A Novel Variant of the ACTRT1 Gene is Potentially Associated with Oligoasthenoteratozoospermia, Acrosome Detachment, and Fertilization Failure

1. Introduction

Male infertility affects around 7% of men worldwide and contributes to nearly half of all infertility cases in couples [1]. Despite advances in molecular genetics, the cause of azoospermia, severe oligozoospermia, and rare syndromic forms of astheno-/teratozoospermia remains unclear for many patients [2]. Many idiopathic cases are attributed to disturbances during the final phase of spermatogenesis, known as spermiogenesis, wherein round spermatids undergo extensive remodeling to form mature spermatozoa [3]. This process involves a series of highly coordinated morphological changes, such as nuclear elongation, chromatin condensation, acrosome biogenesis, the development of the flagellar axoneme and the periaxonemal structures, the assembly of the mitochondrial sheath in the midpiece, and the extrusion of residual cytoplasm [3]. These changes are critical for motility and fertilization competence [4].

The perinuclear theca (PT), a major cytoskeletal component of the sperm head, consists of various cytosolic and nuclear proteins [5]. The PT is conventionally divided into two functionally distinct regions: the subacrosomal region (SAR), located between the inner acrosomal membrane and the nuclear envelope, and the postacrosomal region (PAR), positioned between the plasma membrane and the nuclear envelope [6,7]. PT-SAR proteins are derived from acrosomal vesicles during acrosome biogenesis, whereas PT-PAR proteins are synthesized in the cytoplasmic lobe and transported across the manchette [8]. Thus, one of the critical functions of PT-SAR proteins is to anchor the developing acrosomes to the sperm nucleus, whereas PT-PAR proteins (e.g. phospholipase C zeta, PLCζ) are primarily involved in the later stages of fertilization process, such as oocyte activation [5,6,7,9].

ACTRT1 (Actin-Related Protein Testis 1), which is encoded by a single-exon ACTRT1 gene (OMIM: *300487) located on the X chromosome (Xq25), is a vital component of the PT-SAR-specific actin-related protein complex (ACTRT1-ACTRT2-ACTRT3-ACTL7A-ACTL7B-ACTL9) which anchors developing acrosomes to the nucleus [10]. This complex immunoprecipitates with the inner acrosomal membrane protein SPACA1 and the nuclear envelope proteins PARP11 and SPATA46 [11]. In Actrt1 knockout mice, the loss of Actrt1 attenuates the interaction between Actl7a and Spaca1 proteins, resulting in severe subfertility characterized by morphologically abnormal sperm heads with detached acrosomes and partial fertilization failure [11]. Similarly, a recent human study identified a 110-kb hemizygous loss-of-function deletion affecting the ACTRT1 gene in infertile men, presenting with severe oligoteratozoospermia, detached acrosomes, and markedly reduced fertilization rates [12]. As demonstrated by Q. Zhang et al., Actrt1 and Actl7a exhibit a spatiotemporal localization in male germ cells. These proteins are specifically targeted to the SAR in round and elongated spermatids to mediate acrosome-nucleus anchoring during acrosome biogenesis and subsequently relocate to the PAR in mature spermatozoa, positioning them for potential roles in later fertilization stages, such as oocyte activation [11]. Notably, loss or reduced expression and/or abnormal localization of PLCζ has been reported in ACTRT1/ACTL7A/ACTL9 mutant patients as well as in Actrt1-, Actl7a- and Actl9-deficient mice [11,12,13,14,15,16,17,18,19,20,21,22,23,24]. Furthermore, disruption of ACTL7A or ACTL9 has been consistently shown to cause acrosome detachment, total fertilization failure, and male infertility in both mice and humans [13,14,15,16,17,18,19,20,21,22,23,24].

In the present study we identified a novel hemizygous ACTRT1 gene variant in a patient with severe oligoasthenoteratozoospermia and specific morphological abnormality, characterized by the acrosome detachment from the sperm nucleus, providing new insights into the genetic basis of male infertility.

