Submitted:
21 July 2025
Posted:
22 July 2025
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Materials and Methods
2.1. Animals and Experimental Grouping
2.2. Isolation and Expansion of BM-MSCs
2.3. BM-MSCs Characterization
2.4. Chronic Restraint Stress (CRS) Induced Depressive-like Behavior
2.5. Assessment of Cytotoxic Effects of Fluoxetine and L.PS on the BM-MSCs
2.6. Intracerebroventricular Injection of BM-MSCs
2.7. Behavioral Tests
2.7.1. Body Weight and Blood Glucose Monitoring
2.7.2. Open Field Test
2.7.3. Morris Water Maze Test
2.7.4. Forced Swimming Test
2.8. Serum and Sample Collection
2.9. ELISA
2.10. Real-Time PCR
2.11. Nissl Staining
2.12. In Silico Study
2.12.1. Construction of PPI Network
2.12.2. GO and KEGG Enrichment Analysis
2.12.3. Correlations Between Inflammatory Biomarkers and Major MDD-Associated Genes
2.12.4. Expression of Inflammatory Genes in MDD
2.13. Statistical Analysis
3. Results
3.1. Cytotoxic Effects of Fluoxetine and L.PS on BM-MSCs
3.2. Physiological Parameters
3.2.1. Effect of Various Treatments on Corticosterone Level
3.2.2. Serum Glucose Changes
3.2.3. Body Weight Gain
3.4. Effects of Different Treatments on Behavioral Tests
3.5. Effect of Various Treatments on NF-κB and Pro-Inflammatory Cytokine Gene Expression in Hippocampal Tissues
3.6. Effect of Various Treatments on Pro-Inflammatory Cytokine Levels in Hippocampal Tissues
3.7. Histological Analysis
3.8. In Silico
3.8.1. PPI Network Analysis

3.8.2. KEGG and GO Analysis


3.8.3. Correlation Analysis of Inflammatory Biomarkers with MDD-Associated Genes
3.8.4. Expression Analysis of Inflammation Genes in MDD.
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| α-MEM | Alpha-minimal essential medium |
| BM-MSCs | Bone marrow-derived mesenchymal stem cells |
| BP | Biological Process |
| BSA | Bovine Serum Albumin |
| CASP1 | Caspase 1 |
| CC | Cellular Component |
| CRS | Chronic Restraint Stress |
| DBS | Deep Brain Stimulation |
| DMEM | Dulbecco’s Modified Eagle Medium |
| DMSO | Dimethyl Sulfoxide |
| DSM-IV | Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition |
| ECT | Electroconvulsive Therapy |
| FDR | False Discovery Rate |
| FBS | Fetal Bovine Serum |
| FITC | Fluorescein Isothiocyanate |
| FKBP5 | FK506 Binding Protein 5 Gene |
| FMO | Fluorescence Minus One |
| FST | Forced Swim Test |
| GEO | Gene Expression Omnibus |
| GEPIA | Gene Expression Profiling Interactive Analysis |
| GO | Gene Ontology |
| GR | Glucocorticoid Receptor |
| GTEx | Genotype-Tissue Expression |
| HC | Healthy Controls |
| HPA | Hypothalamus-Pituitary-Adrenal |
| i.c.v | Intracerebroventricularly |
| IL-1β | Interleukin-1 beta |
| IL-1R1 | Interleukin-1 Receptor Type 1 |
| IL1A | Interleukin 1 Alpha |
| IL18 | Interleukin 18 |
| IL1B | Interleukin 1 Beta |
| IL1RN | Interleukin 1 Receptor Antagonist |
| IL33 | Interleukin 33 |
| IL6 | Interleukin 6 |
| KEGG | Kyoto Encyclopedia of Genes and Genomes |
| L.PS | Lactobacillus plantarum Supernatant |
| Log2FC | Log2 Fold Change |
| MDD | Major Depressive Disorder |
| MF | Molecular Function |
| MR | Mineralocorticoid Receptor |
| MRS | Man Rogosa Sharpe |
| MSCs | Mesenchymal Stem Cells |
| MTT | 3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide |
| MWM | Morris Water Maze |
| NF-κB | Nuclear factor kappa-light-chain-enhancer of activated B cells |
| NLRP3 | NOD-, LRR- and pyrin domain-containing protein 3 |
| OD | Optical Density |
| OFT | Open Field Test |
| PBS | Phosphate-buffered saline |
| PE | Phycoerythrin |
| PPI | Protein-Protein Interaction |
| rpm | Revolutions per minute |
| SLC6A4 | Serotonin Transporter Gene |
| TNF | Tumor Necrosis Factor |
| TNF-α | Tumor Necrosis Factor-alpha |
| TPP | Treatment-Prevalence Paradox |
| VNS | Vagus Nerve Stimulation |
| α-MEM | Alpha-minimal essential medium |
| BM-MSCs | Bone marrow-derived mesenchymal stem cells |
| BP | Biological Process |
| BSA | Bovine Serum Albumin |
| CASP1 | Caspase 1 |
| CC | Cellular Component |
| CRS | Chronic Restraint Stress |
| DBS | Deep Brain Stimulation |
| DMEM | Dulbecco’s Modified Eagle Medium |
