Preprint
Article

This version is not peer-reviewed.

Capsaicin Improves Lipid Metabolism Disorders Caused by Immune Stress in Weaned Piglets Induced by LPS

A peer-reviewed version of this preprint was published in:
Veterinary Sciences 2026, 13(2), 155. https://doi.org/10.3390/vetsci13020155

Submitted:

14 January 2026

Posted:

16 January 2026

You are already at the latest version

Abstract
Capsaicin (CAP), as an alkaloid in Capsicum plants, has been widely studied for its promotion of metabolism and anti-inflammatory effects. In weaned piglets, LPS-induced immune stress can lead to impaired intestinal barrier function, lipid metabolism disorders and increased inflammatory response. In this study, by adding 800 mg / kg CAP intervention, which was found that could significantly reduce serum triglyceride (TG), non-esterified fatty acid (NEFA) and liver lipid accumulation, and activate PPARα-PGC1α-CPT1α pathway to promote fatty acid oxidation. In addition, CAP achieves beneficial regulation of blood lipid profiles (TC, TG, LDL-C) by down-regulating cholesterol synthesis precursors (such as MVA), reducing pro-inflammatory phospholipids (such as PA-PC), and regulating bile acid metabolism, and breaks the ' lipid metabolism-inflammation ' interaction cycle. CAP also promotes fatty acid β-oxidation and bile acid metabolism by activating TRPV1 channel to alleviate lipid accumulation. Studies have shown that CAP has potential application value in improving lipid metabolism, intestinal health and immune function of weaned piglets. However, its long-term safety and effects at different doses need to be further verified.
Keywords: 
;  ;  ;  ;  

1. Introduction

In modern intensive pig production, the common stress factors are long-distance transportation, vaccination and disease, temperature change, weaning, pregnancy, delivery and piggery management [3]. Environmental pathogenic factors, including lipopolysaccharide (LPS), viral pathogens (e.g. porcine reproductive and respiratory syndrome virus) and conditional pathogenic bacteria (e.g. Escherichia coli) can activate the host immune system through pattern recognition receptors (e.g. TLR4) and induce the overexpression of pro-inflammatory cytokines (e.g. TNF-α, IL-1β and IL-6) [6]. This persistent low-grade inflammatory state is defined as immune stress, which is characterised by the destruction of intestinal mucosal barrier integrity and liver metabolic dysfunction [7]. Lipid metabolism is crucial in energy homeostasis and growth in animals, particularly during critical developmental stages, such as the weaning period. Body fat is the main source of energy during immediate post-weaning days [8]. A striking change in body composition following weaning is a decrease in body fat content [9] and a decrease in backfat thickness, whereas lipogenesis is marginal [10]. Therefore, a functional and efficient lipid metabolism system is essential for the growth and development of piglets. A large number of studies have shown that such inflammation-mediated tissue damage can significantly reduce nutrient absorption efficiency, resulting in a decrease in average daily gain and deterioration of the feed conversion rate [11]. However, there are few studies on lipid metabolism under immune stress. Therefore, it is of great importance for a method to regulate lipid metabolism in weaned piglets under immune stress.
When piglets are weaned, due to the critical period of the body’s development, their own functions are not yet well integrated with changes in the environment, and pathogenic microorganisms and other factors can cause immune stress in piglets. Stress can lead to dramatic changes in the gastrointestinal tract of piglets, which interferes with the intestinal microbiota, host physiology and mucosal immune function [12]. Subsequently, feed intake decreased, and the occurrence and growth of diarrhoea after weaning slowed down [13]. Although feed additives, such as nucleotides, probiotics, prebiotics and fatty acids (FAs), have shown results in alleviating weaning stress, the potential of plant feed additives, such as capsaicin (CAP), has not been fully utilised [11].
CAP is an alkaloid compound isolated from Capsicum plants [1]. It is the main component that gives chili a spicy taste [14]. CAP is widely used in the food industry, pharmaceutical industry and biological science research. It has many biological functions, including antioxidation, anti-cancer, improving digestion, improving fat metabolism, immune regulation and bacteriostasis [2,14,15,16,17,18,19,20]. CAP can also improve fat metabolism. It may be involved in the regulation of energy metabolism, improve the body’s basal metabolic rate and play a role in weight management and resistance to obesity by activating TRPV1 [2]. Yang et al. found that CAP could improve hyperlipidaemia in guinea pigs fed a high-fat diet [18]. Gong et al. observed that CAP could manage lipid metabolism by regulating bile acid (BA)/intestinal microflora metabolism in high-fat-fed Sprague Dawley rats [17]. Dai et al. revealed that CAP could prevent the development of atherosclerosis induced by a high-fat diet in mice by remodelling gut microbiota and improving blood lipids and inflammation [19]. However, it is not clear whether CA supplementation could improve lipid metabolism in weaned piglets.
Therefore, the aim of this study was to investigate the alleviating effect of CAP on lipid metabolism in weaned piglets under immune stress and to explore its potential mechanism.

2. Materials and Methods

2.1. Moral Statement

All procedures were approved by the Animal Care and Use Committee of Nanjing Agricultural University (GB14925-2010, NJAU-CAST-2011-093).

2.2. Preparation of CAP and LPS

CAP was purchased from Guangzhou Lidar Biotechnology Co. Ltd., with a purity of ≥ 0.5 %. In the feeding, CAP and basic materials were mixed at an effective dose of 4 mg/kg. LPS purchased from Sigma-Aldrich Chemical Co. (O55: B5; # L2880; St. Louis, Missouri) was dissolved in sterile saline at a concentration of 0.86 % (w/v) and prepared into a solution of 1 mg/mL before being used for administration.

2.3. Animal and Experimental Design

All experiments were conducted in accordance with the guidelines of the Animal Care and Use Committee of Nanjing Agricultural University. Twenty-four Duroc-Landrace-Yorkshire (DLY) weaned piglets with an initial body weight of 9.00 ± 0.30 kg were randomly divided into three groups, with eight replicates per group and one pig per replicate. The control group (CON) and LPS group received a basal diet, while the LCA group was fed a basal diet containing 800 mg/kg CAP for 35 days [5]. Piglets in the LPS and LCA groups were intraperitoneally injected with LPS at a dose of 100 μg/kg body weight 4 h before sampling [7], while those in the CON group were intraperitoneally injected with the same dose of normal saline. In this experiment, the injection dose of LPS was referred to the method used by Zhu et al. [7], while the supply dose of CAP was referred to Long et al.’s study [5]. Basal diet composition and nutrient levels (NRC 2012) are shown in Table 1.
Note: 1Premix for per kilogram diet included: lysine, 4.6 g; methionine, 1.2 g; threonine, 0.5 g; NaCl, 0.3 g; vitamin A, 12000 IU; vitamin E, 80 IU; vitamin D3, 2500 IU; vitamin K3, 3.0 mg; biotin, 0.2 mg; nicotinic acid, 25 mg; pantothenic acid, 30 mg; riboflavin, 3.6 mg; thiamin, 1.0 mg; pyridoxine, 1.5 mg; folic acid, 2.0 mg; cobalamin, 12 μg; choline chloride, 800 mg; iron, 120 mg; zinc, 100 mg; copper, 8.8 mg; manganese, 80 mg; iodine, 0.3 mg; selenium, 0.25 mg; 2All nutrient levels were analyzed values except for the digestible energy and SID lysine.

2.4. Sample Collection

After 35 days of feeding, all piglets were sacrificed by carotid artery bloodletting. Blood samples were collected from the anterior vena cava of each pig, and the blood samples were centrifuged at 3,500 g for 15 min at 4°C. Subsequently, the collected upper serum was stored in a −80° refrigerator for subsequent physiological and biochemical indicators. Slaughter sampling was performed, and appropriate amounts of liver, jejunum and ileum tissues were placed in a cryopreservation tube and stored in a −80° refrigerator for the subsequent determination of various indicators.

2.5. Biochemical Assay of Serum Samples

Commercial assay kits were used to determine triglycerides (TG; #A110-1-1), non-esterified free fatty acids (NEFA; #A042-1-1), total cholesterol (TC; #A111-1-1), total bile acid (TBA; #E003-2-1), high-density lipoprotein cholesterol (HDL-C; #A112-1-1) and low-density lipoprotein cholesterol (LDL-C; #A113-1-1), according to the manufacturer’s instructions (Nanjing JianCheng Bioengineering Institute, Nanjing, Jiangsu, China).
According to the manufacturer’s instructions, the porcine enzyme-linked immunosorbent assay kit of Jiangsu Enzyme Immuno Industry Co. Ltd. (Quanzhou City, Jiangsu Province, China) was used to detect the fatty acid binding protein 4 (FABP4; # MM-78445O2) level.

2.6. Determination of Liver Metabolite Concentration and Enzyme Activity

According to the manufacturer’s instructions (Nanjing Jiancheng Institute of Bioengineering), commercial detection kits were used to determine TG (#A110-1-1), TC (#A111-1-1), TBA (#E003-2-1), alanine aminotransferase (ALT; #C009-3-2), aspartate aminotransferase (AST; #C010-2-1), HDL-C (#A112-1-1), LDL-C (#A113-1-1), lipoprotein lipase (LPL; #A067-1-2) and hepatic lipase (HL; #A067-1-2). The total esterase (TL) content was the sum of the HL and LPL contents.

2.7. RNA Isolation and Quantitative Real-Time Polymerase Chain Reaction (PCR) Analysis

Total RNA was extracted from the ileum (mucosal) and liver samples using a total RNA extraction reagent (Vazyme Biotechnology, Nanjing, Jiangsu, China) and quantified using an ND-2000 micro spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). After the RNA quality and concentration were determined, 1 μg of total RNA was reverse-transcribed into complementary DNA (cDNA) using the HiScript III RT SuperMix Reagent (Vazyme Biotechnology), following the manufacturer’s instructions. The mRNA expression levels of specific genes were quantified via real-time polymerase chain reaction (PCR) using SYBR qPCR Master Mix (Vazyme Biotechnology) and the QuantStudio 5 Real-Time PCR System (Thermo Scientific, Wilmington, DE, USA). The SYBR Green PCR reaction mixture consisted of 10 µL TB Green Premix Ex Taq, 0.4 µL ROX Reference Dye II, 2 µL cDNA template, 0.4 µL of each primer (total 0.8 µL, 10 µmol/L) and 6.8 µL of double-distilled H2O. The reaction conditions were as follows: pre-run at 95°C for 30 s, 40 denaturation cycles at 95°C for 10 s and annealing at 60°C for 30 s. Each sample was run in triplicate. The relative mRNA expression levels were analysed using the 2−ΔΔCt method after normalisation against β-actin. The results showed a similar trend when GAPDH served as the housekeeping gene. The primer sequences are shown in Table 2.