2. Materials and Methods

2.1. Patient

A 33-year-old male patient was referred to the Research Centre for Medical Genetics for mediсal genetic counseling and examination due to primary infertility. His clinical history included recurrent severe oligoasthenoteratozoospermia (sOAT), as well as the surgical treatment of right inguinal cryptorchidism via orchiectomy, which was performed in December 2022. Preoperative scrotal ultrasonography revealed significant testicular asymmetry, with a preserved left testicular volume of 16.5 ml and right testicular hypoplasia of 7.64 ml, as well as complete inguinal ectopia. Additionally, a grade I left-sided varicocele was identified. An endocrine evaluation revealed elevated levels of luteinizing hormone (11.50 mIU/mL; reference range: 1.70–8.60), indicating compensated hypogonadism [25]. Normal follicle-stimulating hormone levels (11.30 mIU/mL; reference range: 1.50–12.40) and normal total testosterone levels (6.29 ng/mL; reference range: 2.49–8.36) supported this finding. Standard genetic analysis revealed a normal 46,XY karyotype with no evidence of Y-chromosome microdeletions. Screening for the 22 most common pathogenic CFTR variants was negative. Analysis of the polymorphic CAG repeat region of the androgen receptor gene revealed 21 repeats, which is within normal limits. The physical examination was unremarkable, with anthropometric measurements of 178 cm height and 78 kg weight (BMI 24.6 kg/m²).

The 32-year-old female partner underwent a complete evaluation, that demonstrated normal ovarian reserve parameters and a normal female karyotype (46,XX). The couple underwent an assisted reproductive technology protocol involving intracytoplasmic sperm injection with ejaculated sperm. Ovarian stimulation using a gonadotropin-releasing hormone antagonist protocol resulted in the retrieval of 12 metaphase II oocytes. Despite an optimal ovarian response and sufficient mature oocytes, the cycle was complicated by severe fertilization failure, with only one oocyte demonstrating normal fertilization. According to the standard grading criteria, the resulting embryo had poor morphology (grade 3) and did not implant after transfer. A subsequent ICSI cycle incorporating assisted oocyte activation (AOA) with calcium ionophore is planned due to the fertilization failure observed, in order to overcome the suspected oocyte activation deficiency.

Written informed consent was obtained from all examined individuals. The study was approved by the Ethics Committee of the Research Centre for Medical Genetics (protocol code: №4/3; date of approval: April 19, 2021).

2.2. Standard Semen Examination

Semen samples were collected by masturbation after 3-5 days of sexual abstinence. The analyzed semen parameters included ejaculate volume, viscosity and pH, concentration and total sperm count, motility, vitality and morphology. Sperm vitality (%), motility (%), morphology (%) and sperm count were determined by light microscopy using a Nikon Ci microscope (Nikon, Japan). A standard semen analysis was performed according to the World Health Organization laboratory guideline (WHO, 2010), and the semen parameters were interpreted based on the reference values established in these guideline [26].

2.3. Transmission Electron Microscopy

For the transmission electron microscopy (TEM) analysis, semen samples were obtained from the patient and a control group of 24 fertile, normozoospermic men aged 35 years or younger who had fathered a child within the past 12 months. All control samples exhibited normal semen parameters. After liquefaction, samples from the patient and controls were fixed with a 2.5% glutaraldehyde solution in a 0.1 M cacodylate buffer solution (pH 7.2–7.4). The samples were then treated with 1% osmic acid and embedded in epoxy resin. Ultrathin sections were prepared using a Reichert-Jung Ultracut E ultramicrotome (Vienna, Austria) and mounted on copper grids covered with Formvar film. The sections were then contrasted using a 1% aqueous solution of uranyl acetate and a lead citrate solution. The preparations were examined at 80 kV using a JEM-1011 transmission electron microscope (JEOL, Akishima, Japan), which was equipped with an Orius SC1000 W camera (Gatan Inc., Pleasanton, CA, USA). Results for each parameter are expressed as percentages.

2.4. Isolation of Genomic DNA

Genomic DNA of the proband and his mother was extracted from peripheral blood leukocytes using a standard Wizard® Genomic DNA Purification Kit (Promega, USA) according to the manufacturer's protocol.

