Submitted:
16 October 2025
Posted:
17 October 2025
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Materials and Methods
2.1. Screening and Preparation of Functional Strains for Caffeine Degradation
2.2. Fermentation of D. tabescens in Caffeine-Enriched Liquid Media
2.3. Optimization of Caffeine Degradation Conditions
2.4. Preparation of Fermentation Broth Samples
2.5. Sample Analysis
2.5.1. HPLC Analysis
2.5.2. UPLC-MS/MS Analysis
2.5.3. Data Analysis
2.6. Preparation of RNA Sequencing Samples
2.7. RNA Extraction, Library Preparation, and Sequencing
2.8. Quality Control and Read Mapping
2.9. Differential Expression Analysis and Functional Enrichment
2.10. Time-Series Gene Expression Analysis
2.11. Secondary Metabolism Genes and Clusters Analysis
2.12. qRT-PCR Validation
3. Results
3.1. Compilation of Fungal Resources and Identification of Functional Strains Capable of Caffeine Degradation
3.2. Screening for the Optimal Culture Medium
3.3. Optimization of Degradation Conditions
3.3.1. Optimization of Caffeine Concentration Parameters
3.3.2. Optimization of Temperature Conditions
3.3.3. Optimization of pH Conditions
3.4. Analysis of Caffeine Degradation Products
3.4.1. HPLC Analysis
3.4.2. UPLC-MS/MS Analysis
3.5. RNA-Seq Analysis
3.6. Functional Annotation, Classification, and Enrichment Analysis
3.7. Gene Expression Pattern Analysis of DEGs
3.8. Candidate Genes Involved in the Pathways
3.9. Analysis of Secondary Metabolite Biosynthetic Gene Clusters

3.10. Metabolic Pathways Involved in Energy Production
3.11. Genes Involved in Phase II Detoxification
3.12. Experimental Validation
4. Discussion
4.1. Innovation and Functional Adaptability of the Caffeine-Degrading Metabolic Network in D. tabescens
4.2. Physiological Significance of the “Stress-Degradation-Homeostasis” Three-Stage Transcriptional Regulation Model
4.3. Coupling Mechanism of Detoxification-Energy-Secondary Metabolism
4.4. Inter-Species Mechanistic Differences: Evolutionary Divergence Between Fungi, Bacteria, and Other Degrading Fungi
4.5. Research Limitations and Future Directions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Higdon, J.V.; Frei, B. Coffee and Health: A Review of Recent Human Research. Crit Rev Food Sci Nutr 2006, 46, 101–123. [Google Scholar] [CrossRef]
- Ngueta, G. Caffeine and Caffeine Metabolites in Relation to Hypertension in U.S. Adults. Eur J Clin Nutr 2020, 74, 77–86. [Google Scholar] [CrossRef] [PubMed]
- Isolation, Characterization and Application of Theophylline-Degrading Aspergillus Fungi | Microbial Cell Factories | Full Text. Available online: https://microbialcellfactories.biomedcentral.com/articles/10.1186/s12934-020-01333-0 (accessed on 15 September 2025).
- Microbial Degradation of Caffeine Using Himalayan Psychrotolerant Pseudomonas Sp.GBPI_Hb5 (MCC 3295) | Current Microbiology. Available online: https://link.springer.com/article/10.1007/s00284-021-02644-0 (accessed on 15 September 2025).
- Gutierrez, A.E.; Shah, P.; Rex, A.E.; Nguyen, T.C.; Kenkare, S.P.; Barrick, J.E.; Mishlera, D.M. Bioassay for Determining the Concentrations of Caffeine and Individual Methylxanthines in Complex Samples. Applied and Environmental Microbiology 2019, 85. [Google Scholar] [CrossRef]
- Genetic Characterization of Caffeine Degradation by Bacteria and Its Potential Applications. - Abstract - Europe PMC. Available online: https://europepmc.org/article/PMC/4408171 (accessed on 15 September 2025).