2.8. Protein Extraction and Western Blot Assay

TP was isolated from frozen liver samples using a lysis buffer that contained protease inhibitors (Beyotime Institute of Biotechnology, Nantong, Jiangsu, China). The protein concentration was determined using a BCA Protein Assay Kit (Beyotime Institute of Biotechnology). Equal amounts of TP—specifically, 20 µg—were loaded for electrophoresis on a 4%–20% SDS-PAGE gel. Following electrophoresis, the proteins were transferred onto PVDF membranes that had been activated with methanol. The membranes were subsequently blocked at room temperature for 2 hours in TBST containing 5% fat-free milk powder, along with 0.05% Tween-20, 100 mmol/L Tris-HCl, and 150 mmol/L NaCl (pH 7.5). After blocking, the membranes were incubated overnight at 4°C with primary antibodies against specific target proteins, including PPARα (#66826-1-Ig; Proteintech), PGC1α, CPT1α, LXRα, and FXR. The blots were then washed three times with TBST and incubated at room temperature for 1.5 hours with a secondary antibody—either alkaline phosphatase-conjugated goat anti-rabbit IgG or anti-mouse IgG (#BL023A and #BL021A; Biosharp, Hefei, Anhui, China). Finally, the blots underwent three additional washes with TBST before protein detection was performed using an enhanced chemiluminescence reagent (#BL520A; Biosharp). The signals were visualized using a ChemiDoc™ Imaging System (BIO-RAD, Hercules, CA, USA), and the intensity of the protein bands was quantified with ImageJ 1.42q software (NIH, Bethesda, MD, USA).

2.9. Liver Metabolites Analysis

The non-targeted metabolomics detection of liver tissue in this experiment was completed by Shanghai Pasenuo Biotechnology Co, Ltd. (Shanghai, China). Multivariate statistical analysis of liver samples was performed using Ropls software. PLS-DA (partial least squares-discriminant analysis) was selected to obtain the best analysis model. Differential metabolites were screened according to P value, VIP value and |log2FC| value. ClusterProfiler software was used to perform functional pathway enrichment analysis on the screened differential metabolites.

2.10. Statistical Analysis

All data were analyzed using SPSS software (version 21.0; IBM-SPSS, Inc., Chicago, Illinois) with an independent samples t-test. The results are presented as mean ± SEM. To evaluate significant differences between multiple groups, Tukey’s Honestly Significant Difference (Tukey HSD) test was applied. Statistical significance was defined as P < 0.05, while P < 0.01 was considered highly significant. Liver non-targeted metabolomics data were analyzed by orthogonal partial least squares–discriminant analysis (OPLS-DA).According to the criteria of VIP value > 1 and P value < 0.05, metabolites with significant differences between NC group and LPS group, LPS group and LCA group were screened out. Pathway enrichment analysis was performed using the Parson’s gene cloud platform. Pearson correlation analysis was performed on liver antioxidant enzyme activity and oxidative metabolites and liver differential metabolites using SPSS 26.0 software. P < 0.05 indicated that the two were significantly correlated, and then OriginPro 2025b software was used to make the correlation heat map.

3. Results

3.1. Changes in FA Metabolites and the Corresponding Enzymes in Serum and Liver

As shown in Table 3, the level of FABP4 in the LPS group was significantly lower than that in the CON group (P < 0.05), the TG and NEFA levels were higher (P < 0.05), and the liver TG and NEFA levels were higher (P < 0.05), indicating that LPS induced these conditions. However, compared with the LPS group, the addition of CAP in the LCA group resulted in a significant decrease in serum TG levels (P < 0.05), an increase in FABP4 levels (P < 0.05), a significant decrease in the liver TG and NEFA levels (P < 0.05) and an increase in the LPL, HL and TL levels (P < 0.05).
Note: The results are expressed as mean ± SEM (n = 8). NC, piglets fed a basal diet; LPS, piglets fed a basal diet and intraperitoneally injected with LPS before sampling; lCA, piglets fed CAP and injected intraperitoneally with LPS before sampling. * indicates a significant difference compared with the CON group (P < 0.05), and # indicates a significant difference compared with the LPS group (P < 0.05). TG, triglyceride; NEFA, non-esterified fatty acids; HL, liver lipase; LPL, lipoprotein lipase; TL, total lipase; FABP4, fatty acid binding protein 4.

3.2. Gene Expression Involved in FA Uptake, Synthesis and Oxidation

Regarding fatty acid (FA) uptake, the mRNA expression levels of FABP2, FATP4, and FFAR3 were significantly higher in the LPS group than in the CON group (P < 0.05). Furthermore, when compared with piglets in the LPS group, those in the LCA group exhibited markedly reduced mRNA expression of FABP2, FATP4, and FFAR3 (P < 0.05) (Figure 1A).
Regarding fatty acid (FA) synthesis, the mRNA expression levels of FASN, DGAT1, and LXRα were significantly higher in piglets from the LPS group than in those from the CON group (P < 0.05). In contrast, piglets in the LCA group showed significantly lower mRNA expression of FASN, DGAT1, and LXRα compared to those in the LPS group (P < 0.05) (Figure 1B).
Turning to fatty acid oxidation, both PPARα and ATGL mRNA expression levels were significantly reduced in the LPS group relative to the CON group (P < 0.05). However, in the LCA group, ATGL mRNA expression was markedly elevated compared with that in the LPS group (Figure 1C).

3.3. Protein Expression Related to FA Transport and Metabolism

As shown in Figure 1, the mRNA expression levels of PPARα, PGC1α, and CPT1α were significantly lower in the LPS group than in the CON group (P < 0.05). In contrast, piglets in the LCA group—whose diet was supplemented with CAP—exhibited significantly higher expression of PPARα, PGC1α, and CPT1α compared to those in the LPS group (P < 0.05) (Figure 1D).

3.4. Changes in Cholesterol and BA Metabolites in Serum and Liver

As shown in Table 4, the HDL-C level in the LPS group was significantly lower than that in the CON group (P < 0.05). Additionally, serum total bile acid (TBA) levels were significantly elevated in the LPS group compared to the CON group (P < 0.05). Moreover, both liver total cholesterol (TC) and LDL-C concentrations were also significantly higher in the LPS group (P < 0.05). Together, these findings suggest that LPS exposure induced dyslipidemia and altered bile acid metabolism. However, when CAP was added to the diet of piglets in the LCA group, several beneficial effects were observed. Specifically, serum TC, LDL-C, and TBA levels were all significantly reduced compared to those in the LPS group (P < 0.05). Furthermore, liver LDL-C levels also showed a significant decline relative to the LPS group (P < 0.05).
Note: The results are expressed as the mean ± standard error (n = 8). NC, piglets fed a basal diet; LPS, piglets fed a basal diet and intraperitoneally injected with LPS before sampling; LCA, piglets fed CAP and injected intraperitoneally with LPS before sampling. * indicates a significant difference compared with the CON group (P < 0.05), and # indicates a significant difference compared with the LPS group (P < 0.05). TC, total cholesterol; HDL-C, high-density lipoprotein cholesterol; LDL-C, low-density lipoprotein cholesterol; TBA, total bile acid.

3.5. Expression of Genes Related to Cholesterol and BA Metabolism

With regard to cholesterol metabolism, LPS-treated piglets exhibited significantly higher mRNA expression of NPC1L and ABCA1 genes associated with cholesterol production and efflux than did the piglets in the CON group (P < 0.05), and the mRNA expression of ABCG5 significantly decreased (P < 0.05). Compared with the piglets in the LPS group, those in the LCA group showed a significantly decreased mRNA expression of HMGCR, NPC1L and ACAT2 (P < 0.05) and a significantly increased mRNA expression of ABCG5 (P < 0.05) (Figure 2A).
Regarding BA metabolism, compared with the CON group, the mRNA expression of the BA synthesis-related gene CPY7A1 and BA excretion-related genes BSEP, NTCP, MRP2 and MRP4 in the LPS group significantly decreased (P < 0.05), while the mRNA expression of CYP7A1 and MRP4 in the LCA group was significantly higher than that in the LPS group (P < 0.05) (Figure 2B,C).

3.6. Protein Expression and Enzyme Activity Involved in Cholesterol Metabolism and BA Synthesis

Compared with the CON group, the LPS group showed lower (P < 0.05) LXRα and CYP27A1 expression. However, supplementation of CAP resulted in increased (P < 0.05) LXRα and CYP27A1 expression in LCA piglets compared with LPS piglets (Figure 2D).