2.5. Whole Exome Sequencing

Whole exome sequencing (WES) was performed on the proband's DNA sample. Libraries were prepared from fragmented genomic DNA using the KAPA Hyper Prep Kit (Roche, Switzerland), and target enrichment was carried out using KAPA HyperExome probes (Roche, Switzerland). Paired-end sequencing (2 × 150 bp) was conducted on an Illumina NextSeq 500 platform.

The resulting raw data were aligned to the human reference genome (GRCh37/hg19) using NGSData software. Sequencing achieved a mean coverage of 78x, with 97% of target regions covered at least 10x. Variant calling and annotation were performed according to the standard HGVS nomenclature. The identified variant was visualized using the Integrative Genomics Viewer v.2.17.4 (IGV), and its pathogenicity was assessed in accordance with the guidelines of the American College of Medical Genetics and Genomics (ACMG) [27].

2.6. Sanger Sequencing

To validate the variant identified by WES, exon 1 of the ACTRT1 gene was amplified from genomic DNA using PCR with the following primers, synthesized by Eurogen (Moscow, Russia): forward 5′ AGAGGTCATGATGGATGCACCA, reverse 5′ TTGGGGATGAGCTGTACCAAGT. PCR was performed in 25 µl PCR reactions containing 1×PCR buffer, 2 mM MgCl₂, 0.2 mM of each dNTP, 0.5 mM of each primer, 0,3 U of Taq DNA polymerase (Syntol, Russia), and 1 µL of genomic DNA. Cycling was performed using a GeneAmp PCR System 9700 Thermal Cycler (Applied Biosystems) with the following cycle program: Initial denaturation at 95°C for 2 minutes followed by 35 cycles of 95°C for 30 seconds, 64°C for 30 seconds and 72°C for 30 seconds, followed by a final extension of 5 minutes at 72°C. Five µL of the PCR products were visualized on 2% agarose gels using ethidium bromide staining and UV light transillumination. Amplicons were purified using an Exonuclease I 20 U/μL/FastAP Thermosensitive Alkaline Phosphatase 1 U/μL (Thermo Fisher Scientific, USA) mixture. Purified PCR products were sequenced using the BigDye Terminator Kit v3.1 (Thermo Fisher Scientific, USA) and Applied Biosystems 3500 DNA Analyzer (Thermo Fisher Scientific, USA) according to the manufacturer's protocol. The result of the sequences data was visualized by Chromas software v.2.6.6 (Technelysium, Australia).

2.7. In Silico Pathogenicity Prediction and Structural Analysis of Detected Variant

The potential pathogenicity of the identified missense variant was assessed using a comprehensive suite of bioinformatics tools, including: SIFT, SIFT4G, PROVEAN, MutationTaster, LRT, FATHMM, DANN, MetaLR, MetaSVM, M-CAP, MutationAssessor, MutPred, MVP, PrimateAI, EIGEN, EIGEN-PC and DEOGEN2.

The evolutionary conservation of the affected amino acid position was analyzed using the UCSC Genome Browser (https://genome.ucsc.edu/, accessed on 20 June 2024). The impact of the amino acid substitution on protein structure was visualized and analyzed using the Project HOPE web portal (https://www3.cmbi.umcn.nl/hope/, accessed on 17 June 2024) [28].

3. Results

3.1. Semen Analysis

Repeated semen analyses revealed low sperm concentrations ranging from 0.2 to 2.8 (1.1 ± 1.2) million per milliliter and correspondingly reduced total sperm counts of 3.2 ± 3.5 × 10⁶ per ejaculate in the four examined samples (Table S1). The sperm motility parameters decreased dramatically. Progressive motility (PR) was severely low at 0–9% (5.3 ± 3.8%), and total motility (PR + NP) was below the reference range of ≥40% in two samples (26% and 37%). However, it was normal in the last two samples (42% and 51%). Sperm vitality exhibited considerable variability (71.5 ± 21.4%), ranging from severely compromised to normal (45–91%). Severe teratozoospermia was also consistently observed in all examined samples (99-100% abnormal morphology), with only 0.5% ± 0.6% of gametes being morphologically normal. Head defects were the predominant morphological abnormality, present in 65–75% (70.0 ± 4.5%) of gametes. The volume and pH of the ejaculate were within the normal range (2.9 ± 0.4 mL and 7.6 ± 0.1, respectively). The leukocyte concentration was within the normal reference range (0.16 ± 0.11 million/mL), thereby excluding an inflammatory etiology (Table S1).