- Summers, R.M.; Mohanty, S.K.; Gopishetty, S.; Subramanian, M. Genetic Characterization of Caffeine Degradation by Bacteria and Its Potential Applications. Microb Biotechnol 2015, 8, 369–378. [Google Scholar] [CrossRef]
- Quandt, E.M.; Hammerling, M.J.; Summers, R.M.; Otoupal, P.B.; Slater, B.; Alnahhas, R.N.; Dasgupta, A.; Bachman, J.L.; Subramanian, M.V.; Barrick, J.E. Decaffeination and Measurement of Caffeine Content by Addicted Escherichia Coli with a Refactored N-Demethylation Operon from Pseudomonas Putida CBB5. ACS Synth Biol 2013, 2, 301–307. [Google Scholar] [CrossRef]
- Summers, R.M.; Louie, T.M.; Yu, C.L.; Subramanian, M. Characterization of a Broad-Specificity Non-Haem Iron N-Demethylase from Pseudomonas Putida CBB5 Capable of Utilizing Several Purine Alkaloids as Sole Carbon and Nitrogen Source. Microbiology (Reading) 2011, 157, 583–592. [Google Scholar] [CrossRef]
- Madyastha, K.M.; Sridhar, G.R. A Novel Pathway for the Metabolism of Caffeine by a Mixed Culture Consortium. Biochem Biophys Res Commun 1998, 249, 178–181. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.H.; Kim, B.H.; Brooks, S.; Kang, S.Y.; Summers, R.M.; Song, H.K. Structural and Mechanistic Insights into Caffeine Degradation by the Bacterial N-Demethylase Complex. Journal of Molecular Biology 2019, 431, 3647–3661. [Google Scholar] [CrossRef]
- Salmones, D.; Mata, G.; Waliszewski, K.N. Comparative Culturing of Pleurotus Spp. on Coffee Pulp and Wheat Straw: Biomass Production and Substrate Biodegradation. Bioresource Technology 2005, 96, 537–544. [Google Scholar] [CrossRef]
- Brand, D.; Pandey, A.; Roussos, S.; Soccol, C.R. Biological Detoxification of Coffee Husk by Filamentous Fungi Using a Solid State Fermentation System. Enzyme and Microbial Technology 2000, 27, 127–133. [Google Scholar] [CrossRef]
- Caffeine Metabolism during Cultivation of Oyster Mushroom (Pleurotus Ostreatus) with Spent Coffee Grounds | Applied Microbiology and Biotechnology. Available online: https://link.springer.com/article/10.1007/s00253-019-09883-z (accessed on 15 September 2025).
- Zhou, B.; Ma, C.; Ren, X.; Xia, T.; Li, X. LC-MS/MS-Based Metabolomic Analysis of Caffeine-Degrading Fungus Aspergillus Sydowii during Tea Fermentation. J Food Sci 2020, 85, 477–485. [Google Scholar] [CrossRef] [PubMed]
- Dash, S.S.; Gummadi, S.N. Catabolic Pathways and Biotechnological Applications of Microbial Caffeine Degradation. Biotechnol Lett 2006, 28, 1993–2002. [Google Scholar] [CrossRef] [PubMed]
- Sipos, G.; Prasanna, A.N.; Walter, M.C.; O’Connor, E.; Bálint, B.; Krizsán, K.; Kiss, B.; Hess, J.; Varga, T.; Slot, J.; et al. Genome Expansion and Lineage-Specific Genetic Innovations in the Forest Pathogenic Fungi Armillaria. Nat Ecol Evol 2017, 1, 1931–1941. [Google Scholar] [CrossRef] [PubMed]
- Mihail, J.D.; Bilyeu, L.; Lalk, S.R. Bioluminescence Expression during the Transition from Mycelium to Mushroom in Three North American Armillaria and Desarmillaria Species. Fungal Biol 2018, 122, 1064–1068. [Google Scholar] [CrossRef]
- A Combination of Genome Mining with an OSMAC Approach Facilitates the Discovery of and Contributions to the Biosynthesis of Melleolides from the Basidiomycete Armillaria Tabescens | Journal of Agricultural and Food Chemistry. Available online: https://pubs.acs.org/doi/10.1021/acs.jafc.2c04079 (accessed on 15 September 2025).