| DMSO | Dimethyl Sulfoxide |
| DSM-IV | Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition |
| ECT | Electroconvulsive Therapy |
| FDR | False Discovery Rate |
| FBS | Fetal Bovine Serum |
| FITC | Fluorescein Isothiocyanate |
| FKBP5 | FK506 Binding Protein 5 Gene |
| FMO | Fluorescence Minus One |
| FST | Forced Swim Test |
| GEO | Gene Expression Omnibus |
| GEPIA | Gene Expression Profiling Interactive Analysis |
| GO | Gene Ontology |
| GR | Glucocorticoid Receptor |
| GTEx | Genotype-Tissue Expression |
| HC | Healthy Controls |
| HPA | Hypothalamus-Pituitary-Adrenal |
| i.c.v | Intracerebroventricularly |
| IL-1β | Interleukin-1 beta |
| IL-1R1 | Interleukin-1 Receptor Type 1 |
| IL1A | Interleukin 1 Alpha |
| IL18 | Interleukin 18 |
| IL1B | Interleukin 1 Beta |
| IL1RN | Interleukin 1 Receptor Antagonist |
| IL33 | Interleukin 33 |
| IL6 | Interleukin 6 |
| KEGG | Kyoto Encyclopedia of Genes and Genomes |
| L.PS | Lactobacillus plantarum Supernatant |
| Log2FC | Log2 Fold Change |
| MDD | Major Depressive Disorder |
| MF | Molecular Function |
| MR | Mineralocorticoid Receptor |
| MRS | Man Rogosa Sharpe |
| MSCs | Mesenchymal Stem Cells |
| MTT | 3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide |
| MWM | Morris Water Maze |
| NF-κB | Nuclear factor kappa-light-chain-enhancer of activated B cells |
| NLRP3 | NOD-, LRR- and pyrin domain-containing protein 3 |
| OD | Optical Density |
| OFT | Open Field Test |
| PBS | Phosphate-buffered saline |
| PE | Phycoerythrin |
| PPI | Protein-Protein Interaction |
| rpm | Revolutions per minute |
| SLC6A4 | Serotonin Transporter Gene |
| TNF | Tumor Necrosis Factor |
| TNF-α | Tumor Necrosis Factor-alpha |
| TPP | Treatment-Prevalence Paradox |
| VNS | Vagus Nerve Stimulation |
| α-MEM | Alpha-minimal essential medium |
| BM-MSCs | Bone marrow-derived mesenchymal stem cells |
| BP | Biological Process |
| BSA | Bovine Serum Albumin |
| CASP1 | Caspase 1 |
| CC | Cellular Component |
| CRS | Chronic Restraint Stress |
| DBS | Deep Brain Stimulation |
| DMEM | Dulbecco’s Modified Eagle Medium |
| DMSO | Dimethyl Sulfoxide |
| DSM-IV | Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition |
| ECT | Electroconvulsive Therapy |
| FDR | False Discovery Rate |
| FBS | Fetal Bovine Serum |
| FITC | Fluorescein Isothiocyanate |
| FKBP5 | FK506 Binding Protein 5 Gene |
| FMO | Fluorescence Minus One |
| FST | Forced Swim Test |
| GEO | Gene Expression Omnibus |
| GEPIA | Gene Expression Profiling Interactive Analysis |
| GO | Gene Ontology |
| GR | Glucocorticoid Receptor |
| GTEx | Genotype-Tissue Expression |
| HC | Healthy Controls |
| HPA | Hypothalamus-Pituitary-Adrenal |
| i.c.v | Intracerebroventricularly |
| IL-1β | Interleukin-1 beta |
| IL-1R1 | Interleukin-1 Receptor Type 1 |
| IL1A | Interleukin 1 Alpha |
| IL18 | Interleukin 18 |
| IL1B | Interleukin 1 Beta |
| IL1RN | Interleukin 1 Receptor Antagonist |
| IL33 | Interleukin 33 |
| IL6 | Interleukin 6 |
| KEGG | Kyoto Encyclopedia of Genes and Genomes |
| L.PS | Lactobacillus plantarum Supernatant |
| Log2FC | Log2 Fold Change |
| MDD | Major Depressive Disorder |
| MF | Molecular Function |
| MR | Mineralocorticoid Receptor |
| MRS | Man Rogosa Sharpe |
| MSCs | Mesenchymal Stem Cells |
| MTT | 3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide |
| MWM | Morris Water Maze |
| NF-κB | Nuclear factor kappa-light-chain-enhancer of activated B cells |
| NLRP3 | NOD-, LRR- and pyrin domain-containing protein 3 |
| OD | Optical Density |
| OFT | Open Field Test |
| PBS | Phosphate-buffered saline |
| PE | Phycoerythrin |
| PPI | Protein-Protein Interaction |
| rpm | Revolutions per minute |
| SLC6A4 | Serotonin Transporter Gene |
| TNF | Tumor Necrosis Factor |
| TNF-α | Tumor Necrosis Factor-alpha |
| TPP | Treatment-Prevalence Paradox |
| VNS | Vagus Nerve Stimulation |
| α-MEM | Alpha-minimal essential medium |
| BM-MSCs | Bone marrow-derived mesenchymal stem cells |
| BP | Biological Process |
| BSA | Bovine Serum Albumin |
| CASP1 | Caspase 1 |
| CC | Cellular Component |