3.7. Effects of Capsaicin on Hepatic Metabolites in Immune Stressed Piglets

The orthogonal partial least squares discriminant analysis of the liver metabolites of the three groups of piglets is shown in Figure 3. The results showed that the liver metabolites of NC and LPS groups, LPS and LCA groups were significantly separated. The results showed that there were significant differences in liver metabolites between NC group and LPS group, as well as LPS group and LCA group (P < 0.05).
There were 789 differential metabolites in the results of liver non-target metabolome analysis. According to the standard screening of P1, | log2FC | > 1, the three groups of piglet liver differential metabolites volcano map is shown in Fig.4. The results showed that, compared with the NC group, the LPS group exhibited 138 significantly down-regulated and 109 significantly up-regulated metabolites in the liver (P < 0.05). In contrast, when the LCA group was compared with the LPS group, 22 metabolites were significantly down-regulated and 12 metabolites were significantly up-regulated in the liver (P < 0.05). Furthermore, the 247 differential metabolites identified between the LPS and NC groups could be broadly classified into nine categories, including benzenoids; organic acids and derivatives; alkaloids and derivatives; lipids and lipid-like molecules; organic oxygen compounds; organoheterocyclic compounds; nucleosides, nucleotides, and analogues; phenylpropanoids and polyketides; and others. Similarly, the 34 differential metabolites found by comparing the LCA group with the LPS group also fell into nine categories: benzenoids; lipids and lipid-like molecules; organoheterocyclic compounds; organic oxygen compounds; phenylpropanoids and polyketides; and other compound classes. The changes of differential metabolites of fatty acyl compounds in liver of LCA group and LPS group were as follows: the content of Prallethrin, Latanoprost, 1-linoleoyl-2-oleoyl-rac-glycerol increased; the content of Eicosapentaenoic acid decreased.
Figure 4. Volcano plot of differential metabolites. Note: A: NC group compared with LPS group; B: LPS group compared with LCA group.
Figure 4. Volcano plot of differential metabolites. Note: A: NC group compared with LPS group; B: LPS group compared with LCA group.
Preprints 193614 g004

3.8. Correlation Analysis Between Enzyme Activity and Product Level Related to Lipid Metabolism in Liver of Piglets and Differential Metabolites

Pearson correlation analysis was performed on liver lipid metabolism-related enzyme activities and product levels with differential metabolites, and the results are shown in Figure 5. Compared with the NC group, the LPS group was significantly up-regulated in Mevalonic acid 5-pyrophosphate, Citrate, Palmitoyl carnitine. Stearoylcarnitine increased, lysophospholipids (LysoPC) increased, Leukotriene D4 was significantly up-regulated, Arachidonic acid and Prostaglandin F2α were significantly up-regulated, Pyruvate and Acetacetate increased, Adipoyl-carnitine increased (Fig.5A). Compared with LPS group, Leukotriene D4, Prostaglandin F2α and Arachidonic acid in LCA group were significantly decreased, and various glycerophospholipids (such as 1-palmitoyl-2-arachidonoyl-sn-glycero-3-phosphocholine) tended to be normal, Myristoleic acid. Monounsaturated fatty acids such as palmitoleic acid were more stable, and the proportion of Linoleic acid and Oleic acid was improved (Figure 5B). The results of the heat map of lipid metabolism in LPS and LCA groups showed that TC was positively correlated with Mevalonic acid 5-pyrophosphate, Pg 44: 12, Eicosapentaenoic acid; tG was positively correlated with 1-palmitoyl-2-arachidonoyl-sn-glycero-3-phosphocholine, Pe 40.7. HDL-C was negatively correlated with 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine. LDL-C was positively correlated with 1-stearoyl-2-docosahexaenoyl-sn-glycero-3-phosphocholine. TBA was positively correlated with Pe 38.6 and Myristoleic acid (Fig.5C).

4. Discussion

Studies have shown that obesity is associated with chronic systemic inflammation [21]. Excessive release of these inflammatory factors can damage the body’s tissues, causing damage to the structure and function of the intestine and liver, which affects the growth and health of animals [22]. At the same time, studies have also found that the metabolites of gut microbes, such as LPS, may promote tissue inflammation through the ‘gut–liver axis’ and ‘gut–fat axis’ [23]. In this study, high TG levels and NEFA accumulation were observed in the serum and liver samples of piglets in the LPS group. The increase in TG and NEFA content is one of the characteristics of dyslipidaemia, which is closely related to the occurrence of obesity. The cause of obesity is the formation and accumulation of fat, and the formation of fat is the enzymatic process of esterification of glycerol and NEFA to form TG [24]. Fat accumulation in adipose tissue occurs in the late stage of adipogenesis, which is associated with an increase in the TG concentration [25]. More evidence suggests that the accumulation of NEFAs is closely related to a series of health problems, such as obesity, insulin resistance and vascular diseases [26,27,28]. NEFA can induce insulin resistance to accumulate TG in cells and liver and can also produce low-grade inflammation in skeletal muscle, liver and adipose tissue by activating the NF-κB pathway, releasing pro-inflammatory cytokines, such as TNF-α, IL-1β and IL-6 [29]. Therefore, piglets injected with LPS may be in an immune stress state and produce inflammation, which increases the level of NEFA and negatively affects lipid metabolism in piglets.
In addition, the serum HDL-C level of piglets in the LPS group was lower, while the serum TBA content was higher, and the liver TC and LDL-C levels were higher. HDL-C is one of the main carriers of cholesterol in the blood and plays a key role in maintaining cholesterol homeostasis between the blood and peripheral tissues. It can transport excess cholesterol from the periphery to the liver for elimination through the reverse cholesterol transfer pathway [30,31,32]. Liver BA synthesis is the main metabolic pathway of cholesterol catabolism [33]. When hepatobiliary diseases occur, serum BA levels significantly increase, and high concentrations of BA are cytotoxic [34]. Primary BA is synthesised by cholesterol and binds to taurine or glycine in the liver, which is secreted into bile and further metabolised by the gut microbiota into secondary BAs [33]. In addition to its washing effect on intestinal lipid absorption, BA also acts as a ligand for a variety of nuclear receptors (NR), such as farnesoid X receptor (FXR, also known as NR1H4) [35,36,37]. Taken together, these findings suggest that the ability of piglets in the LPS group to remove excess lipids was weakened, which could also increase the risk of lipid metabolism-related diseases in piglets.
Conversely, in the LCA group, the addition of CAP resulted in the alleviation of excessive lipid (TG and NEFA) accumulation in the liver and serum, while the increase in HL activity and LPL activity in the liver led to an increase in lipid efflux, a significant decrease in the content of TC, LDL-C and TBA and a significant decrease in the content of LDL-C in the liver. HL plays a key role in the hydrolysis of TGs and promotes the uptake of HDL-C in the circulating blood [38,39]. An increase in HDL-C content can help prevent cardiovascular diseases [32]. The concentration of LDL-C is regulated by Low-Density Lipoprotein (LDLR) levels, and LDL-C in the blood can be absorbed by LDLR on the basal surface of intestinal cells or hepatocytes. Studies have shown that a decrease in LDL-C content can help inhibit body fat accumulation. For example, bamboo leaf extract can improve cholesterol metabolism, reduce TG and LDL-C content and inhibit abdominal fat deposition in broilers [40,41]. In a high-fat diet mouse model, dietary CAP supplementation significantly reduced TC, LDL-C and TG levels while increasing HDL-C [42]. Therefore, as previously mentioned, the addition of CAP to the diet can effectively alleviate the lipid metabolism disorder in weaned piglets under stress.
To further explore the molecular mechanism of CAP using lipid regulation, we determined the levels of genes and proteins related to FA and cholesterol metabolism. The hepatic uptake of circulating FA is largely dependent on three major FA transporters located in the plasma membrane of hepatocytes: fatty acid transporter (FATP), cluster of differentiation 36 (CD36) and caveolin [43,44]. Liver FA uptake was found to decrease in mice lacking FATP2 or FATP5 in the liver [45,46]. In this study, although there was no significant difference in the expression of CD36 between the CON and LPS groups, the mRNA expression of FABP2, FATP4 and FFAR3 in the LPS group was significantly higher than that in the CON group. However, the addition of CAP to the diet significantly decreased the expression of FABP2, FATP4 and FFAR3 in the LCA group. Therefore, it is speculated that the intake of FAs in piglets abnormally increases under LPS-induced immune stress, but the addition of CAP to the diet can effectively alleviate this problem.
The formation of FAS is mainly controlled by the sterol regulatory element-binding protein 1c and its downstream targets, acetyl-CoA carboxylase (ACC) and FASN. Initially, acetyl-CoA is transformed by ACC into malonyl-CoA, followed by the conversion of malonyl-CoA into palmitate by FASN. The new FAs can then undergo a series of desaturation, elongation and esterification steps, leading to storage in the form of TG or output in the form of VLDL particles [47]. Among these, ACC is the first rate-limiting enzyme that can convert acetyl-CoA to malonyl-CoA, and FASN is the key lipogenic enzyme that catalyses the final step of FA synthesis [48,49]. The newly synthesised FA will be used to synthesise TG, which is catalysed by DGAT1 and DGAT2 in the last step [50]. In addition, the liver X receptor (LXR) is a key regulator of mammalian lipid homeostasis. This transcription factor controls the expression of a series of genes involved in cholesterol uptake, transport, efflux and excretion in a tissue-dependent manner. The activation of LXRα can promote the synthesis of FAs [51,52]. In this study, LPS injection resulted in a higher mRNA expression of FASN, DGAT1 and LXRα in piglets, indicating that LPS-induced immune stress catalysed abnormal FA synthesis in piglets. By contrast, the abnormal expression of FASN, DGAT1 and LXRα mRNA in piglets in the LCA group supplemented with CAP in their diet was alleviated, indicating that piglets under immune stress have abnormal FA uptake and synthesis and that feeding CAP can alleviate this situation.
After uptake, FA is utilised by hepatocytes to produce ATP through β-oxidation. PPARα is a transcription factor involved in FA oxidation [47]. As one of the FA-activated NRs, PPARα can up-regulate the gene transcription of lipid catabolism-related proteins and plays a key role in the transcriptional regulation of peroxisome and mitochondrial FA oxidation-related genes (e.g. ACOX) [53,54,55]. As a key regulator of mitochondrial biosynthesis and energy metabolism, PGC-1α regulates many physiological processes, such as glucose metabolism and lipid metabolism, and targets the expression of PPARα [56]. Mitochondrial FA β-oxidation is the main pathway of FA catabolism and plays a vital role in maintaining systemic energy homeostasis [57]. As the rate-limiting enzyme of FA oxidation, carnitine palmitoyltransferase I (CPT1) catalyses the conversion of acetyl-CoA into acylcarnitine, which then penetrates the membrane into the mitochondria. PGC-1 also acts as a coactivator in the thyroid induction of CPT1A in the liver [58], highlighting the pleiotropic role of PGC-1 in lipid metabolism [59]. Different from the increase in FA uptake, the mRNA expression of PPARα in the LPS group was down-regulated, the protein expression of PPARα decreased, and the expression of PGC1α and CPT1α decreased. Therefore, we can infer that the increase in serum NEFA levels may be caused by the decrease in FA uptake and utilisation in LPS group piglets. However, the addition of CAP to the diet resulted in a significant up-regulation of PPARα, PGC1α and CPT1α protein expression in the LCA group, which effectively alleviated the adverse effects of immune stress on β-oxidation. In addition, ATGL can hydrolyse TAG into DAG and FA [60]. In this study, qPCR detection showed that the mRNA expression of ATGL in the LPS group decreased significantly, while the mRNA expression of ATGL in the LCA group increased significantly, indicating that CAP promoted the hydrolysis of TG to a certain extent. Therefore, we concluded that the addition of CAP to the diet greatly improved the FA metabolism of LPS-induced immune-stressed piglets, which could also be the reason for the decrease in NEFA content in serum compared with the LPS group.
In cholesterol metabolism, LXR works together with the sterol regulatory element binding protein 2 (SREBP2) pathway to maintain cellular and systemic sterol levels [51,61]. LXRs can act on target genes ABCG5 and ABCG8 to stimulate bile cholesterol excretion, thereby promoting the elimination of excess cholesterol [62], while SREBP2 can promote cholesterol biosynthesis by activating gene transcription that encodes the rate-limiting enzyme HMGCR [63]. In this study, although SREBP2 between the two groups did not differ significantly compared with the CON group, the mRNA expression of ABCG5 in the LPS group was down-regulated, and the protein expression of LXRα decreased. This indicates that the cholesterol excretion of piglets under immune stress was blocked, resulting in cholesterol accumulation, which could also be the reason for the increase in TC content in the liver of piglets in the LPS group. The addition of CAP in the diet up-regulated the mRNA expression of ABCG5 and the protein expression of LXRα in the LCA group, indicating that the blocked cholesterol excretion of piglets under immune stress was alleviated. In addition, the mRNA expression of HMGCR in piglets in the LCA group was down-regulated, implying that the addition of CAP to the diet could also inhibit the transcription of the HMGCR gene and reduce the synthesis of cholesterol, which could be the reason for the decrease in TC content in the serum of piglets in the LCA group. In addition to endogenous synthesis, another important source of cholesterol is intestinal absorption of cholesterol from the diet and bile [64]. Cholesterol obtained from the diet is absorbed in the intestinal lumen through small intestinal epithelial cells through NPC1L1, located on the surface of the intestinal lumen, and then this dietary cholesterol is released in the form of chylomicrons, which are absorbed by the liver [51,64,65]. Free cholesterol can be absorbed from the diet through the intestinal epithelial cells of the small intestine and by hepatocytes from the bile of the biliary tract. Excessive cholesterol is transported to the blood through ABCA1 or into the intestinal cavity and bile duct through ABCG5 and ABCG8 [32]. Intracellular cholesterol is esterified by ACAT2, mainly expressed in intestinal epithelial cells and liver cells in the endoplasmic reticulum, stored in lipid droplets or secreted as lipoproteins [32,64]. Compared with the CON group, the mRNA expression of ABCA1 and NPC1L in the LPS group was up-regulated, indicating that piglets in the LPS group could up-regulate NPC1L to absorb more dietary cholesterol through the intestine. Due to the high TC content in the liver of piglets in the LPS group under immune stress, more ABCA1 expression is needed to transport excess TC to the blood. Compared with piglets in the LPS group, those in the LCA group had lower mRNA expression of NPC1L, indicating that the addition of CAP to the diet could alleviate the excessive intake of dietary cholesterol in the intestine of piglets under stress. In addition, the mRNA expression of ACAT2 in the LCA group was down-regulated, indicating that the addition of CAP to the diet could reduce the esterification and storage of intracellular cholesterol.
BA is synthesised by a multi-step reaction catalysed by two different pathways in hepatocytes: the ‘classical’ (neutral) pathway and the ‘alternative’ (acidic) pathway [66]. The classical pathway of BA synthesis begins with the 7α-hydroxylation initiation of cholesterol through the rate-limiting enzyme cytochrome P450 family 7 subfamily A member 1 (CYP7A1) [67,68]. The alternative pathway is initiated by sterol 27-hydroxylase (CYP27A1), which oxidises cholesterol into a series of alcohol, aldehyde and carboxylic acid metabolites. The reaction is followed by oxysterol 7α-hydroxylation, mainly mediated by CYP7B1 [68,69]. Finally, the synthesised BA is secreted into the bile duct lumen by two ABC transporters (BSEP and MRP2) through the bile duct membrane [70]. The mRNA expression of CYP7A1, BSEP, NTCP, MRP2 and MRP4 in the LPS group was significantly lower than that in the CON group, which was consistent with the change in the TBA level in the liver. In the LCA group, the mRNA expression of CYP7A1 and MRP4 also increased. These results suggest that the decrease in BA levels in piglets injected with LPS under stress may be the result of impaired classical pathways and that the addition of CAP to the diet can effectively restore BA levels to normal levels by promoting classical pathways. In addition, previous studies have shown that increased CYP7A1 activity can down-regulate cholesterol synthesis through the SREBP pathway and enhance cholesterol efflux and elimination through LXR [71], which is consistent with the up-regulation of LXRα protein expression in the LCA group in a previous study.
Metabolomics is an important research method for analyzing the relationship between physiological state and metabolites, which can reveal the metabolic regulation mechanism of animal life activities. As the metabolic center in the body, the liver is closely related to the metabolism of carbohydrates, proteins and lipids, involving key life activities such as energy metabolism, detoxification, glucose and lipid metabolism [72]. Dai et al. (2022) found that the metabolites of CAP in the cecum of mice were mainly concentrated in steroids and their derivatives, organic oxygen compounds, fatty acyl, carboxylic acids and their derivatives, which was similar to the changes of liver metabolites after CAP treatment in this experiment [19].Among the differential metabolites between NC group and LPS group, Mevalonic acid 5-pyrophosphate was significantly up-regulated, suggesting the activation of cholesterol synthesis pathway; the increase of LysoPC may be caused by the activation of phospholipase A2 in the inflammatory response. Leukotriene D4, as a potent pro-inflammatory factor, is derived from arachidonic acid (AA) metabolism, and its significant up-regulation leads to an increase in inflammation-related lipids. The up-regulation of arachidonic acid is a marker of the initiation of the inflammatory cascade; the increase of Pyruvate and Acetacetate may indicate an increase in glycolysis or a compensatory increase in ketone body formation; the increase of Adipoyl-carnitine may reflect the abnormal oxidation of medium-chain fatty acids. Therefore, LPS induces immune stress, leading to imbalance of fatty acid synthesis and decomposition, phospholipid membrane damage and inflammatory lipid release, mitochondrial dysfunction, and abnormal energy metabolism. Among the differential metabolites between the LCA group and the LPS group, Leukotriene D4, Prostaglandin F2α, and Arachidonic acid were significantly reduced in the LCA group, indicating that capsaicin inhibited the arachidonic acid metabolic pathway and reduced the inflammatory response. A variety of glycerophospholipids (such as 1-palmitoyl-2-arachidonoyl-sn-glycero-3-phosphocholine) tended to normal levels in the LCA group, indicating the recovery of cell membrane stability; the improvement of the ratio of Linoleic acid and Oleic acid indicated that the n-6 / n-3 balance was improved and the pro-inflammatory environment was reduced. The changes of Taurocholic acid sulfate and Glycochenodeoxycholic acid may be related to the effect of capsaicin on the hepatoenteric axis, which indirectly regulates lipid metabolism.
In order to further determine the mechanism of CAP on liver lipid metabolism in immune-stressed piglets, the correlation between liver lipid metabolism related indicators and differential metabolites was analyzed. The results showed that Mevalonic acid 5-pyrophosphate was positively correlated with TC, TG and LDL-C.Mevalonic acid 5-pyrophosphate is the core node of cholesterol biosynthesis, and its up-regulation directly drives the increase of blood lipids. 1-palmitoyl-2-arachidonoyl-sn-glycero-3-phosphocholine is also positively correlated with TG, TC and LDL-C.This is an AA-rich phospholipid that is easily hydrolyzed by PLA2 to produce AA, which further promotes inflammation and forms a ' lipid metabolism-inflammation feedback loop '. Pe 40.7 was positively correlated with TG, TC and TBA, suggesting that it may be a new protective metabolite produced by capsaicin intervention, which has the effect of regulating lipid transport.