- Yang, R.; Li, Y.; Mehmood, S.; Yan, C.; Huang, Y.; Cai, J.; Ji, J.; Pan, W.; Zhang, W.; Chen, Y. Polysaccharides from Armillariella Tabescens Mycelia Ameliorate Renal Damage in Type 2 Diabetic Mice. International Journal of Biological Macromolecules 2020, 162, 1682–1691. [Google Scholar] [CrossRef]
- Yang, R.; Li, Y.; Cai, J.; Ji, J.; Wang, Y.; Zhang, W.; Pan, W.; Chen, Y. Polysaccharides from Armillariella Tabescens Mycelia Ameliorate Insulin Resistance in Type 2 Diabetic Mice. Food Funct 2020, 11, 9675–9685. [Google Scholar] [CrossRef]
- Zhang, T.; Feng, J.; He, W.; Rong, X.; Lv, H.; Li, J.; Li, X.; Wang, H.; Wang, L.; Zhang, L.; et al. Genomic and Transcriptomic Approaches Provide a Predictive Framework for Sesquiterpenes Biosynthesis in Desarmillaria Tabescens CPCC 401429. Journal of Fungi 2023, 9, 481. [Google Scholar] [CrossRef]
- Fitri Faradilla, Rh.; Tamrin, T.; Nuh Ibrahim, M.; Rejeki, S.; Siala, A.; Firmansyah, F. Chemical, Mechanical, Antioxidant, and Antimicrobial Properties of Paper Prepared from Cocoa Bean Shell Using Polyethylene Glycol. JFNR 2019, 7, 579–583. [Google Scholar] [CrossRef]
- Ma, C.; Li, X.; Zheng, C.; Zhou, B.; Xu, C.; Xia, T. Comparison of Characteristic Components in Tea-Leaves Fermented by Aspergillus Pallidofulvus PT-3, Aspergillus Sesamicola PT-4 and Penicillium Manginii PT-5 Using LC-MS Metabolomics and HPLC Analysis. Food Chemistry 2021, 350, 129228. [Google Scholar] [CrossRef]
- Fastp: An Ultra-Fast All-in-One FASTQ Preprocessor | Bioinformatics | Oxford Academic. Available online: https://academic.oup.com/bioinformatics/article/34/17/i884/5093234?login=true (accessed on 15 September 2025).
- HISAT: A Fast Spliced Aligner with Low Memory Requirements | Nature Methods. Available online: https://www.nature.com/articles/nmeth.3317 (accessed on 15 September 2025).
- StringTie Enables Improved Reconstruction of a Transcriptome from RNA-Seq Reads | Nature Biotechnology. Available online: https://www.nature.com/articles/nbt.3122 (accessed on 15 September 2025).
- Li, B.; Dewey, C.N. RSEM: Accurate Transcript Quantification from RNA-Seq Data with or without a Reference Genome. BMC Bioinformatics 2011, 12, 323. [Google Scholar] [CrossRef]
- Wang, L.; Feng, Z.; Wang, X.; Wang, X.; Zhang, X. DEGseq: An R Package for Identifying Differentially Expressed Genes from RNA-Seq Data. Bioinformatics 2010, 26, 136–138. [Google Scholar] [CrossRef] [PubMed]
- STEM: A Tool for the Analysis of Short Time Series Gene Expression Data | BMC Bioinformatics | Full Text. Available online: https://bmcbioinformatics.biomedcentral.com/articles/10.1186/1471-2105-7-191 (accessed on 23 September 2025).
- antiSMASH 8.0: Extended Gene Cluster Detection Capabilities and Analyses of Chemistry, Enzymology, and Regulation - Wageningen University & Research. Available online: https://research.wur.nl/en/publications/antismash-80-extended-gene-cluster-detection-capabilities-and-ana (accessed on 16 September 2025).
- Arocho, A.; Chen, B.; Ladanyi, M.; Pan, Q. Validation of the 2-DeltaDeltaCt Calculation as an Alternate Method of Data Analysis for Quantitative PCR of BCR-ABL P210 Transcripts. Diagn Mol Pathol 2006, 15, 56–61. [Google Scholar] [CrossRef]
- Salmones, D.; Mata, G.; Waliszewski, K.N. Comparative Culturing of Pleurotus Spp. on Coffee Pulp and Wheat Straw: Biomass Production and Substrate Biodegradation. Bioresource Technology 2005, 96, 537–544. [Google Scholar] [CrossRef]
- Carrasco-Cabrera, C.P.; Bell, T.L.; Kertesz, M.A. Caffeine Metabolism during Cultivation of Oyster Mushroom (Pleurotus Ostreatus) with Spent Coffee Grounds. Appl Microbiol Biotechnol 2019, 103, 5831–5841. [Google Scholar] [CrossRef]
- Biological characteristics of three Armillaria species from Northeast China and artificial cultivation of A.ostoyae. Available online: https://d.wanfangdata.com.cn/Periodical/jwxt202301028 (accessed on 17 September 2025).
- Cloning and Function Analysis of CYP82Ds Genes from Camellia Sinensis. Available online: https://d.wanfangdata.com.cn/Thesis/D02821474 (accessed on 23 September 2025).
- Chung, W.G.; Cha, Y.N. Oxidation of Caffeine to Theobromine and Theophylline Is Catalyzed Primarily by Flavin-Containing Monooxygenase in Liver Microsomes. Biochem Biophys Res Commun 1997, 235, 685–688. [Google Scholar] [CrossRef]
- Theobromine, Caffeine, and Theophylline Metabolites in Human Plasma and Urine after Consumption of Soluble Cocoa Products with Different Methylxanthine Contents | Article Information | J-GLOBAL. Available online: https://jglobal.jst.go.jp/en/detail?JGLOBAL_ID=201402272030823259 (accessed on 25 September 2025).
- Grzegorzewski, J.; Bartsch, F.; Köller, A.; König, M. Pharmacokinetics of Caffeine: A Systematic Analysis of Reported Data for Application in Metabolic Phenotyping and Liver Function Testing. bioRxiv - Pharmacology and Toxicology 2021. [CrossRef]
- He, C.; Huang, Y.; Liu, P.; Wei, J.; Yang, Y.; Xu, L.; Xiao, M. Transcriptome Analysis of Genes and Metabolic Pathways Associated with Nicotine Degradation in Aspergillus Oryzae 112822. BMC Genomics 2019, 20, 86. [Google Scholar] [CrossRef]
- MAPK Signal Pathways in the Regulation of Cell Proliferation in Mammalian Cells | Cell Research. Available online: https://www.nature.com/articles/7290105 (accessed on 25 September 2025).
- Kyriakis, J.M.; Avruch, J. Mammalian MAPK Signal Transduction Pathways Activated by Stress and Inflammation: A 10-Year Update. Physiol Rev 2012, 92, 689–737. [Google Scholar] [CrossRef] [PubMed]
- Fungal Stress Responses and the Importance of GPCRs. Available online: https://www.mdpi.com/2309-608X/11/3/213 (accessed on 25 September 2025).
- Cnubben, N.H.P.; Rietjens, I.M.C.M.; Wortelboer, H.; van Zanden, J.; van Bladeren, P.J. The Interplay of Glutathione-Related Processes in Antioxidant Defense. Environmental Toxicology and Pharmacology 2001, 10, 141–152. [Google Scholar] [CrossRef] [PubMed]













| Time | A% | B% | Flow Velocity (mL/min) |
|---|---|---|---|
| 0.00 | 95 | 5 | 1.00 |
| 15.00 | 90 | 10 | 1.00 |
| 40.00 | 80 | 20 | 1.00 |
| 50.00 | 65 | 35 | 1.00 |
| 55.00 | 15 | 85 | 1.00 |
| 65.00 | 5 | 95 | 1.00 |
| 70.00 | 5 | 95 | 1.00 |
| Time | A% | B% | Flow Velocity (mL/min) |
|---|---|---|---|
| 0.00 | 95 | 5 | 0.35 |
| 9.00 | 5 | 95 | 0.35 |
| 10.00 | 5 | 95 | 0.35 |
| 11.00 | 95 | 5 | 0.35 |
| 14.00 | 95 | 5 | 0.35 |
| Primer | Sequence (5′-3′) | Product Size (bp) |
|---|---|---|
| β_tub for | CTGGTTTCGCACCTTTGA | 241 bp |
| β_tub rev | TTGTTGGGAATCCACTCG | |
| DT_22397-F | TTGCGTTTCTTATTGCGGGATCAG | 75 bp |
| DT_22397-R | GCGTGCGTGCCAGGTAGTAG | |
| DT_14597-F | ATAGTGCGGCTGTGGCGAAG | 148 bp |
| DT_14597-R | GCTTCATCAGGATTCTCCAACACG | |
| DT_10255-F | GAATTGAAGGATGGAGTGGCAGAC | 138 bp |