| CRS | Chronic Restraint Stress |
| DBS | Deep Brain Stimulation |
| DMEM | Dulbecco’s Modified Eagle Medium |
| DMSO | Dimethyl Sulfoxide |
| DSM-IV | Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition |
| ECT | Electroconvulsive Therapy |
| FDR | False Discovery Rate |
| FBS | Fetal Bovine Serum |
| FITC | Fluorescein Isothiocyanate |
| FKBP5 | FK506 Binding Protein 5 Gene |
| FMO | Fluorescence Minus One |
| FST | Forced Swim Test |
| GEO | Gene Expression Omnibus |
| GEPIA | Gene Expression Profiling Interactive Analysis |
| GO | Gene Ontology |
| GR | Glucocorticoid Receptor |
| GTEx | Genotype-Tissue Expression |
| HC | Healthy Controls |
| HPA | Hypothalamus-Pituitary-Adrenal |
| i.c.v | Intracerebroventricularly |
| IL-1β | Interleukin-1 beta |
| IL-1R1 | Interleukin-1 Receptor Type 1 |
| IL1A | Interleukin 1 Alpha |
| IL18 | Interleukin 18 |
| IL1B | Interleukin 1 Beta |
| IL1RN | Interleukin 1 Receptor Antagonist |
| IL33 | Interleukin 33 |
| IL6 | Interleukin 6 |
| KEGG | Kyoto Encyclopedia of Genes and Genomes |
| L.PS | Lactobacillus plantarum Supernatant |
| Log2FC | Log2 Fold Change |
| MDD | Major Depressive Disorder |
| MF | Molecular Function |
| MR | Mineralocorticoid Receptor |
| MRS | Man Rogosa Sharpe |
| MSCs | Mesenchymal Stem Cells |
| MTT | 3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide |
| MWM | Morris Water Maze |
| NF-κB | Nuclear factor kappa-light-chain-enhancer of activated B cells |
| NLRP3 | NOD-, LRR- and pyrin domain-containing protein 3 |
| OD | Optical Density |
| OFT | Open Field Test |
| PBS | Phosphate-buffered saline |
| PE | Phycoerythrin |
| PPI | Protein-Protein Interaction |
| rpm | Revolutions per minute |
| SLC6A4 | Serotonin Transporter Gene |
| TNF | Tumor Necrosis Factor |
| TNF-α | Tumor Necrosis Factor-alpha |
| TPP | Treatment-Prevalence Paradox |
| VNS | Vagus Nerve Stimulation |
References
- Ghafori, S.S.; Yousefi, Z.; Bakhtiari, E.; Hassanzadeh, G. Neutrophil-to-lymphocyte ratio as a predictive biomarker for early diagnosis of depression: A narrative review. Brain, Behavior, & Immunity-Health 2024, 100734. [Google Scholar] [CrossRef]
- Karrouri, R.; Hammani, Z.; Benjelloun, R.; Otheman, Y. Major depressive disorder: Validated treatments and future challenges. World journal of clinical cases 2021, 9, 9350. [Google Scholar] [CrossRef]
- Marwaha, S.; Palmer, E.; Suppes, T.; Cons, E.; Young, A.H.; Upthegrove, R. Novel and emerging treatments for major depression. The Lancet 2023, 401, 141–153. [Google Scholar] [CrossRef] [PubMed]
- Chen, S.; Sun, H.; Song, Y.; Zhang, M.; Huang, W.; Zhao, C.; et al. Transition and trend analysis of the burden of depression in China and different income countries: Based on GBD database and joinpoint regression model. Journal of Affective Disorders 2024. [Google Scholar] [CrossRef]
- Ezawa, I.D.; Robinson, N.; Hollon, S.D. Prevalence Increases as Treatments Improve: An Evolutionary Perspective on the Treatment-Prevalence Paradox in Depression. Annual Review of Clinical Psychology 2024, 20, 201–228. [Google Scholar] [CrossRef]
- Pharoun, J.; Berro, J.; Sobh, J.; Abou-Younes, M.-M.; Nasr, L.; Majed, A.; et al. Mesenchymal stem cells biological and biotechnological advances: Implications for clinical applications. European Journal of Pharmacology 2024, 977, 176719. [Google Scholar] [CrossRef]
- Asgari Taei, A.; Nasoohi, S.; Hassanzadeh, G.; Kadivar, M.; Dargahi, L.; Farahmandfar, M. Enhancement of angiogenesis and neurogenesis by intracerebroventricular injection of secretome from human embryonic stem cell-derived mesenchymal stem cells in ischemic stroke model. Biomedicine & Pharmacotherapy 2021, 140, 111709. [Google Scholar] [CrossRef]
- Sadr, S.; Ahmadi Simab, P.; Niazi, M.; Yousefsani, Z.; Lotfalizadeh, N.; Hajjafari, A.; et al. Anti-inflammatory and immunomodulatory effects of mesenchymal stem cell therapy on parasitic drug resistance. Expert Review of Anti-infective Therapy 2024. [Google Scholar] [CrossRef]
- Kin, K.; Yasuhara, T.; Borlongan, C.V.; Date, I. Encapsulated stem cells ameliorate depressive-like behavior via growth factor secretion. Brain Circ 2018, 4, 128–132. [Google Scholar] [CrossRef]
- Tfilin, M.; Sudai, E.; Merenlender, A.; Gispan, I.; Yadid, G.; Turgeman, G. Mesenchymal stem cells increase hippocampal neurogenesis and counteract depressive-like behavior. Molecular psychiatry 2010, 15, 1164–1175. [Google Scholar] [CrossRef] [PubMed]
- Huang, J.; Huang, W.; Yi, J.; Deng, Y.; Li, R.; Chen, J.; et al. Mesenchymal stromal cells alleviate depressive and anxiety-like behaviors via a lung vagal-to-brain axis in male mice. Nat Commun 2023, 14, 7406. [Google Scholar] [CrossRef]
- Shwartz, A.; Betzer, O.; Kronfeld, N.; Kazimirsky, G.; Cazacu, S.; Finniss, S.; et al. Therapeutic Effect of Astroglia-like Mesenchymal Stem Cells Expressing Glutamate Transporter in a Genetic Rat Model of Depression. Theranostics 2017, 7, 2690–2703. [Google Scholar] [CrossRef]
- Wang, P.; Li, Y.; Song, Y.; Gao, Y.; Hao, C.; Zhou, Y.; et al. Human umbilical cord mesenchymal stem cells reverse depression in rats induced by chronic unpredictable mild stress combined with lipopolysaccharide. CNS Neuroscience & Therapeutics 2024, 30, e14644. [Google Scholar] [CrossRef]
- Cui, L.; Li, S.; Wang, S.; Wu, X.; Liu, Y.; Yu, W.; et al. Major depressive disorder: hypothesis, mechanism, prevention and treatment. Signal Transduction and Targeted Therapy 2024, 9, 30. [Google Scholar] [CrossRef] [PubMed]
- Poletti, S.; Mazza, M.G.; Benedetti, F. Inflammatory mediators in major depression and bipolar disorder. Translational Psychiatry 2024, 14, 247. [Google Scholar] [CrossRef] [PubMed]
- Blevins, H.M.; Xu, Y.; Biby, S.; Zhang, S. The NLRP3 Inflammasome Pathway: A Review of Mechanisms and Inhibitors for the Treatment of Inflammatory Diseases. Front Aging Neurosci 2022, 14, 879021. [Google Scholar] [CrossRef]
- Amini, M.; Yousefi, Z.; Ghafori, S.S.; Hassanzadeh, G. Sleep deprivation and NLRP3 inflammasome: Is there a causal relationship? Front Neurosci 2022, 16, 1018628. [Google Scholar] [CrossRef]
- Gholaminejhad, M.; Jameie, S.B.; Abdi, M.; Abolhassani, F.; Mohammed, I.; Hassanzadeh, G. All-Trans Retinoic Acid-Preconditioned Mesenchymal Stem Cells Improve Motor Function and Alleviate Tissue Damage After Spinal Cord Injury by Inhibition of HMGB1/NF-κB/NLRP3 Pathway Through Autophagy Activation. J Mol Neurosci 2022, 72, 947–962. [Google Scholar] [CrossRef]
- Gholaminejhad, M.; Forouzesh, M.; Ebrahimi, B.; Mahdavi, S.A.; Mirtorabi, S.D.; Liaghat, A.; et al. Formation and activity of NLRP3 inflammasome and histopathological changes in the lung of corpses with COVID-19. Journal of Molecular Histology 2022, 53, 883–890. [Google Scholar] [CrossRef]
- Yarahmadi, A.; Malek, F.; Poorhassan, M.; Ghaffari, N.; Ebrahimi, B.; Bazrafkan, M.; et al. Curcumin Attenuates Development of Depressive-Like Behavior in Male Rats after Spinal Cord Injury: Involvement of NLRP3 Inflammasome. Journal of Contemporary Medical Sciences 2022, 8. [Google Scholar] [CrossRef]
- Das, R.; Emon, M.P.Z.; Shahriar, M.; Nahar, Z.; Islam, S.M.A.; Bhuiyan, M.A.; et al. Higher levels of serum IL-1β and TNF-α are associated with an increased probability of major depressive disorder. Psychiatry Research 2021, 295, 113568. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Liu, L.; Liu, Y.-Z.; Shen, X.-L.; Wu, T.-Y.; Zhang, T.; et al. NLRP3 inflammasome mediates chronic mild stress-induced depression in mice via neuroinflammation. International Journal of Neuropsychopharmacology 2015, 18, pyv006. [Google Scholar] [CrossRef]
- Li, J.; Tian, S.; Wang, H.; Du, C.; Fang, J.; Wang, X.; et al. Protection of hUC-MSCs against neuronal complement C3a receptor-mediated NLRP3 activation in CUMS-induced mice. Neuroscience Letters 2021, 741, 135485. [Google Scholar] [CrossRef] [PubMed]
- Ju, R.; Gao, X.; Zhang, C.; Tang, W.; Tian, W.; He, M. Exogenous MSCs based tissue regeneration: a review of immuno-protection strategies from biomaterial scaffolds. Journal of Materials Chemistry B 2024. [CrossRef] [PubMed]
- Kazemi, A.; Eshkoor, P.A.; Saeedi, P.; Halabian, R. Evaluation of antioxidant and antibacterial effects of lactobacilli metabolites-preconditioned bone marrow mesenchymal stem cells in skin lesions amelioration. Bioorganic Chemistry 2022, 124, 105797. [Google Scholar] [CrossRef] [PubMed]
- Mendi, A.; Aktaş, B.; Aslım, B. Mesenchymal stem cell-probiotic communication: beneficial bacteria in preconditioning. In Handbook of Stem Cell Therapy; Springer, 2022; pp. 1–20. [Google Scholar] [CrossRef]
- Li, J.; Wang, J.; Wang, M.; Zheng, L.; Cen, Q.; Wang, F.; et al. Bifidobacterium: a probiotic for the prevention and treatment of depression. Front Microbiol 2023, 14, 1174800. [Google Scholar] [CrossRef]
- Romijn, A.R.; Rucklidge, J.J.; Kuijer, R.G.; Frampton, C. A double-blind, randomized, placebo-controlled trial of Lactobacillus helveticus and Bifidobacterium longum for the symptoms of depression. Aust N Z J Psychiatry 2017, 51, 810–821. [Google Scholar] [CrossRef]
- Ma, J.; Chen, Y.; Wang, Z.; Wang, R.; Dong, Y. Lactiplantibacillus plantarum CR12 attenuates chronic unforeseeable mild stress induced anxiety and depression-like behaviors by modulating the gut microbiota-brain axis. Journal of Functional Foods 2023, 107, 105710. [Google Scholar] [CrossRef]
- Sun, X.; Zhang, H.F.; Ma, C.L.; Wei, H.; Li, B.M.; Luo, J. Alleviation of Anxiety/Depressive-Like Behaviors and Improvement of Cognitive Functions by Lactobacillus plantarum WLPL04 in Chronically Stressed Mice. Can J Infect Dis Med Microbiol 2021, 2021, 6613903. [Google Scholar] [CrossRef]
- Seewoo, B.J.; Hennessy, L.A.; Feindel, K.W.; Etherington, S.J.; Croarkin, P.E.; Rodger, J. Validation of chronic restraint stress model in young adult rats for the study of depression using longitudinal multimodal MR imaging. Eneuro 2020. [Google Scholar] [CrossRef]
- Alkanat, M.; Alkanat, H. D-Limonene reduces depression-like behaviour and enhances learning and memory through an anti-neuroinflammatory mechanism in male rats subjected to chronic restraint stress. Eur J Neurosci 2024, 60, 4491–4502. [Google Scholar] [CrossRef]
- Vaseghi, S.; Babapour, V.; Nasehi, M.; Zarrindast, M.R. The role of CA1 CB1 receptors on lithium-induced spatial memory impairment in rats. Excli j 2018, 17, 916–934. [Google Scholar] [PubMed]
- Hernández, V.S.; Luquín, S.; Jáuregui-Huerta, F.; Corona-Morales, A.A.; Medina, M.P.; Ruíz-Velasco, S.; et al. Dopamine receptor dysregulation in hippocampus of aged rats underlies chronic pulsatile l-Dopa treatment induced cognitive and emotional alterations. Neuropharmacology 2014, 82, 88–100. [Google Scholar] [CrossRef] [PubMed]
- Duan, T.-T.; Tan, J.-W.; Yuan, Q.; Cao, J.; Zhou, Q.-X.; Xu, L. Acute ketamine induces hippocampal synaptic depression and spatial memory impairment through dopamine D1/D5 receptors. Psychopharmacology 2013, 228, 451–461. [Google Scholar] [CrossRef]
- Nissen, I.; Estrada, F.S.; Nava-Kopp, A.T.; Irles, C.; de-la-Peña-Diaz, A.; Fernandez, G.J.; et al. Prolame ameliorates anxiety and spatial learning and memory impairment induced by ovariectomy in rats. Physiol Behav 2012, 106, 278–284. [Google Scholar] [CrossRef] [PubMed]
- Hu, C.; Luo, Y.; Wang, H.; Kuang, S.; Liang, G.; Yang, Y.; et al. Re-evaluation of the interrelationships among the behavioral tests in rats exposed to chronic unpredictable mild stress. PLoS One 2017, 12, e0185129. [Google Scholar] [CrossRef] [PubMed]
- Kouba, B.R.; de Araujo Borba, L.; Borges de Souza, P.; Gil-Mohapel, J.; Rodrigues, A.L.S. Role of Inflammatory Mechanisms in Major Depressive Disorder: From Etiology to Potential Pharmacological Targets. Cells 2024. [Google Scholar] [CrossRef]
- Zhang, W.; Wang, T.; Li, L.; Xu, J.; Wang, J.; Wang, G.; et al. The Role of Mitochondrial Dysfunction-Mediated Changes in Immune Cytokine Expression in the Pathophysiology and Treatment of Major Depressive Disorder. Molecular Neurobiology 2025, 1–12. [Google Scholar] [CrossRef]
- Zhou, F.; Luo, Y.; Xiong, H.; Zhang, G. Carcinogenic effect of adenosine deaminase(ADA) in human tumors. Research Square 2023. [Google Scholar] [CrossRef]
- Miyata, S.; Kurachi, M.; Okano, Y.; Sakurai, N.; Kobayashi, A.; Harada, K.; et al. Blood Transcriptomic Markers in Patients with Late-Onset Major Depressive Disorder. PLoS One 2016, 11, e0150262. [Google Scholar] [CrossRef]
- Ye, F.; Dong, M.-C.; Xu, C.-X.; Jiang, N.; Chang, Q.; Liu, X.-M.; et al. Effects of different chronic restraint stress periods on anxiety- and depression-like behaviors and tryptophan-kynurenine metabolism along the brain-gut axis in C57BL/6N mice. European Journal of Pharmacology 2024, 965, 176301. [Google Scholar] [CrossRef]
- Hassamal, S. Chronic stress, neuroinflammation, and depression: an overview of pathophysiological mechanisms and emerging anti-inflammatories. Frontiers in Psychiatry 2023, 14, 1130989. [Google Scholar] [CrossRef] [PubMed]
- White, A.G.; Elias, E.; Orozco, A.; Robinson, S.A.; Manners, M.T. Chronic Stress-Induced Neuroinflammation: Relevance of Rodent Models to Human Disease. International Journal of Molecular Sciences 2024, 25, 5085. [Google Scholar] [CrossRef]
- Lei, A.A.; Phang, V.W.X.; Lee, Y.Z.; Kow, A.S.F.; Tham, C.L.; Ho, Y.-C.; et al. Chronic Stress-Associated Depressive Disorders: The Impact of HPA Axis Dysregulation and Neuroinflammation on the Hippocampus-A Mini Review. International Journal of Molecular Sciences 2025, 26, 2940. [Google Scholar] [CrossRef] [PubMed]
- Jia, Z.; Yu, W.; Li, X.; Dong, T.; Wang, X.; Li, J.; et al. Du-moxibustion ameliorates depression-like behavior and neuroinflammation in chronic unpredictable mild stress-induced mice. Journal of Affective Disorders 2024, 358, 211–221. [Google Scholar] [CrossRef] [PubMed]
- Du, Y.; Dou, Y.; Wang, M.; Wang, Y.; Yan, Y.; Fan, H.; et al. Efficacy and acceptability of anti-inflammatory agents in major depressive disorder: a systematic review and meta-analysis. Frontiers in Psychiatry 2024, 15, 1407529. [Google Scholar] [CrossRef]
- Gao, Z.; Luo, K.; Hu, Y.; Niu, Y.; Zhu, X.; Li, S.; et al. Melatonin alleviates chronic stress-induced hippocampal microglia pyroptosis and subsequent depression-like behaviors by inhibiting Cathepsin B/NLRP3 signaling pathway in rats. Translational Psychiatry 2024, 14, 166. [Google Scholar] [CrossRef]
- Tan, X.; Wang, D.; Lu, P.; Guan, S.; Zheng, Q.; Du, X.; et al. Bone marrow mesenchymal stem cells alleviate stress-induced hyperalgesia via restoring gut microbiota and inhibiting neuroinflammation in the spinal cord by targeting the AMPK/NF-κB signaling pathway. Life Sciences 2023, 314, 121318. [Google Scholar] [CrossRef]
- Wang, Q.; Xu, Y.; Zhu, S.; Jiang, L.; Yao, L.; Yu, X.; et al. Mesenchymal stem cells improve depressive disorder via inhibiting the inflammatory polarization of microglia. Journal of Psychiatric Research 2024, 179, 105–116. [Google Scholar] [CrossRef]
- Zhang, L.-w.; Cui, C.-a.; Liu, C.; Sun, L.-p.; Ouyang, Y.-n.; Li, L.-f.; et al. Auraptene-ameliorating depressive-like behaviors induced by lipopolysaccharide combined with chronic unpredictable mild stress in mice mitigate hippocampal neuroinflammation mediated by microglia. International Immunopharmacology 2024, 136, 112330. [Google Scholar] [CrossRef] [PubMed]
- Jangra, A.; Dwivedi, S.; Sriram, C.S.; Gurjar, S.S.; Kwatra, M.; Sulakhiya, K.; et al. Honokiol abrogates chronic restraint stress-induced cognitive impairment and depressive-like behaviour by blocking endoplasmic reticulum stress in the hippocampus of mice. European Journal of Pharmacology 2016, 770, 25–32. [Google Scholar] [CrossRef] [PubMed]
- Adachi, N.; Sakhri, F.Z.; Ikemoto, H.; Ohashi, Y.; Kato, M.; Inoue, T.; et al. Kamikihito rescued depressive-like behaviors and hippocampus neurogenesis in chronic restraint stress rats. Journal of Traditional and Complementary Medicine 2022, 12, 172–179. [Google Scholar] [CrossRef]
- Berk, M.; Williams, L.J.; Jacka, F.N.; O'Neil, A.; Pasco, J.A.; Moylan, S.; et al. So depression is an inflammatory disease, but where does the inflammation come from? BMC Medicine 2013, 11, 200. [Google Scholar] [CrossRef]
- Grygiel-Górniak, B.; Limphaibool, N.; Puszczewicz, M. Cytokine secretion and the risk of depression development in patients with connective tissue diseases. Psychiatry and Clinical Neurosciences 2019, 73, 302–316. [Google Scholar] [CrossRef]
- Chang, J.; Jiang, T.; Shan, X.; Zhang, M.; Li, Y.; Qi, X.; et al. Pro-inflammatory cytokines in stress-induced depression: Novel insights into mechanisms and promising therapeutic strategies. Progress in Neuro-Psychopharmacology and Biological Psychiatry 2024, 131, 110931. [Google Scholar] [CrossRef]
- Kaufmann, F.N.; Costa, A.P.; Ghisleni, G.; Diaz, A.P.; Rodrigues, A.L.S.; Peluffo, H.; et al. NLRP3 inflammasome-driven pathways in depression: Clinical and preclinical findings. Brain Behav Immun 2017, 64, 367–383. [Google Scholar] [CrossRef] [PubMed]
- Xia, C.-Y.; Guo, Y.-X.; Lian, W.-W.; Yan, Y.; Ma, B.-Z.; Cheng, Y.-C.; et al. The NLRP3 inflammasome in depression: Potential mechanisms and therapies. Pharmacological Research 2023, 187, 106625. [Google Scholar] [CrossRef] [PubMed]
- Hassamal, S. Chronic stress, neuroinflammation, and depression: an overview of pathophysiological mechanisms and emerging anti-inflammatories. Front Psychiatry 2023, 14, 1130989. [Google Scholar] [CrossRef] [PubMed]
- Hodes, G.; Bangasser, D.; Sotiropoulos, I.; Kokras, N.; Dalla, C. Sex Differences in Stress Response: Classical Mechanisms and Beyond. Current Neuropharmacology 2023, 22. [Google Scholar] [CrossRef] [PubMed]
- Misiak, B.; Łoniewski, I.; Marlicz, W.; Frydecka, D.; Szulc, A.; Rudzki, L.; et al. The HPA axis dysregulation in severe mental illness: Can we shift the blame to gut microbiota? Progress in Neuro-Psychopharmacology and Biological Psychiatry 2020, 102, 109951. [Google Scholar] [CrossRef] [PubMed]
- Foster, J.A.; Rinaman, L.; Cryan, J.F. Stress & the gut-brain axis: Regulation by the microbiome. Neurobiology of Stress 2017, 7, 124–136. [Google Scholar] [CrossRef]
- El Marzouki, H.; Aboussaleh, Y.; Najimi, M.; Chigr, F.; Ahami, A. Effect of Cold Stress on Neurobehavioral and Physiological Parameters in Rats. Frontiers in Physiology 2021, 12, 660124. [Google Scholar] [CrossRef]
- Vittengl, J.R. Are body weight changes depressogenic? Even intentional weight loss correlates with increased depressive symptomatology among overweight or obese adults in the United States. Journal of Affective Disorders Reports 2022, 10, 100441. [Google Scholar] [CrossRef]
- Werner, A.M.; Ernst, M.; Brähler, E.; Tibubos, A.N.; Otten, D.; Reiner, I.; et al. The association of depressive symptoms and body weight change in midlife - Results from the Gutenberg Health Study in Germany. Journal of Affective Disorders 2023, 332, 115–124. [Google Scholar] [CrossRef]
- Ma, Y.; Fei, Y.; Han, X.; Liu, G.; Fang, J. Lactobacillus plantarum Alleviates Obesity by Altering the Composition of the Gut Microbiota in High-Fat Diet-Fed Mice. Front Nutr 2022, 9, 947367. [Google Scholar] [CrossRef] [PubMed]
- Rahayu, E.S.; Mariyatun, M.; Putri Manurung, N.E.; Hasan, P.N.; Therdtatha, P.; Mishima, R.; et al. Effect of probiotic Lactobacillus plantarum Dad-13 powder consumption on the gut microbiota and intestinal health of overweight adults. World J Gastroenterol 2021, 27, 107–128. [Google Scholar] [CrossRef]
- Rousseaux, C.G.; Bracken, W.M.; Guionaud, S. Chapter 1 - Overview of Drug Development. In Haschek and Rousseaux' s Handbook of Toxicologic Pathology (Fourth Edition); Haschek, W.M., Rousseaux, C.G., Wallig, M.A., Bolon, B., Bolon, B., Heinz-Taheny, K.M., et al., Eds.; Academic Press, 2023; pp. 3–48. [Google Scholar] [CrossRef]
- Gilsanz, P.; Karter, A.J.; Beeri, M.S.; Quesenberry, C.P.; Jr Whitmer, R.A. The Bidirectional Association Between Depression and Severe Hypoglycemic and Hyperglycemic Events in Type 1 Diabetes. Diabetes Care 2018, 41, 446–452. [Google Scholar] [CrossRef]
- Iqbal, A.; Prince, L.R.; Novodvorsky, P.; Bernjak, A.; Thomas, M.R.; Birch, L.; et al. Effect of Hypoglycemia on Inflammatory Responses and the Response to Low-Dose Endotoxemia in Humans. J Clin Endocrinol Metab 2019, 104, 1187–1199. [Google Scholar] [CrossRef]
- Yohei, K.; Masanori, I.; Hiroki, F.; Toshiaki, O.; Shinako, K.; Hitoshi, I.; et al. Association of severe hypoglycemia with depressive symptoms in patients with type 2 diabetes: the Fukuoka Diabetes Registry. BMJ Open Diabetes Research & Care 2015, 3, e000063. [Google Scholar] [CrossRef] [PubMed]
- Györfi, O.; Nagy, H.; Bokor, M.; Moustafa, A.A.; Rosenzweig, I.; Kelemen, O.; et al. Reduced CA2-CA3 Hippocampal Subfield Volume Is Related to Depression and Normalized by l-DOPA in Newly Diagnosed Parkinson's Disease. Frontiers in Neurology 2017, 8, 84. [Google Scholar] [CrossRef] [PubMed]
- van Gemert, N.G.; Carvalho, D.M.M.; Karst, H.; van der Laan, S.; Zhang, M.; Meijer, O.C.; et al. Dissociation between Rat Hippocampal CA1 and Dentate Gyrus Cells in Their Response to Corticosterone: Effects on Calcium Channel Protein and Current. Endocrinology 2009, 150, 4615–4624. [Google Scholar] [CrossRef] [PubMed]
- Inserra, A.; Mastronardi, C.; Rogers, G.; Licinio, J.; Wong, M.-L. Neuroimmunomodulation in Major Depressive Disorder: Focus on Caspase 1, Inducible Nitric Oxide Synthase, and Interferon-Gamma. Molecular Neurobiology 2019, 56. [Google Scholar] [CrossRef] [PubMed]
- Hu, X.; Pang, H.; Liu, J.; Wang, Y.; Lou, Y.; Zhao, Y. A network medicine-based approach to explore the relationship between depression and inflammation. Frontiers in Psychiatry 2023, 14, 1184188. [Google Scholar] [CrossRef] [PubMed]
- Amodeo, G.; Trusso, M.A.; Fagiolini, A. Depression and inflammation: Disentangling a clear yet complex and multifaceted link. Neuropsychiatry 2017, 7, 448–457. [Google Scholar] [CrossRef]
- Moon, Y.K.; Kim, H.; Kim, S.; Lim, S.W.; Kim, D.K. Influence of antidepressant treatment on SLC6A4 methylation in Korean patients with major depression. Am J Med Genet B Neuropsychiatr Genet 2023, 192, 28–37. [Google Scholar] [CrossRef] [PubMed]
- Eslami, M.; Monemi, M.; Nazari, M.A.; Azami, M.H.; Shariat Rad, P.; Oksenych, V.; et al. The Anti-Inflammatory Potential of Tricyclic Antidepressants (TCAs): A Novel Therapeutic Approach to Atherosclerosis Pathophysiology. Pharmaceuticals 2025, 18, 197. [Google Scholar] [CrossRef] [PubMed]
- Gan, Y.L.; Wang, C.Y.; He, R.H.; Hsu, P.C.; Yeh, H.H.; Hsieh, T.H.; et al. FKBP51 mediates resilience to inflammation-induced anxiety through regulation of glutamic acid decarboxylase 65 expression in mouse hippocampus. J Neuroinflammation 2022, 19, 152. [Google Scholar] [CrossRef] [PubMed]









| Gene | Forward primer (5′-3′) | Reverse primer (5′-3′) | Product Size |
| IL-1β | TGGCTGTGGAGAAGCTGTGG | GCAGTGCAGCTGTCTAATGG | 170 |
| IL-6 | CCACTGCCTTCCCTACTTCAC | CAGTGCATCATCGCTGTTC | 185 |
| IL-18 | CCGAACAGCCAACGAATCC | GACATCCTTCCATCCTTCAC | 105 |
| TNF-α | CCCTCACACTCAGATCATCTTCTC | TCAGCCACTCCAGCTGCTCCTC | 96 |
| NF-kB | GGATGACAGAGGCGTGTATAAGG | GAGGAAGGCTGTGAACATGAGG | 194 |
| GAPDH | CTTTCTACATCCTGGCTCACAC | GTCCAGATGATTCAGAGCTCC | 151 |
| Groups Variables |
CTRL | CRS | CRS+PBS | CRS+MSCs | CRS+Flux pretreated MSCs | CRS+L.PS pretreated MSCs | Title 1 | Title 2 | Title 3 | Title 4 |
| Locomotion Frequency | 380.83±9.14 | 242.83±27.87*, .0001 | 266.16±14.23*, .003 | 387.83±14.5#&, .0001, .002 | 377.16±15.22#&, .0001, .004 | 412.16±27.8#&, .0001, .0001 | entry 1 * | data | data | data |
| Total Time in Center | 39.56±4.89 |
11.68±3.95*, .0001 | 11.28±3.45*, .0001 |
28.58±4.13#&, .043, .037 |
33.73±3.49#&, .004, .003 |
37.21±2.84#&, .001, .001 |
data | data | data | |
| Rearing | 30.83±2.52 |
13.83±1.44*, .0001 |
16.83±1.70*, .0001 | 22.16±2.18 |
23.33±2.53#, .029 |
29.16±1.66#&, .0001, .002 |
data | data | data | |
| Grooming | 9.33±0.84 | 3±0.57*, .0001 |
1.83±0.9*, .0001 | 6.16±0.87 | 5.5±0.61*&, .024, .034 | 6.83±0.94#&, .024, .002 | entry 2 | data | data | data |
| Licking/Cleaning | 5±1.12 | 2±0.73 | 3.33±0.95 | 2.16±0.87 | 3.33±1.05 | 4±0.85 | data | data | data | |
| Immobility Time | 66.59±11.17 |
105.45±4.76 | 101.42±4.11 | 83.61±16.76 | 75.17±12.5 | 69.64±11.23 | entry 3 | data | data | data |
| data | data | data | ||||||||
| data | data | data | ||||||||
| data | data | data | ||||||||
| entry 4 | data | data | data | |||||||
| data | data | data |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).