5. Conclusions

Based on the results of this study, we concluded that capsaicin CAP supplementation in the diet of LPS-induced immune stress weaned piglets can significantly improve lipid metabolism disorders. Due to the role of CAP, the PPARα-PGC1α-CPT1α pathway was activated, ATGL was up-regulated, FASN, DGAT1 and NPC1L were down-regulated, and FA metabolism was improved. By up-regulating the LXRα-ABCG5 pathway and FXR-dependent CYP7A1-MRP4 pathway, cholesterol efflux and bile acid metabolism homeostasis were significantly restored. Thus, the lipid metabolism homeostasis of weaned piglets under immune stress was remodeled. At the same time, in terms of metabolism, CAP achieves beneficial regulation of blood lipid profile (TC, TG, LDL-C) by down-regulating cholesterol synthesis precursors (such as MVA), reducing pro-inflammatory phospholipids (such as PA-PC), and regulating bile acid metabolism, and breaks the 'lipid metabolism-inflammation' interaction cycle, providing a new nutritional intervention strategy for alleviating immune stress-induced lipid metabolism disorders in piglets.

Author Contributions

Jianlei Zhao: Investigation, Writing – original draft, Writing – review & editing. Wenyi Liu: Investigation, Methodology, Formal analysis. Xin Zhang: Investigation. Zechen Xie: Investigation. Shuhan Liu: Investigation. Wenjun Zhou: Project administration, Methodology. Lili Zhang: Project administration, Conceptualisation, Writing – review & editing. All authors read and approved the final manuscript.

Funding

The research was sponsored by the National Natural Science Foundation of China (Grant No: 32172775).

Acknowledgments

We express our gratitude to the experimental platform provided by Nanjing Agricultural University.

Conflicts of Interest

The authors declare no competing interests.

Abbreviations

ABCA1, ATP-binding cassette transporter A1; ABCG5, ATP-binding cassette transporter G5; ABCG8, ATP-binding cassette transporter G8; ACACA, Acetyl-CoA carboxylase α; ACAT2, Acyl coenzyme A: cholesterol acyltransferase 2; ALT, Alanine aminotransferase; AST, Aspartate aminotransferase; ATGL, Adipose triglyceride lipase; ATP, Adenosine Triphosphate; BA, Biogenic amine; BSEP, Bile salt export pump; CAP, Capsaicin; CD36, Cluster of differentiation 36; CPT1A, Carnitine palmitoyltransferase 1A; CYP27A1, Sterol 27-hydroxylase; CYP7A1, Cholesterol 7α-hydroxylas; DGAT1, Diacylglycerol acyltransferase 1; DGAT2, Diacylglycerol acyltransferase 2; FA, Fatty acid;FABP2, Fatty acid binding protein 2; FABP4, Fatty acid binding protein 4; FASN, Fatty acid synthase; FATP4, Fatty acid transport protein 4; FFAR3, Free fatty acid receptor 3; FXR, Farnesoid X receptor; GAPDH, Glyceraldehyde-3-phosphate dehydrogenase; HDL-C, High-density lipoprotein cholesterol; HL, Hepatic lipase; HMGCR, 3-hydroxy-3-methylglutaryl-CoA reductase; LDL-C, Low-density lipoprotein cholesterol; LPL, Lipoprotein lipase;LXRα, Liver X receptor α; MDR3, Multidrug resistant protein 3; MRP2, Multidrug resistance related protein 2; MRP3, Multidrug resistance related protein 3; MRP4, Multidrug resistance protein 4; NEFA, Non-esterified fatty acid; NPC1L, Niemann-Pick C-1-like protein; NTCP, Na+-taurocholate cotransporting polypeptide; PCoA, Principal coordinates analysis; PVDF, Polyvinylidene difluoride; PPARα, Peroxisome proliferator activated receptor α; SCD1, Stearoyl-CoA desaturase 1; SDS-PAGE, Sodium Dodecyl Sulfate-Polyacrylamide Gel Electrophoresis; SEM, Standard Error of the Mean; SREBP2, Sterol regulatory element-binding protein 2; TBA, Total bile acid; TBST, Tris-Buffered Saline with Tween 20; TC, Total cholesterol; TG, Triglyceride; TL, Total lipase; VLDL, Very-Low-Density Lipoprotein.

