Submitted:
12 July 2025
Posted:
15 July 2025
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Materials and Methods
2.1. Mosquitoes Field Collections
2.2. Total Nucleic Acid Purification
2.3. WNV and USUV RNA Detection
2.4. Pan-Flavivirus RNA Detection
3. Results
3.1. Mosquito Collection
3.2. Viral Screening
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| WNV | West Nile Virus |
| USUV | Usutu virus |
| qRT-PCR | real time Reverse transcriptase Polymerase Chain Reaction |
| PCR | Polymerase Chain Reaction |
| NS5 | Non-Structural protein 5 |
| Spp. | Species pluralis |
| RNA | Ribonucleic Acid |
| SAGIR | French national network for the epidemiological surveillance of wildlife diseases |
| MEM | Minimum Essential Medium |
| 3’NC | 3’ Non-Coding |
| EQA | External Quality Assessment |
| COFRAC | French national body for laboratory and certification accreditation |
| EVAM | European Virus Archive – Marseille |
| Lyo P&P | Primers and Probes Lyophilized |
| PBS | Phosphate-Buffered Saline |
References
- Kuchinsky, S.C.; Duggal, N.K. Chapter Two - Usutu Virus, an Emerging Arbovirus with One Health Importance. In Advances in Virus Research; Macdiarmid, R., Lee, B., Beer, M., Eds.; Academic Press, 2024; Vol. 120, pp. 39–75. [Google Scholar]
- Pealer, L.N.; Marfin, A.A.; Petersen, L.R.; Lanciotti, R.S.; Page, P.L.; Stramer, S.L.; Stobierski, M.G.; Signs, K.; Newman, B.; Kapoor, H.; et al. Transmission of West Nile Virus through Blood Transfusion in the United States in 2002. N Engl J Med 2003, 349, 1236–1245. [Google Scholar] [CrossRef] [PubMed]
- Iwamoto, M.; Jernigan, D.B.; Guasch, A.; Trepka, M.J.; Blackmore, C.G.; Hellinger, W.C.; Pham, S.M.; Zaki, S.; Lanciotti, R.S.; Lance-Parker, S.E.; et al. Transmission of West Nile Virus from an Organ Donor to Four Transplant Recipients. N Engl J Med 2003, 348, 2196–2203. [Google Scholar] [CrossRef] [PubMed]
- Hayes, E.B.; O’Leary, D.R. West Nile Virus Infection: A Pediatric Perspective. Pediatrics 2004, 113, 1375–1381. [Google Scholar] [CrossRef] [PubMed]
- Martinet, J.-P.; Bohers, C.; Vazeille, M.; Ferté, H.; Mousson, L.; Mathieu, B.; Depaquit, J.; Failloux, A.-B. Assessing Vector Competence of Mosquitoes from Northeastern France to West Nile Virus and Usutu Virus. PLOS Neglected Tropical Diseases 2023, 17, e0011144. [Google Scholar] [CrossRef] [PubMed]
- Vilibic-Cavlek, T.; Petrovic, T.; Savic, V.; Barbic, L.; Tabain, I.; Stevanovic, V.; Klobucar, A.; Mrzljak, A.; Ilic, M.; Bogdanic, M.; et al. Epidemiology of Usutu Virus: The European Scenario. Pathogens 2020, 9, 699. [Google Scholar] [CrossRef] [PubMed]
- Seroprevalence of West Nile and Usutu Viruses in Military Working Horses and Dogs, Morocco, 2012: Dog as an Alternative WNV Sentinel Species? | Epidemiology & Infection | Cambridge Core Available online:. Available online: https://www.cambridge.org/core/journals/epidemiology-and-infection/article/seroprevalence-of-west-nile-and-usutu-viruses-in-military-working-horses-and-dogs-morocco-2012-dog-as-an-alternative-wnv-sentinel-species/F1E419419D8A8C04D458474207430C8C (accessed on 14 May 2025).
- Maquart, M.; Dahmani, M.; Marié, J.-L.; Gravier, P.; Leparc-Goffart, I.; Davoust, B. First Serological Evidence of West Nile Virus in Horses and Dogs from Corsica Island, France. Vector Borne Zoonotic Dis 2017, 17, 275–277. [Google Scholar] [CrossRef] [PubMed]
- Csank, T.; Drzewnioková, P.; Korytár, Ľ.; Major, P.; Gyuranecz, M.; Pistl, J.; Bakonyi, T. A Serosurvey of Flavivirus Infection in Horses and Birds in Slovakia. Vector-Borne and Zoonotic Diseases 2018, 18, 206–213. [Google Scholar] [CrossRef] [PubMed]
- Bażanów, B.; Jansen van Vuren, P.; Szymański, P.; Stygar, D.; Frącka, A.; Twardoń, J.; Kozdrowski, R.; Pawęska, J.T. A Survey on West Nile and Usutu Viruses in Horses and Birds in Poland. Viruses 2018, 10, 87. [Google Scholar] [CrossRef] [PubMed]
- Diagne, M.M.; Ndione, M.H.D.; Di Paola, N.; Fall, G.; Bedekelabou, A.P.; Sembène, P.M.; Faye, O.; Zanotto, P.M. de A.; Sall, A.A. Usutu Virus Isolated from Rodents in Senegal. Viruses 2019, 11, 181. [Google Scholar] [CrossRef] [PubMed]
- Romeo, C.; Lecollinet, S.; Caballero, J.; Isla, J.; Luzzago, C.; Ferrari, N.; García-Bocanegra, I. Are Tree Squirrels Involved in the Circulation of Flaviviruses in Italy? Transboundary and Emerging Diseases 2018, 65, 1372–1376. [Google Scholar] [CrossRef] [PubMed]
- Escribano-Romero, E.; Lupulović, D.; Merino-Ramos, T.; Blázquez, A.-B.; Lazić, G.; Lazić, S.; Saiz, J.-C.; Petrović, T. West Nile Virus Serosurveillance in Pigs, Wild Boars, and Roe Deer in Serbia. Veterinary Microbiology 2015, 176, 365–369. [Google Scholar] [CrossRef] [PubMed]
- Bournez, L.; Umhang, G.; Faure, E.; Boucher, J.-M.; Boué, F.; Jourdain, E.; Sarasa, M.; Llorente, F.; Jiménez-Clavero, M.A.; Moutailler, S.; et al. Exposure of Wild Ungulates to the Usutu and Tick-Borne Encephalitis Viruses in France in 2009–2014: Evidence of Undetected Flavivirus Circulation a Decade Ago. Viruses 2020, 12, 10. [Google Scholar] [CrossRef] [PubMed]
- Cadar, D.; Becker, N.; Campos, R. de M.; Börstler, J.; Jöst, H.; Schmidt-Chanasit, J. Usutu Virus in Bats, Germany, 2013. Emerg Infect Dis 2014, 20, 1771–1773. [Google Scholar] [CrossRef] [PubMed]
- Simonin, Y. Circulation of West Nile Virus and Usutu Virus in Europe: Overview and Challenges. Viruses 2024, 16, 599. [Google Scholar] [CrossRef] [PubMed]
- Nasci, R.S.; Savage, H.M.; White, D.J.; Miller, J.R.; Cropp, B.C.; Godsey, M.S.; Kerst, A.J.; Bennett, P.; Gottfried, K.; Lanciotti, R.S. West Nile Virus in Overwintering Culex Mosquitoes, New York City, 2000. Emerg Infect Dis 2001, 7, 742–744. [Google Scholar] [CrossRef] [PubMed]
- Reisen, W.K.; