Submitted:
26 August 2025
Posted:
05 September 2025
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Materials and Methods
2.1. Biological Material and DNA Extraction
2.2. DNA Amplification and Sequencing
2.3. Duplex Conventional PCRs
2.4. Real-Time PCR Design and Application
3. Results
3.1. Sequencing the Hgam98 Locus
3.2. Duplex Conventional PCR
3.3. Real-Time PCR
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| COX1 | Cytochrome c Oxidase gene 1 |
| NNS | Non-Native Species |
| PCR | Polymerase Chain Reaction |
| SNP | Single Nucleotide Polymorphism |
| IFCA | Inshore Fisheries and Conservation Authorities |
| VNTR | Variable Nucleotide Tandem Repeat |
References
- Manchester S.J.; Bullock J.M. The impacts of non-native species on UK biodiversity and the effectiveness of control. Journal of Applied Ecology 2000, 37(5), 845–864. [CrossRef]
- Eschen, R., Kadzamira, M., Stutz, S. et al. An updated assessment of the direct costs of invasive non-native species to the United Kingdom. Biol Invasions 2023, 25, 3265–3276. [CrossRef]
- Stewart J.E. Gaffkemia, the Fatal Infection of Lobsters (Genus Homarus) Caused by Aerococcus viridans (var.) homari: A Review. Marine Fisheries Review 1975, 37(5–6), 20–24.
- Øresland V., Ulmestrand M., Agnalt A.L., Oxby G. Recorded captures of American lobster (Homarus Americanus) in Swedish waters and an observation of predation on the European lobster (Homarus Gammarus). Canadian Journal of Fisheries and Aquatic Sciences 2017, 74(10), 1503–1506. [CrossRef]
- Stebbing P., Johnson P., Delahunty A., Clark P.F., McCollin T., Hale C., Clark S. Reports of american lobsters, homarus americanus (H. milne edwards, 1837), in British waters. BioInvasions Records 2012, 1(1), 17–23. [CrossRef]
- Mozer A., Prost S. An introduction to illegal wildlife trade and its effects on biodiversity and society. Forensic Science International: Animals and Environments 2023, 100064. [CrossRef]
- Ellis C.D., Jenkins T.L., Svanberg L., Eriksson S.P., Stevens J.R. Crossing the pond: genetic assignment detects lobster hybridisation. Scientific Reports 2020, 10(1), 1–7. [CrossRef]
- Jacquet J.L., Pauly D. Trade secrets: Renaming and mislabeling of seafood. Marine Policy 2008, 32(3), 309–318. [CrossRef]
- Jørstad K.E., Prodohl P.A., Agnalt A.L., Hughes M., Farestveit E., Ferguson A.F. Comparison of genetic and morphological methods to detect the presence of American lobsters, Homarus americanus H. Milne Edwards, 1837 (Astacidea: Nephropidae) in Norwegian waters. Hydrobiologia 2007, 590(1), 103–114. [CrossRef]
- van der Meeren G.I., Chandrapavan A., Breithaupt T. Sexual and aggressive interactions in a mixed species group of lobsters Homarus gammarus and H. americanus. Aquatic Biology 2008, 2(2), 191–200. [CrossRef]
- Jenkins T.L., Ellis C.D., Stevens J.R., Jenkins T.L. SNP discovery in European lobster (Homarus gammarus) using RAD sequencing. Conservation Genetics Resources 2019, 11(3), 253–257. [CrossRef]
- Kumar S., Stecher G., Tamura K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Molecular Biology and Evolution 2016, 33(7), 1870–1874.
- Altschul S.F., Gish W., Miller W., Myers E.W., Lipman D.J. Basic local alignment search tool. Journal of Molecular Biology 1990, 215(3). 403-410. [CrossRef]
- Schrader C., Schielke A., Ellerbroek L., Johne R. PCR inhibitors – occurrence, properties and removal. Journal of Applied Microbiology 2012, 113(5), 1014–1026. [CrossRef]



| Identification | Species | Location | Number of VNTRs (A[C/T]AG) | Accession number |
| HAM1 | H. americanus | Browns Bank, Massachusetts, USA | 17 | PQ106807 |
| HAM2 | H. americanus | Caraquet, New Brunswick, Canada | 18 | PQ106808 |
| HAM3 | H. americanus | Coastal New Hampshire, USA | 5 | PQ106809 |
| HAM4 | H. americanus | Fortune Bay, Newfoundland and Labrador, Canada | 17 | PQ106810 |
| HAM5 | H. americanus | Malpeque Bay, Prince Edward Island, Canada | 26 | PQ106811 |
| HAM6 | H. americanus | Musquodoboit Harbour, Nova Scotia, Canada | 26 | PQ106812 |
| AxG1 | Hybrid animal | Lysekil, Sweden | 15 | PQ106813 |
| AxG2 | Hybrid animal | Lysekil, Sweden | 15 | |
| AxG3 | Hybrid animal | Lysekil, Sweden | 15 | |
| AxG4 | Hybrid animal | Lysekil, Sweden | 15 | |
| AxG5 | Hybrid animal | Lysekil, Sweden | 15 | |
| AxG6 | Hybrid animal | Lysekil, Sweden | 15 | |
| GAM1 | H. gammarus | Bergen, Norway | 15 | PQ106814 |
| GAM2 | H. gammarus | Flodevigen, Norway | 15 | |
| GAM3 | H. gammarus | Lysekil, Sweden | 15 | PQ106815 |
| GAM4 | H. gammarus | Tangiers, Morocco | 15 | PQ106816 |
| GAM5 | H. gammarus | Tangiers, Morocco | 15 | |
| GAM6 | H. gammarus | Tangiers, Morocco | 15 | |
| Corn1 | Unknown | Cornwall, UK | 15 | N/A |
| Corn2 | Unknown | Cornwall, UK | 15 | N/A |
| Primer/Probe name | Primer sequence | Target organism | Reference |
| Hgam98 F | GCCTCCGTCGGGTTTCCTG | H. gammarus/H. americanus | Jørstad et al 2007 (modified) |
| Hgam98 R | AATATGTCTTTCAATGGCTTCTCC | H. gammarus/H. americanus | Jørstad et al 2007 (modified) |
| Hamer F | ATAACGAGATAGTGTAGGG | H. americanus (Insert) | This study |
| COI_H_SP_F | ACTGGRTGAACTGTCTACCC | H. gammarus/H. americanus | This study |
| COI_H_SP_R | CCAGCYAGATGAAGCGAGAA | H. gammarus/H. americanus | This study |
| COI_HA_Pr | [6FAM] CTCACGCAGGTGCTTCCGTTGA [TAM] |
H. americanus | This study |
| COI_HGam_Pr | [HEX] CGCTTCTGTTGATTTAGGAATTTTCTCGCT [TAM] | H. gammarus | This study |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).