3.2. Transmission Electron Microscopy

TEM revealed significant ultrastructural abnormalities in the patient's spermatozoa (Figure 1C,D,E,E1), but not in the control group (Figure 1A,B, Table S2).

A comparative ultrastructural analysis of sperm morphology revealed an absence of spermatozoa with intact heads in the patient (0%), in contrast to the control group, in which such cells constituted 5.4 ± 1.7% (range 4-9%). Although the incidence of acrosome hypoplasia in the patient (42%) was within the normal reference range (46.0 ± 11.7%, range 7-61%), other critical parameters showed significant deviations. Notably, the proportion of spermatozoa with impaired chromatin condensation was markedly higher at 54% versus 17.0 ± 8.3% (range 7-29%) in the control group. Similarly, spermatozoa with excessive residual cytoplasm accounted for 31% of the patient's sample, compared to 6.2 ± 3.9% (range 1-13%) in the control group. The percentage of spermatozoa with an enlarged subacrosomal space was 49%, compared to a control value of 5.3 ± 3.4% (range 1-11%). Additionally, the incidence of flagellar axoneme abnormalities was substantially higher in the patient (31%) than in the control group (9.7 ± 7.6%, range 1-30%).

The most pronounced pathological features were the complete absence of normally formed sperm heads, characterized by detachment of the inner acrosomal membrane from the sperm nucleus, severe chromatin condensation defects, excessive cytoplasmic retention, and a high percentage of enlarged subacrosomal spaces (Figure 1C,D,E,E1).

Because of the high prevalence of specific ultrastructural defects revealed by the TEM results, the patient was referred for WES to identify an underlying genetic etiology.

3.3. Molecular Genetic, Segregation and Bioinformatic Study Results

Initial variant filtering and annotation focused on known genes associated with male infertility revealed no pathogenic, likely pathogenic, or variants of unknown clinical significance in established oligoteratozoospermia-related genes. Subsequent analysis identified a novel hemizygous missense variant in the ACTRT1 gene (NM_138289.4), located on the X chromosome (locus Xq25). This variant is characterized by a c.821G>C substitution that results in an amino acid change from glycine to alanine at position 274 (Figure 2). A comprehensive review of the Online Mendelian Inheritance in Man (OMIM) database revealed no established associations between the ACTR1 gene and male infertility. This suggests that this finding may represent a novel genotype-phenotype correlation. The identified nucleotide sequence variant is not registered in the control sample Genome Aggregation Database (gnomAD v2.1.1) (http://gnomad.broadinstitute.org/).

Evolutionary conservation analysis revealed that the affected glycine residue at position 274 is highly conserved among vertebrate species, indicating significant structural or functional constraints at this site of the ACTRT1 protein (Figure 2A).

Sanger sequencing was performed for the proband and his mother, and the results confirmed an X-linked recessive inheritance pattern. The variant was hemizygous in the proband and heterozygous in his asymptomatic mother (Figure 2C). This pattern of inheritance is consistent with Mendelian inheritance for X-chromosomal disorders and suggests that the variant may be pathogenic in a hemizygous state for male patients.

The variant c.821G>C is considered likely pathogenic by pathogenicity prediction algorithms for missense variants (SIFT, SIFT4G, BLOSUM, DANN, FATHMM, PrimateAI, MetaLR, MetaSVM, DEOGEN2, EIGEN, EIGEN PC, M-CAP, Mutation assessor, MutPred, MVP, PROVEAN, LRT, MutationTaster).

We have also created a 3D model of the mutant ACTRT1 protein and compared it with the normal protein using the Project HOPE3D tool (Figure 3).

The p.(Gly274Ala) substitution in the ACTRT1 introduces significant steric constraints due to the substantial difference in side-chain volume between glycine and alanine. The larger alanine residue cannot be accommodated within the core structure, leading to unfavorable torsion angles and steric clashes. The unique conformational flexibility of glycine is essential at this position, as it is the only residue capable of adopting the required backbone conformation without distortion. Substitution with alanine is predicted to disrupt the local protein architecture, an effect that would likely propagate to destabilize the tertiary structure of ACTRT1 and compromise its biological function. Therefore, glycine is exclusively required to maintain the native protein fold at this position.

Finally, the identified variant chrX:127185365G>C; NM_138289.3: c.821G>C, p.(Gly274Ala) in the ACTRT1 gene was classified as a variant of uncertain clinical significance (VoUS) according to the ACMG guidelines (PM2, PP3).

4. Discussion

The ACTRT1 gene encodes the actin-related protein T1, a critical structural component of a testis-specific ARP complex (ACTRT1-ACTRT2-ACTL7A-ACTL7B-ACTL9) within the PT, which is indispensable for anchoring the acrosome to the sperm nucleus and fertilization [11]. Despite its testis-restricted expression profile, the previously established OMIM phenotype associated with ACTRT1 gene was Bazex-Dupré-Christol syndrome (BDCS; OMIM: 301845), an X-linked dominant genodermatosis characterized by follicular atrophoderma, congenital hypotrichosis, and early-onset multiple basal cell carcinomas [29,30]. However, recent evidence has definitively refuted this association. Liu et al. (2022) demonstrated that BDCS is actually caused by small intergenic tandem duplications at Xq26.1, leading to dysregulation of the ARHGAP36 gene [31]. Importantly, no rare coding variants in the ACTRT1 gene were identified in 7 of 8 BDCS families. Furthermore, immunofluorescence studies revealed the absence of ACTRT1 expression in relevant hair follicle compartments [31]. Therefore, ACTRT1 has been excluded as a causative gene for BDCS. Its actual phenotypic consequences remain to be fully elucidated; however, its testis-specific expression and structural role suggest potential involvement in male reproductive function, which requires further validation.

The initial link between ACTRT1 and male infertility was established in a large-scale sequencing study. S. Chen et al. (2020) conducted a whole exome sequencing analysis of 314 Chinese men with non-obstructive azoospermia (NOA) and severe oligozoospermia and identified ACTRT1 as one of 20 novel candidate genes for male infertility [32]. Among the patients in their cohort, two patients with NOA were found to have hemizygous variants in the ACTRT1 gene [32]. Notably, a meiotic arrest phenotype was revealed by testicular histopathology in both patients.

Subsequently, Y. Sha et al. (2021) proposed a more specific yet controversial association [33]. They identified two unrelated individuals with hemizygous missense variants in ACTRT1 in a cohort of 34 infertile men with acephalic spermatozoa syndrome (ASS). The patients presented with asthenoteratozoospermia, characterized predominantly by acephalic sperm. Immunofluorescence staining revealed displaced and diffuse ACTRT1 expression in the patients' sperm. To validate their findings, the researchers generated an Actrt1-knockout mouse model using CRISPR/Cas9 and reported that approximately 60% of the sperm were headless, with TEM revealing significant defects in the head-tail coupling apparatus (HTCA). Based on this, they proposed ACTRT1 as a gene associated with ASS. Following artificial insemination with optimized sperm, both patients and their partners achieved successful pregnancy and delivery.

However, this conclusion was challenged by a series of studies from another research group. X. Zhang et al. (2022) reanalyzed the role of ACTRT1, identifying it as a candidate gene in patients with syndromic teratozoospermia characterized not by headless sperm, but specifically by the detachment of the acrosome from the sperm nucleus [11]. This refined phenotype was strongly supported by functional mouse model data. Their Actrt1-knockout mice were severely subfertile, exhibiting deformed sperm heads and a high proportion of sperm with detached acrosomes, as confirmed by TEM. These results allowed to reveal that ACTRT1 interacts with ACTRT2, ACTL7A, and ACTL9 to form a sperm-specific PT-ARP complex, which anchors the developing acrosome to the nucleus by connecting the inner acrosomal membrane protein SPACA1 with nuclear envelope proteins such as PARP11 and SPATA46. Importantly, their Actrt1-KO mice did not exhibit the headless sperm phenotype reported by Sha et al., despite using a similar knockout strategy. The authors argued that there was no evidence that ACTRT1 regulates the HTCA and deemed the evidence linking it to ASS insufficient.

The human relevance of this acrosome detachment phenotype was conclusively demonstrated by Q. Zhang et al. (2024) [12]. They reported two infertile Chinese men with a ~110 kb X-chromosomal microdeletion encompassing the entire ACTRT1 gene. Semen analysis revealed sOT, and TEM confirmed sperm head deformation due to acrosome detachment, perfectly mirroring the mouse model. The deletion was inherited from the patients' mothers, consistent with X-linked recessive inheritance. Western blot and immunostaining of patient sperm showed that ACTRT1 deficiency led to downregulated expression and ectopic distribution of ACTL7A and PLCζ, key proteins for oocyte activation, explaining the observed fertilization failure. The authors successfully overcame this challenge by using the ICSI procedure combined with artificial oocyte activation (AOA) on one patient.

In the study by H. Zhou et al. (2024), a patient with oligoasthenoteratozoospermia (OAT) was found to carry a hemizygous missense mutation in the ACTRT1 gene [34].

The clinical and genetic features of all male patients with reported ACTRT1 variants are summarized in Table 1.

In our patient, a history of right inguinal cryptorchidism requiring orchiectomy could certainly be a contributing factor to his severe oligozoospermia. However, the specific ultrastructural defects revealed by TEM—particularly the abnormal sperm head morphology characterized by detachment of the inner acrosomal membrane from the nucleus—are highly consistent with the phenotypes observed in both Actrt1-knockout mouse models and in patients with complete ACTRT1 deletion. However, a comprehensive comparison with other reported ACTRT1 variant cases is limited. For patients with non-obstructive azoospermia or severe oligoasthenoteratozoospermia TEM analysis was precluded due to the absence or critically low number of spermatozoa in the ejaculate. This makes it impossible to determine whether acrosomal detachment is a universal feature. Furthermore, data on the percentage of spermatozoa with immature chromatin or flagellar axonemal abnormalities are unavailable in other patients with identified ACTRT1 variants. In our case, the significant finding is the high proportion (54%) of spermatozoa with non-condensed chromatin, as defective chromatin compaction is a well-established factor that can impair paternal DNA integrity and potentially lead to failures in embryonic cleavage, division, and early development. These findings suggest that the phenotypic spectrum of ACTRT1-related infertility may extend beyond acrosomal defects to include nuclear and abnormalities, which could collectively contribute to variable clinical and ART outcomes observed among patients.

These findings provide strong circumstantial evidence linking this specific genetic variant to the observed spermatological profile, the characteristic ultrastructural defects, and the clinical outcome of failed fertilization. However, direct functional studies are required to definitively characterize the pathogenic impact of the p.(Gly274Ala) substitution on the ACTRT1 protein.

As demonstrated by the literature, male patients with hemizygous variants in the ACTRT1 gene exhibit a remarkably heterogeneous clinical spectrum, ranging from asthenoteratozoospermia and acephalic spermatozoa syndrome to severe oligozoospermia and non-obstructive azoospermia with meiotic arrest. This significant phenotypic variability highlights the importance of collecting and reporting detailed clinical cases that integrate comprehensive semen analysis, TEM, and genetic data. These efforts are essential for delineating precise genotype-phenotype correlations and understanding the full pathogenic potential of ACTRT1 gene variants in human male infertility.

5. Conclusions

This study provides a comprehensive clinical and genetic characterization of a novel ACTRT1 gene variant in a patient with severe oligoteratozoospermia and fertilization failure. The results contribute to the growing evidence linking ACTRT1 deficiency to specific head defects with acrosomal detachment and other sperm abnormalities. These findings support the inclusion of ACTRT1 in genetic screening panels for azoospermic or severe oligoteratozoospermic patients, as well as the use of transmission electron microscopy for teratozoospermic patients with fertilization failure, and highlight the need for additional functional studies to establish definitive genotype-phenotype correlations.