References

  1. Yin, J.; Ren, W.; Liu, G.; Duan, J.; Yang, G.; Wu, L.; Li, T.; Yin, Y. Birth oxidative stress and the development of an antioxidant system in newborn piglets. Free Radic Res 2013, 47, 1027–1035. [Google Scholar] [CrossRef]
  2. Varshney, V.; Kumar, A.; Parashar, V.; Kumar, A.; Goyal, A.; Garabadu, D. Therapeutic Potential of Capsaicin in Various Neurodegenerative Diseases with Special Focus on Nrf2 Signaling. Curr Pharm Biotechnol 2024, 25, 1693–1707. [Google Scholar] [CrossRef]
  3. Wang, L.; Wang, C.; Peng, Y.; Zhang, Y.; Liu, Y.; Liu, Y.; Yin, Y. Research progress on anti-stress nutrition strategies in swine. Anim Nutr 2023, 13, 342–360. [Google Scholar] [CrossRef]
  4. Cao, S.; Hou, L.; Sun, L.; Gao, J.; Gao, K.; Yang, X.; Jiang, Z.; Wang, L. Intestinal morphology and immune profiles are altered in piglets by early-weaning. Int Immunopharmacol 2022, 105, 108520. [Google Scholar] [CrossRef]
  5. Long, S.; Liu, S.; Wang, J.; Mahfuz, S.; Piao, X. Natural capsicum extract replacing chlortetracycline enhances performance via improving digestive enzyme activities, antioxidant capacity, anti-inflammatory function, and gut health in weaned pigs. Anim Nutr 2021, 7, 305–314. [Google Scholar] [CrossRef]
  6. Moeser, A.J.; Pohl, C.S.; Rajput, M. Weaning stress and gastrointestinal barrier development: Implications for lifelong gut health in pigs. Anim Nutr 2017, 3, 313–321. [Google Scholar] [CrossRef] [PubMed]
  7. Zhu, H.; Wang, H.; Wang, S.; Tu, Z.; Zhang, L.; Wang, X.; Hou, Y.; Wang, C.; Chen, J.; Liu, Y. Flaxseed Oil Attenuates Intestinal Damage and Inflammation by Regulating Necroptosis and TLR4/NOD Signaling Pathways Following Lipopolysaccharide Challenge in a Piglet Model. Mol Nutr Food Res 2018, 62, e1700814. [Google Scholar] [CrossRef] [PubMed]
  8. Le Dividich, J.; Sève, B. Effects of underfeeding during the weaning period on growth, metabolism, and hormonal adjustments in the piglet. Domest Anim Endocrinol 2000, 19, 63–74. [Google Scholar] [CrossRef]
  9. Davis, B.L.; Fraser, J.N.; Burkey, T.E.; Skjolaas, K.A.; Dritz, S.S.; Johnson, B.J.; Minton, J.E. Oral inoculation with Salmonella enterica serovar Typhimurium or Choleraesuis promotes divergent responses in the somatotropic growth axis of swine. J Anim Sci 2010, 88, 1642–1648. [Google Scholar] [CrossRef]
  10. Fenton, J.P.; Roehrig, K.L.; Mahan, D.C.; Corley, J.R. Effect of swine weaning age on body fat and lipogenic activity in liver and adipose tissue. J Anim Sci 1985, 60, 190–199. [Google Scholar] [CrossRef] [PubMed]
  11. Upadhaya, S.D.; Kim, I.H. The Impact of Weaning Stress on Gut Health and the Mechanistic Aspects of Several Feed Additives Contributing to Improved Gut Health Function in Weanling Piglets-A Review. Animals (Basel) 2021, 11. [Google Scholar] [CrossRef]
  12. Li, Y.; Guo, Y.; Wen, Z.; Jiang, X.; Ma, X.; Han, X. Weaning Stress Perturbs Gut Microbiome and Its Metabolic Profile in Piglets. Sci Rep 2018, 8, 18068. [Google Scholar] [CrossRef]
  13. Spreeuwenberg, M.A.; Verdonk, J.M.; Gaskins, H.R.; Verstegen, M.W. Small intestine epithelial barrier function is compromised in pigs with low feed intake at weaning. J Nutr 2001, 131, 1520–1527. [Google Scholar] [CrossRef]
  14. Srinivasan, K. Biological Activities of Red Pepper (Capsicum annuum) and Its Pungent Principle Capsaicin: A Review. Crit Rev Food Sci Nutr 2016, 56, 1488–1500. [Google Scholar] [CrossRef]
  15. Chen, Z.Y.; Huang, H.H.; Li, Q.C.; Zhan, F.B.; Wang, L.B.; He, T.; Yang, C.H.; Wang, Y.; Zhang, Y.; Quan, Z.X. Capsaicin Reduces Cancer Stemness and Inhibits Metastasis by Downregulating SOX2 and EZH2 in Osteosarcoma. Am J Chin Med 2023, 51, 1041–1066. [Google Scholar] [CrossRef]
  16. Mondal, A.; Banerjee, S.; Terang, W.; Bishayee, A.; Zhang, J.; Ren, L.; da Silva, M.N.; Bishayee, A. Capsaicin: A chili pepper bioactive phytocompound with a potential role in suppressing cancer development and progression. Phytother Res 2024, 38, 1191–1223. [Google Scholar] [CrossRef] [PubMed]
  17. Gong, T.; Wang, H.; Liu, S.; Zhang, M.; Xie, Y.; Liu, X. Capsaicin regulates lipid metabolism through modulation of bile acid/gut microbiota metabolism in high-fat-fed SD rats. Food Nutr Res 2022, 66. [Google Scholar] [CrossRef]
  18. Yang, S.; Liu, L.; Meng, L.; Hu, X. Capsaicin is beneficial to hyperlipidemia, oxidative stress, endothelial dysfunction, and atherosclerosis in Guinea pigs fed on a high-fat diet. Chem Biol Interact 2019, 297, 1–7. [Google Scholar] [CrossRef] [PubMed]
  19. Dai, Z.; Li, S.; Meng, Y.; Zhao, Q.; Zhang, Y.; Suonan, Z.; Sun, Y.; Shen, Q.; Liao, X.; Xue, Y. Capsaicin Ameliorates High-Fat Diet-Induced Atherosclerosis in ApoE(-/-) Mice via Remodeling Gut Microbiota. Nutrients 2022, 14. [Google Scholar] [CrossRef] [PubMed]
  20. Yu, T.; Tong, L.; Ao, Y.; Zhang, G.; Liu, Y.; Zhang, H. Novel design of NIR-triggered plasmonic nanodots capped mesoporous silica nanoparticles loaded with natural capsaicin to inhibition of metastasis of human papillary thyroid carcinoma B-CPAP cells in thyroid cancer chemo-photothermal therapy. J Photochem Photobiol B 2019, 197, 111534. [Google Scholar] [CrossRef]
  21. Bouter, K.E.; van Raalte, D.H.; Groen, A.K.; Nieuwdorp, M. Role of the Gut Microbiome in the Pathogenesis of Obesity and Obesity-Related Metabolic Dysfunction. Gastroenterology 2017, 152, 1671–1678. [Google Scholar] [CrossRef]
  22. Niu, X.; Ding, Y.; Chen, S.; Gooneratne, R.; Ju, X. Effect of Immune Stress on Growth Performance and Immune Functions of Livestock: Mechanisms and Prevention. Animals (Basel) 2022, 12. [Google Scholar] [CrossRef]
  23. Xu, S.S.; Wang, N.; Huang, L.; Zhang, X.L.; Feng, S.T.; Liu, S.S.; Wang, Y.; Liu, Z.G.; Wang, B.Y.; Wu, T.W.; et al. Changes in the Mucosa-Associated Microbiome and Transcriptome across Gut Segments Are Associated with Obesity in a Metabolic Syndrome Porcine Model. Microbiol Spectr 2022, 10, e0071722. [Google Scholar] [CrossRef]
  24. Kersten, S. Mechanisms of nutritional and hormonal regulation of lipogenesis. EMBO Rep 2001, 2, 282–286. [Google Scholar] [CrossRef] [PubMed]
  25. Shao, D.; Rangwala, S.M.; Bailey, S.T.; Krakow, S.L.; Reginato, M.J.; Lazar, M.A. Interdomain communication regulating ligand binding by PPAR-gamma. Nature 1998, 396, 377–380. [Google Scholar] [CrossRef]
  26. Björntorp, P.; Bergman, H.; Varnauskas, E. Plasma free fatty acid turnover rate in obesity. Acta Med Scand 1969, 185, 351–356. [Google Scholar] [CrossRef] [PubMed]
  27. Boden, G. Effects of free fatty acids (FFA) on glucose metabolism: significance for insulin resistance and type 2 diabetes. Exp Clin Endocrinol Diabetes 2003, 111, 121–124. [Google Scholar] [CrossRef]
  28. Carlsson, M.; Wessman, Y.; Almgren, P.; Groop, L. High levels of nonesterified fatty acids are associated with increased familial risk of cardiovascular disease. Arterioscler Thromb Vasc Biol 2000, 20, 1588–1594. [Google Scholar] [CrossRef] [PubMed]
  29. Boden, G. Obesity and free fatty acids. Endocrinol Metab Clin North Am 2008, 37, 635–646, viii-ix. [Google Scholar] [CrossRef]
  30. März, W.; Kleber, M.E.; Scharnagl, H.; Speer, T.; Zewinger, S.; Ritsch, A.; Parhofer, K.G.; von Eckardstein, A.; Landmesser, U.; Laufs, U. HDL cholesterol: reappraisal of its clinical relevance. Clin Res Cardiol 2017, 106, 663–675. [Google Scholar] [CrossRef]
  31. Wasan, K.M.; Brocks, D.R.; Lee, S.D.; Sachs-Barrable, K.; Thornton, S.J. Impact of lipoproteins on the biological activity and disposition of hydrophobic drugs: implications for drug discovery. Nat Rev Drug Discov 2008, 7, 84–99. [Google Scholar] [CrossRef]
  32. Santos-Gallego, C.G.; Giannarelli, C.; Badimón, J.J. Experimental models for the investigation of high-density lipoprotein-mediated cholesterol efflux. Curr Atheroscler Rep 2011, 13, 266–276. [Google Scholar] [CrossRef]
  33. Chiang, J.Y. Bile acid metabolism and signaling. Compr Physiol 2013, 3, 1191–1212. [Google Scholar] [CrossRef]
  34. Hofmann, A.F. The continuing importance of bile acids in liver and intestinal disease. Arch Intern Med 1999, 159, 2647–2658. [Google Scholar] [CrossRef]
  35. Fuchs, C.D.; Trauner, M. Role of bile acids and their receptors in gastrointestinal and hepatic pathophysiology. Nat Rev Gastroenterol Hepatol 2022, 19, 432–450. [Google Scholar] [CrossRef] [PubMed]
  36. Perino, A.; Demagny, H.; Velazquez-Villegas, L.; Schoonjans, K. Molecular Physiology of Bile Acid Signaling in Health, Disease, and Aging. Physiol Rev 2021, 101, 683–731. [Google Scholar] [CrossRef]
  37. Fuchs, C.D.; Simbrunner, B.; Baumgartner, M.; Campbell, C.; Reiberger, T.; Trauner, M. Bile acid metabolism and signalling in liver disease. J Hepatol 2025, 82, 134–153. [Google Scholar] [CrossRef] [PubMed]
  38. Connelly, P.W.; Hegele, R.A. Hepatic lipase deficiency. Crit Rev Clin Lab Sci 1998, 35, 547–572. [Google Scholar] [CrossRef]
  39. Perret, B.; Mabile, L.; Martinez, L.; Tercé, F.; Barbaras, R.; Collet, X. Hepatic lipase: structure/function relationship, synthesis, and regulation. J Lipid Res 2002, 43, 1163–1169. [Google Scholar] [CrossRef]
  40. Shen, M.; Xie, Z.; Jia, M.; Li, A.; Han, H.; Wang, T.; Zhang, L. Effect of Bamboo Leaf Extract on Antioxidant Status and Cholesterol Metabolism in Broiler Chickens. Animals (Basel) 2019, 9. [Google Scholar] [CrossRef]
  41. Shen, M.M.; Zhang, L.L.; Chen, Y.N.; Zhang, Y.Y.; Han, H.L.; Niu, Y.; He, J.T.; Zhang, Y.L.; Cheng, Y.F.; Wang, T. Effects of bamboo leaf extract on growth performance, meat quality, and meat oxidative stability in broiler chickens. Poult Sci 2019, 98, 6787–6796. [Google Scholar] [CrossRef]
  42. Zhai, L.; Ning, Z.W.; Huang, T.; Wen, B.; Liao, C.H.; Lin, C.Y.; Zhao, L.; Xiao, H.T.; Bian, Z.X. Cyclocarya paliurus Leaves Tea Improves Dyslipidemia in Diabetic Mice: A Lipidomics-Based Network Pharmacology Study. Front Pharmacol 2018, 9, 973. [Google Scholar] [CrossRef] [PubMed]
  43. Mashek, D.G. Hepatic fatty acid trafficking: multiple forks in the road. Adv Nutr 2013, 4, 697–710. [Google Scholar] [CrossRef] [PubMed]