| DT_10255-R | TAGAGGCAGGAAGGCGAAGTTG | |
| DT_13148-F | ACGGTTTCACACTCTCGCTTAATG | 132 bp |
| DT_13148-R | GCACATCAGATTCCACAGAGACATC | |
| DT_3381-F | CCGCATGTACGCAGTTATGTCAG | 119 bp |
| DT_3381-R | AGCCTTCCATCACGACCTGTC | |
| DT_9081-F | GGCGTCCTCTTCTCCGATAACC | 125 bp |
| DT_9081-R | GTGACATTGAGCGAAGCGAAGG | |
| DT_15188-F | ATGGTCTGGCGGGTCAAAGG | 101 bp |
| DT_15188_R | GCAAGTGTGGCGGATCGTAAC | |
| DT_18708-F | TTTCCCTTGCCTGCCTCCTC | 114 bp |
| DT_18708-R | GTCGTCGGTTCATCGCTTGG | |
| DT_3595-F | GCTTGTGCGGCTTACCTTCTAC | 86 bp |
| DT_3595-R | ATCCCTGTGACATGACCCTTGG | |
| DT_4877-F | GCTCTCAGTACCCGCCCTTTG | 87 bp |
| DT_4877-R | CGATCCGCCAGTCCGTTCTC | |
| DT_9523-F | GCAAGACCAACAGGATGGATACG | 116 bp |
| DT_9523-R | GCGGCGAAGCGAAGACATAG | |
| DT_9657-F | TGGCAACAACAGCAAGCAGAAG | 124 bp |
| DT_9657-R | GTGACCATCCGCTATACCTCCTAC |
| Compounds | Relative Content | ||
|---|---|---|---|
| LF-1 | LF-2 | LF-3 | |
| Xanthosine | 3061085.97 | 3308773.83 | 1728570.43 |
| 1,7-Dimethylxanthine | 1149491.50 | 1491768.33 | 1582676.97 |
| 7-Methylxanthine | 25714920.16 | 27103545.14 | 28155343.82 |
| Caffeine | 444244.67 | 588329.20 | 595120.38 |
| Theobromine | 432153.50 | 632932.68 | 715049.52 |
| 1,3,7-Trimethyluric acid | 22816.60 | 31955.41 | 41885.54 |
| Theophylline | 1032014.26 | 1025524.47 | 550688.88 |
| 3-Methylxanthine | 1707194.76 | 2194741.14 | 2747530.71 |
| 1-Methylxanthine | 14255941.68 | 17777575.01 | 17462626.23 |
| Xanthine | 13933801.87 | 12351831.46 | 9415550.65 |
| 1,3-Dimethyluric acid | 690080.00 | 709655.94 | 333344.06 |
| Gene ID | Gene Length | Log2FC (CT/ NCT) | ||
|---|---|---|---|---|
| 10 days | 16 days | 22 days | ||
| gene_670 | 2486 | 3.71 | 1.09 | 3.13 |
| gene_3381 | 1936 | 6.18 | 3.56 | 4.86 |
| gene_3390 | 2409 | 2.07 | 3.30 | 1.04 |
| gene_3396 | 2222 | 5.92 | 3.31 | 4.46 |
| gene_7614 | 2826 | 1.74 | 1.05 | 3.61 |
| gene_14597 | 543 | 2.58 | 1.81 | 4.06 |
| gene_14794 | 2459 | 1.13 | 1.05 | 1.65 |
| gene_16566 | 2547 | 2.64 | 1.64 | 4.11 |
| gene_22397 | 2154 | 4.60 | 2.89 | 4.26 |
| Comparison | Bacteria (e.g., Pseudomonas putida) | Nicotine-Degrading Fungus (A. oryzae) | D. tabescens |
|---|---|---|---|
| Core Enzyme System | Fixed NdmA-E gene cluster | Differentiated P450 family | stage-specific CYP450 (further verification) |
| Metabolic Pathway | Single N-demethylation/C8 oxidation | Linear degradation pathway | Branched and intersecting network (synergy of dual pathways) |
| Energy Regulation | Continuous high-energy consumption mode | Early-stage energy upregulation | Temporal “on-demand allocation” (precise regulation) |
| Environmental Adaptation | Dependence on external nutrients | GSTs-mediated detoxification + involvement of transporters | Secondary metabolic cluster-mediated defense + ecological competition |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).