Morphological Observation and Imaging
Molecular Experiment
3. Results
Morphological Description




Type Materials
Phylogenetic Tree
Differential Diagnosis
Acknowledgments
References
- Goncalves, C. C.; Prando, J. S.; Domahovski, A. C. Review of the genus Tenuacia DeLong (Insecta: Hemiptera: Cicadellidae: Gyponini), including two new species and Rubacea DeLong raised to generic status. Zootaxa 2025, 5604, 361–372. [Google Scholar] [CrossRef] [PubMed]
- de FREITAS, A. S.; Dietrich, C. H.; Takiya, D. M. Five new species of Caliscelidae (Insecta, Hemiptera) from Mexico and Panama, with additional redescriptions of little-known species. European Journal of Taxonomy 2020, 717, 27–69. [Google Scholar] [CrossRef]
- Strueder-Kypke, M. C.; Lynn, D. H. Comparative analysis of the mitochondrial cytochrome c oxidase subunit I (COI) gene in ciliates (Alveolata, Ciliophora) and evaluation of its suitability as a biodiversity marker. Systematics and Biodiversity 2010, 8, 131–148. [Google Scholar] [CrossRef]
- Li, J.; Liu, H.; Wu, Y.; Zeng, L.; Huang, X. Spatial patterns and determinants of the diversity of Hemipteran insects in the Qinghai-Xizangan Plateau. Frontiers in Ecology and Evolution 2019, 7, 165. [Google Scholar] [CrossRef]
- Cho, J. Y.; Rédei, D.; Chan, M. L. A revision of the genus Euhemisphaerius (Hemiptera: fulgoromorpha: issidae), with taxonomic corrections on related genera. The European Zoological Journal 2024, 91, 915–989. [Google Scholar] [CrossRef]
- Purse, B. The ecology and conservation of the Southern Damselfly (Coenagrion mercuriale). Doctoral dissertation, University of Liverpool, 2001. [Google Scholar]
- HU, S.; RAN, S.; XING, J. Description of a new species of the leafhopper genus Mimotettix Matsumura (Hemiptera: Cicadellidae: Deltocephalinae) from China. Zootaxa 2025, 5570, 380–386. [Google Scholar] [CrossRef] [PubMed]
- Ahmed, S.S. DNA Barcoding in Plants and Animals: A Critical Review. Preprints 2022, 2022010310. [Google Scholar]
- Li, Q.; Wang, C.; Gong, Z.; Liu, G. Phylogenetic relationships of 52 Eimeria species based on COI sequences. Mitochondrial DNA Part B 2019, 4, 3956–3958. [Google Scholar] [CrossRef] [PubMed]
- Koichiro, Tamura; Glen, Stecher; Sudhir, Kumar. MEGA11: Molecular Evolutionary Genetics Analysis version 11. Molecular biology and evolution CrossRef. 2021, 38, 3022–3027. [Google Scholar]
- Che, Y. L.; Zhang, Y. L.; Wang, Y.L. Seven new species and one new record of Gergithus Stal (Hemiptera: Fulgoroidea: Issidae) from China. Proceedings of the Entomological Society of Washington 2007, 109, 611--627. [Google Scholar]
- Hebert, P. D.; Cywinska, A.; Ball, S. L.; deWaard, J. R. Biological identifications through DNA barcodes. Proceedings of the Royal Society B: Biological Sciences 2003, 270, 313–321. [Google Scholar] [CrossRef] [PubMed]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Molecular Biology and Evolution 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [PubMed]
- Meng, R.; Gnezdilov, V.M.; Wang, Y. Two new species of the genus Peltonotellus Puton (Hemiptera: Fulgoromorpha: Caliscelidae) from northwestern China with a world checklist. Zootaxa 2015, 4052, 465–477. [Google Scholar] [CrossRef] [PubMed]


| Site Name | Primer Name | Primer sequence | Product size | TM Value |
|---|---|---|---|---|
| COI-KC | LCO1490 | GGTCAACAAATCATAAAGATATTGG | 650 | 42 |
| HC02198 | TAAACTTCAGGGTGACCAAAAAATCA |
| Character | P. brevis Meng et al., 2015(Ningxia) | P. niger Meng et al., 2015(Gansu) | P. lasaensis Chan et al., 2025(Xizang) |
|---|---|---|---|
| Type Locality | Tongxin County, Ningxia(Altitude unspecified) | Luqu County, Gansu(2,347–3,147 m) | Lhasa, Xizang(3,650–3,800 m) |
| Body Length (mm) | ♂ 1.7–1.9 ♀ 2.8–3.0 | ♂ 2.2–2.4 ♀ 2.5–2.7 | ♂ 3.0–3.1♀ 3.3–3.7 |
| Key Coloration | |||
| Male | Head/thorax with broad white median stripe; forewings dark brown/orange | Entirely black; white median stripe on head/thorax | Head white + red margins; lateral black spots; forewings translucent (yellow-black gradient) |
| Female | Light yellowish-brown; abdominal B&W stripes | Dark fulvous; black spots flanking white stripe | Predominantly brown; irregular black abdominal patches |
| Male Genitalia | |||
| Aedeagus Structure | Short thin process on right side (not reaching phallobase base) | Short thin process + transverse process on right | Distally divided into valvular lobes; paired spinous ventral processes |
| Phallobase Dorsal Margin | Concave near distal 1/3 | Slightly concave | U-shaped tubular |
| Female Genitalia | |||
| Teeth on Type IX Arcuate Process | ~10 teeth on dorsal margin of posterior connective lamina | ~11 dorsal teeth + 6 small lateral teeth | ~15 ridge teeth (key diagnostic) |
| Denticle Protrusion | Minimal | Prominent | Distinct |
| Head Ratio (Width/Length) | ♂ 1.1×, ♀ 0.9× | 0.8× | Width > Length(♂ 0.64 mm, ♀ 0.77 mm) |
| Forewing Features | Grayish-brown; no transparency | Subtransparent; prominent veins | Semi-transparent; ♂ color-demarcated, ♀ uniformly brown |
| Habitat | Mountain vegetation | High-altitude grasslands | Highest recorded altitude for the family (3,650–3,800 m) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).