  44. Koo, S.H. Nonalcoholic fatty liver disease: molecular mechanisms for the hepatic steatosis. Clin Mol Hepatol 2013, 19, 210–215. [Google Scholar] [CrossRef]
  45. Doege, H.; Baillie, R.A.; Ortegon, A.M.; Tsang, B.; Wu, Q.; Punreddy, S.; Hirsch, D.; Watson, N.; Gimeno, R.E.; Stahl, A. Targeted deletion of FATP5 reveals multiple functions in liver metabolism: alterations in hepatic lipid homeostasis. Gastroenterology 2006, 130, 1245–1258. [Google Scholar] [CrossRef]
  46. Falcon, A.; Doege, H.; Fluitt, A.; Tsang, B.; Watson, N.; Kay, M.A.; Stahl, A. FATP2 is a hepatic fatty acid transporter and peroxisomal very long-chain acyl-CoA synthetase. Am J Physiol Endocrinol Metab 2010, 299, E384–E393. [Google Scholar] [CrossRef]
  47. Bougarne, N.; Weyers, B.; Desmet, S.J.; Deckers, J.; Ray, D.W.; Staels, B.; De Bosscher, K. Molecular Actions of PPARα in Lipid Metabolism and Inflammation. Endocr Rev 2018, 39, 760–802. [Google Scholar] [CrossRef]
  48. Menendez, J.A.; Lupu, R. Fatty acid synthase and the lipogenic phenotype in cancer pathogenesis. Nat Rev Cancer 2007, 7, 763–777. [Google Scholar] [CrossRef]
  49. Numa, S.; Nakanishi, S.; Hashimoto, T.; Iritani, N.; Okazaki, T. Role of acetyl coenzyme A carboxylase in the control of fatty acid synthesis. Vitam Horm 1970, 28, 213–243. [Google Scholar] [CrossRef]
  50. McFie, P.J.; Chumala, P.; Katselis, G.S.; Stone, S.J. DGAT2 stability is increased in response to DGAT1 inhibition in gene edited HepG2 cells. Biochim Biophys Acta Mol Cell Biol Lipids 2021, 1866, 158991. [Google Scholar] [CrossRef]
  51. Hong, C.; Tontonoz, P. Liver X receptors in lipid metabolism: opportunities for drug discovery. Nat Rev Drug Discov 2014, 13, 433–444. [Google Scholar] [CrossRef]
  52. Endo-Umeda, K.; Makishima, M. Liver X Receptors Regulate Cholesterol Metabolism and Immunity in Hepatic Nonparenchymal Cells. Int J Mol Sci 2019, 20. [Google Scholar] [CrossRef]
  53. Gao, Q.; Jia, Y.; Yang, G.; Zhang, X.; Boddu, P.C.; Petersen, B.; Narsingam, S.; Zhu, Y.J.; Thimmapaya, B.; Kanwar, Y.S.; et al. PPARα-Deficient ob/ob Obese Mice Become More Obese and Manifest Severe Hepatic Steatosis Due to Decreased Fatty Acid Oxidation. Am J Pathol 2015, 185, 1396–1408. [Google Scholar] [CrossRef] [PubMed]
  54. Fan, C.Y.; Pan, J.; Chu, R.; Lee, D.; Kluckman, K.D.; Usuda, N.; Singh, I.; Yeldandi, A.V.; Rao, M.S.; Maeda, N.; et al. Hepatocellular and hepatic peroxisomal alterations in mice with a disrupted peroxisomal fatty acyl-coenzyme A oxidase gene. J Biol Chem 1996, 271, 24698–24710. [Google Scholar] [CrossRef]
  55. Knottnerus, S.J.G.; Bleeker, J.C.; Wüst, R.C.I.; Ferdinandusse, S.; I.J., L; Wijburg, F.A.; Wanders, R.J.A.; Visser, G.; Houtkooper, R.H. Disorders of mitochondrial long-chain fatty acid oxidation and the carnitine shuttle. Rev Endocr Metab Disord 2018, 19, 93–106. [Google Scholar] [CrossRef] [PubMed]
  56. Qian, L.; Zhu, Y.; Deng, C.; Liang, Z.; Chen, J.; Chen, Y.; Wang, X.; Liu, Y.; Tian, Y.; Yang, Y. Peroxisome proliferator-activated receptor gamma coactivator-1 (PGC-1) family in physiological and pathophysiological process and diseases. Signal Transduct Target Ther 2024, 9, 50. [Google Scholar] [CrossRef] [PubMed]
  57. Schlaepfer, I.R.; Joshi, M. CPT1A-mediated Fat Oxidation, Mechanisms, and Therapeutic Potential. Endocrinology 2020, 161. [Google Scholar] [CrossRef]
  58. Sadana, P.; Zhang, Y.; Song, S.; Cook, G.A.; Elam, M.B.; Park, E.A. Regulation of carnitine palmitoyltransferase I (CPT-Ialpha) gene expression by the peroxisome proliferator activated receptor gamma coactivator (PGC-1) isoforms. Mol Cell Endocrinol 2007, 267, 6–16. [Google Scholar] [CrossRef]
  59. Finck, B.N.; Kelly, D.P. PGC-1 coactivators: inducible regulators of energy metabolism in health and disease. J Clin Invest 2006, 116, 615–622. [Google Scholar] [CrossRef]
  60. Ko, C.W.; Qu, J.; Black, D.D.; Tso, P. Regulation of intestinal lipid metabolism: current concepts and relevance to disease. Nat Rev Gastroenterol Hepatol 2020, 17, 169–183. [Google Scholar] [CrossRef]
  61. Wang, B.; Tontonoz, P. Liver X receptors in lipid signalling and membrane homeostasis. Nat Rev Endocrinol 2018, 14, 452–463. [Google Scholar] [CrossRef]
  62. Yu, L.; York, J.; von Bergmann, K.; Lutjohann, D.; Cohen, J.C.; Hobbs, H.H. Stimulation of cholesterol excretion by the liver X receptor agonist requires ATP-binding cassette transporters G5 and G8. J Biol Chem 2003, 278, 15565–15570. [Google Scholar] [CrossRef]
  63. Horton, J.D.; Shah, N.A.; Warrington, J.A.; Anderson, N.N.; Park, S.W.; Brown, M.S.; Goldstein, J.L. Combined analysis of oligonucleotide microarray data from transgenic and knockout mice identifies direct SREBP target genes. Proc Natl Acad Sci U S A 2003, 100, 12027–12032. [Google Scholar] [CrossRef] [PubMed]
  64. Zanotti, I.; Dall'Asta, M.; Mena, P.; Mele, L.; Bruni, R.; Ray, S.; Del Rio, D. Atheroprotective effects of (poly)phenols: a focus on cell cholesterol metabolism. Food Funct 2015, 6, 13–31. [Google Scholar] [CrossRef] [PubMed]
  65. Luo, J.; Yang, H.; Song, B.L. Mechanisms and regulation of cholesterol homeostasis. Nat Rev Mol Cell Biol 2020, 21, 225–245. [Google Scholar] [CrossRef]
  66. Zhang, X.; Yun, Y.; Lai, Z.; Ji, S.; Yu, G.; Xie, Z.; Zhang, H.; Zhong, X.; Wang, T.; Zhang, L. Supplemental Clostridium butyricum modulates lipid metabolism by reshaping the gut microbiota composition and bile acid profile in IUGR suckling piglets. J Anim Sci Biotechnol 2023, 14, 36. [Google Scholar] [CrossRef]
  67. Fleishman, J.S.; Kumar, S. Bile acid metabolism and signaling in health and disease: molecular mechanisms and therapeutic targets. Signal Transduct Target Ther 2024, 9, 97. [Google Scholar] [CrossRef] [PubMed]
  68. Ishibashi, S.; Schwarz, M.; Frykman, P.K.; Herz, J.; Russell, D.W. Disruption of cholesterol 7alpha-hydroxylase gene in mice. I. Postnatal lethality reversed by bile acid and vitamin supplementation. J Biol Chem 1996, 271, 18017–18023. [Google Scholar] [CrossRef]
  69. Russell, D.W. The enzymes, regulation, and genetics of bile acid synthesis. Annu Rev Biochem 2003, 72, 137–174. [Google Scholar] [CrossRef]
  70. Ding, L.; Yang, L.; Wang, Z.; Huang, W. Bile acid nuclear receptor FXR and digestive system diseases. Acta Pharm Sin B 2015, 5, 135–144. [Google Scholar] [CrossRef]
  71. Fu, X.; Menke, J.G.; Chen, Y.; Zhou, G.; MacNaul, K.L.; Wright, S.D.; Sparrow, C.P.; Lund, E.G. 27-hydroxycholesterol is an endogenous ligand for liver X receptor in cholesterol-loaded cells. J Biol Chem 2001, 276, 38378–38387. [Google Scholar] [CrossRef] [PubMed]
  72. Chen, M.; Yang, Z.; Gan, H.; Wang, Y.; Li, C.; Gao, Y. Investigation into potential mechanisms of metabolic syndrome by integrative analysis of metabolomics and proteomics. PLoS One 2022, 17, e0270593. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Effects of capsaicin supplementation on FA metabolism in weaned piglets under immune stress. Note: (A) mRNA abundance of genes related to FA uptake and transport. (B) mRNA abundance of genes related to FA synthesis. (C) mRNA abundance of FA oxidation-related genes. (D) Protein levels of PPARα, PGC1α and CPT1α. The column and its bars represent the mean and SE (n = 8), respectively. The results are expressed as the mean ± SEM (n = 8). NC, piglets fed a basal diet; LPS, piglets fed a basal diet and intraperitoneally injected with LPS before sampling; LCA, piglets fed CAP and injected intraperitoneally with LPS before sampling. * indicates a significant difference compared with the CON group (P < 0.05), and # indicates a significant difference compared with the LPS group (P < 0.05). CD36, differentiation cluster 36; FABP2, fatty acid binding protein 2; FATP4, fatty acid transporter 4; FFAR3, free fatty acid receptor 3; ACACA, acetyl-CoA carboxylase α; FASN, fatty acid synthase; SCD1, stearoyl-CoA desaturase 1; DGAT1, diacylglycerol acyltransferase 1; DGAT2, diacylglycerol acyltransferase 2; LXRα, liver X receptor α; CPT1A, carnitine palmitoyltransferase 1α; PPARα, peroxisome proliferator-activated receptor α; ATGL, fatty triglyceride lipase.
Figure 1. Effects of capsaicin supplementation on FA metabolism in weaned piglets under immune stress. Note: (A) mRNA abundance of genes related to FA uptake and transport. (B) mRNA abundance of genes related to FA synthesis. (C) mRNA abundance of FA oxidation-related genes. (D) Protein levels of PPARα, PGC1α and CPT1α. The column and its bars represent the mean and SE (n = 8), respectively. The results are expressed as the mean ± SEM (n = 8). NC, piglets fed a basal diet; LPS, piglets fed a basal diet and intraperitoneally injected with LPS before sampling; LCA, piglets fed CAP and injected intraperitoneally with LPS before sampling. * indicates a significant difference compared with the CON group (P < 0.05), and # indicates a significant difference compared with the LPS group (P < 0.05). CD36, differentiation cluster 36; FABP2, fatty acid binding protein 2; FATP4, fatty acid transporter 4; FFAR3, free fatty acid receptor 3; ACACA, acetyl-CoA carboxylase α; FASN, fatty acid synthase; SCD1, stearoyl-CoA desaturase 1; DGAT1, diacylglycerol acyltransferase 1; DGAT2, diacylglycerol acyltransferase 2; LXRα, liver X receptor α; CPT1A, carnitine palmitoyltransferase 1α; PPARα, peroxisome proliferator-activated receptor α; ATGL, fatty triglyceride lipase.
Preprints 193614 g001
Figure 2. Effects of LCA on the mRNA expression of cholesterol and BA metabolism-related genes in the liver of suckling piglets. Note: (A) mRNA abundance of genes related to cholesterol synthesis and efflux. (B) mRNA abundance of genes related to BA synthesis. (C) mRNA abundance of genes related to BA excretion. (D) Protein levels of LXRα and FXR. The column and its bars represent the mean and standard error (n = 8), respectively. The results are expressed as the mean ± SEM (n = 8). NC, piglets fed a basal diet; LPS, piglets fed a basal diet and intraperitoneally injected with LPS before sampling; LCA, piglets fed CAP and injected intraperitoneally with LPS before sampling. * indicates a significant difference compared with the CON group (P < 0.05), and # indicates a significant difference compared with the LPS group (P < 0.05). SREBP2, sterol regulatory element binding factor 2; HMGCR, hydroxymethylglutaryl coenzyme A reductase; NPC1L, Niemann-Pick C1-like protein 1; ACAT2, acyl-CoA cholesterol acyltransferase 2; ABCA1, ATP-binding cassette transporter A1; ABCG5, ATP-binding cassette transporter G subfamily member 5; ABCG8, ATP-binding cassette transporter G subfamily member 8; FXR, farnesoid X receptor; CYP7A1, cholesterol 7α-hydroxylase; CYP27A1, cholesterol 27α-hydroxylase; BSEP, bile salt outlet pump; NTCP, sodium-taurocholic acid co-transporting polypeptide; MRP2, multidrug resistance-associated protein 2; MRP3, multidrug resistance-associated protein 3; MRP4, multidrug resistance-associated protein 4; MDR3, multidrug resistance protein 3.
Figure 2. Effects of LCA on the mRNA expression of cholesterol and BA metabolism-related genes in the liver of suckling piglets. Note: (A) mRNA abundance of genes related to cholesterol synthesis and efflux. (B) mRNA abundance of genes related to BA synthesis. (C) mRNA abundance of genes related to BA excretion. (D) Protein levels of LXRα and FXR. The column and its bars represent the mean and standard error (n = 8), respectively. The results are expressed as the mean ± SEM (n = 8). NC, piglets fed a basal diet; LPS, piglets fed a basal diet and intraperitoneally injected with LPS before sampling; LCA, piglets fed CAP and injected intraperitoneally with LPS before sampling. * indicates a significant difference compared with the CON group (P < 0.05), and # indicates a significant difference compared with the LPS group (P < 0.05). SREBP2, sterol regulatory element binding factor 2; HMGCR, hydroxymethylglutaryl coenzyme A reductase; NPC1L, Niemann-Pick C1-like protein 1; ACAT2, acyl-CoA cholesterol acyltransferase 2; ABCA1, ATP-binding cassette transporter A1; ABCG5, ATP-binding cassette transporter G subfamily member 5; ABCG8, ATP-binding cassette transporter G subfamily member 8; FXR, farnesoid X receptor; CYP7A1, cholesterol 7α-hydroxylase; CYP27A1, cholesterol 27α-hydroxylase; BSEP, bile salt outlet pump; NTCP, sodium-taurocholic acid co-transporting polypeptide; MRP2, multidrug resistance-associated protein 2; MRP3, multidrug resistance-associated protein 3; MRP4, multidrug resistance-associated protein 4; MDR3, multidrug resistance protein 3.
Preprints 193614 g002
Figure 3. OPLS-DA analysis. Note: A: NC vs LPS OPLS-DA score plot; B:LPS vs LCA OPLS-DA score plot.
Figure 3. OPLS-DA analysis. Note: A: NC vs LPS OPLS-DA score plot; B:LPS vs LCA OPLS-DA score plot.
Preprints 193614 g003
Figure 5. Effects of capsaicin on the correlation between liver lipid metabolism-related indicators and differential metabolites in immune-stressed piglets. Note: A: NC group compared with LPS group; B: LPS group compared with LCA group; C: LPS group was related to lipid metabolism in LCA group.
Figure 5. Effects of capsaicin on the correlation between liver lipid metabolism-related indicators and differential metabolites in immune-stressed piglets. Note: A: NC group compared with LPS group; B: LPS group compared with LCA group; C: LPS group was related to lipid metabolism in LCA group.
Preprints 193614 g005
Table 1. Composition and nutritional levels of the basal diet.
Table 1. Composition and nutritional levels of the basal diet.
Items Content
28-41d 42-62d
Ingredient (%)
Maize (first-grade) 36.25
Maize (second-grade) 33.50
Wheat 26.00
Barley 15.00
Wheat flour (first-grade) 15.00
Broken rice 20.00
Full-fat rice bran 6.00
Extruded full-fat soybean(35%) 2.50
Soybean meal (46%) 13.00 15.00
Fermented soybean meal(50%) 3.00
Super steam fish meal (67%) 1.25
Glucose 2.00
Soybean oil 1.00 0.50
Premix1 6.00 4.00
Total 100.00 100.00
Nutrient levels2
Digestible energy (MJ/kg) 15.27 13.41
Crude protein (%) 17.51 15.95
Calcium (%) 0.65 0.63
Total phosphorus (%) 0.38 0.38
Crude fiber (%) 2.06 2.76
Crude ash (%) 4.43 4.89
SID Lysine (%) 1.20 1.00
Note: 1Premix for per kilogram diet included: lysine, 4.6 g; methionine, 1.2 g; threonine, 0.5 g; NaCl, 0.3 g; vitamin A, 12000 IU; vitamin E, 80 IU; vitamin D3, 2500 IU; vitamin K3, 3.0 mg; biotin, 0.2 mg; nicotinic acid, 25 mg; pantothenic acid, 30 mg; riboflavin, 3.6 mg; thiamin, 1.0 mg; pyridoxine, 1.5 mg; folic acid, 2.0 mg; cobalamin, 12 μg; choline chloride, 800 mg; iron, 120 mg; zinc, 100 mg; copper, 8.8 mg; manganese, 80 mg; iodine, 0.3 mg; selenium, 0.25 mg; 2All nutrient levels were analyzed values except for the digestible energy and SID lysine.
Table 2. Primer sequence.
Table 2. Primer sequence.
Gene Primer sequence (5’→3’) Accession numbers Size, bp
ABCA1 F: CGTCTCCGCTATCTCCAACC
R: CACAAAGGCTCCCTCTCTGG
NM_001317080.1 121
ABCG5 F: CGTGTGCTACTGGACTCTGG
R: ACCACACTGTTGACCACGTT
XM_021087571.1 150
ABCG8 F: CCTTCCTCCGATGGTGCTTT
R: CCATGGCATTGAGGATTGCG
XM_021087570.1 120
ACACA F: GCCATGTTATTGCTGCTCGG
R: ATTCATGAAGTCCGCCTGCA
NM_001114269.1 147
ACAT2 F: AAGATCAGGACAGGCTTGCC
R: GCATTAGCTGGGGTGACTGT
XM_001928345.4 226
BSEP F: TATTGCTCGGGCCATCGTAC
R: CCGACCTTCTCTGGCTTTGT
XM_003133457.5 121
CD36 F: CTGGCCGTGTTTGGAGGTAT
R: TCCGTGCCTGTTTTAACCCA
XM_021102279.1 125
CPT1A F: TGGTGTCCAAATACCTCGCC
R: CTCCGCTCGACACATACTCC
NM_001129805.1 144
CYP27A1 F: CCTTCGTCAGATCTGTCGGG
R: ATCCAGGTATCGCCTCCAGT
NM_001243304.1 104
CYP7A1 F: AGCATTGACCCCAGTGATGG
R: GGGGTCTCAGGACAAGTTGG
KP687249.1 130
DGAT1 F: TACTACTTCCTCCTGGCCCC
R: TGCAGCTGGATGAGGAACAG
NM_214051.1 119
DGAT2 F: GGGTCCTGTCTTTCCTCGTG
R: CGCCAGCCAAGTGAAGTAGA
NM_001160080.1 107
FABP2 F: GCCTGGAAGATAGACCGCAA
R: CCCAGTGAGTTCAGTTCCGT
NM_001031780.1 228
FABP4 F: ATGGCCAAACCCAACCTGAT
R: CCCACTTCTGCACCTGTACC
NM_001002817.1 190
FATP4 F: TGAAGGTGAAGGCCAAGGTC
R: CACGCTGCTCGAGTAGTCAT
JX103441.1 164
FFAR3 F: CCTGGTGTGCATACTCAGCA
R: CCCAAAGCAGACGAGGAAGT
JX566878.1 100
FXR F: TGACAAAGACGACCCGACTG
R: AAACCTTTGCACCCCTCACA
KF597010.1 127
GAPDH F: GGAGAACGGGAAGCTTGTCA
R: GCCTTCTCCATGGTCGTGAA
XM_021091114.1 138
HMGCR F: AAAGGAGGCATTCGACAGCA
R: TCACCTGACCTGGACTGGAA
NM_001122988.1 105
LXRα F: ACAAAAGCGGAAAAAGGGGC
R: TTGATGACACTGCGACGGAA
AB254405.1 141
MDR3 F: AACGCAGACTTGATCGTGGT
R: GGACGCTGACCATGGAGAAA
XM_013989596 106
MRP2 F: TCCTACGAGGTGACAGAGGG
R: GTCTCTAGATCCACCGCAGC
XM_021073710.1 134
MRP3 F: GCTGGAGAACCTGAAGAACG
R: TCAGGCTCCTCCTCATTCTC
NM_001164723.1 121
MRP4 F: GCAGAAGCTGGAGAAGATGG
R: TCCTCCTCATTCTCCTCCTG
NM_001352764.1 124
NPC1L F: GTCCCCTCCTCTCTGGTGAT
R: GGTCAGGGCTCCTAGGAAGA
XM_005673340.3 219
NTCP F: GCTGCTGCTATCTTCTGCTT
R: CCAGGAGAAGGTGAAGGTGA
NM_001128475.1 128
PPARα F: GCAATAACCCGCCTTTCGTC
R: CTCCTTGTTCTGGATGCCGT
NM_001044526.1 101
SCD1 F: AGAATGGAGGGGGCAAGTTG
R: GGGCCCTCCTTATCCTGGTA
NM_213781.1 109
Table 3. Effects of capsaicin on FA metabolites and their corresponding enzymes in the serum and liver of weaned piglets.
Table 3. Effects of capsaicin on FA metabolites and their corresponding enzymes in the serum and liver of weaned piglets.
Items Group P value
CON LPS LCA NC vs LPS LPS vs LCA
Serum
TG, mmol/L 0.62 ± 0.06 1.16 ± 0.18 0.70 ± 0.07 0.013 0.033
NEFA, μmol/L 47.76 ± 6.34 306.52 ± 51.83 215.14 ± 29.30 0.002 0.147
FABP4, ng/mL 34.00 ± 0.75 32.13 ± 0.3 34.30 ± 0.63a 0.045 0.008
Liver
TG, μmol/gprot 41.89 ± 3.07 55.52 ± 2.67 44.59 ± 3.14 0.005 0.019
NEFA, mmol/gprot 0.61 ± 0.03 1.01 ± 0.13 0.66 ± 0.05 0.019 0.036
LPL, U/gprot 184.66 ± 20.56 132.94 ± 20.70 211.04 ± 19.03 0.098 0.015
HL, U/gprot 93.79 ± 16.75 92.22 ± 7.08 161.75 ± 9.82 0.933 < 0.001
TL, U/gprot 278.46 ± 33.41 225.17 ± 23.51 372.80 ± 24.40 0.213 0.001
Note: The results are expressed as mean ± SEM (n = 8). NC, piglets fed a basal diet; LPS, piglets fed a basal diet and intraperitoneally injected with LPS before sampling; lCA, piglets fed CAP and injected intraperitoneally with LPS before sampling. * indicates a significant difference compared with the CON group (P < 0.05), and # indicates a significant difference compared with the LPS group (P < 0.05). TG, triglyceride; NEFA, non-esterified fatty acids; HL, liver lipase; LPL, lipoprotein lipase; TL, total lipase; FABP4, fatty acid binding protein 4.
Table 4. Effects of capsaicin supplementation on the content of TC and its metabolites in the serum and liver of weaned piglets.
Table 4. Effects of capsaicin supplementation on the content of TC and its metabolites in the serum and liver of weaned piglets.
项目Items 分组 Group PP value
CON LPS LCA NC vs. LPS LPS vs. LCA
Serum
TC, mmol/L 2.43 ± 0.05 2.15 ± 0.07 1.81 ± 0.04 0.07 0.01
HDL-C, mmol/L 1.08 ± 0.07 0.54 ± 0.06 0.61 ± 0.04 < 0.001 0.323
LDL-C, mmol/L 1.50 ± 0.04 1.79 ± 0.19 1.19 ± 0.06 0.172 0.016
TBA, μmol/L 28.64 ± 4.96 174.07 ± 21.80 79.77 ± 19.03 < 0.001 0.006
Liver
TC, μmol/g 9.69 ± 0.36 10.83 ± 0.25 11.38 ± 0.55 0.021 0.384
HDL-C, μmol/g 7.03 ± 0.07 7.15 ± 0.49 7.48 ± 0.3 0.812 0.580
LDL-C, μmol/gprot 2.60 ± 0.05 3.61 ± 0.07 2.74 ± 0.23 < 0.001 0.003
TBA, μmol/gprot 5.66 ± 0.55 3.68 ± 0.24 5.03 ± 0.30 0.008 0.004
Note: The results are expressed as the mean ± standard error (n = 8). NC, piglets fed a basal diet; LPS, piglets fed a basal diet and intraperitoneally injected with LPS before sampling; LCA, piglets fed CAP and injected intraperitoneally with LPS before sampling. * indicates a significant difference compared with the CON group (P < 0.05), and # indicates a significant difference compared with the LPS group (P < 0.05). TC, total cholesterol; HDL-C, high-density lipoprotein cholesterol; LDL-C, low-density lipoprotein cholesterol; TBA, total bile acid.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.
Copyright: This open access article is published under a Creative Commons CC BY 4.0 license, which permit the free download, distribution, and reuse, provided that the author and preprint are cited in any reuse.
Prerpints.org logo

Preprints.org is a free preprint server supported by MDPI in Basel, Switzerland.

Subscribe

Disclaimer

Terms of Use

Privacy Policy

Privacy Settings

© 2026 MDPI (Basel, Switzerland) unless otherwise stated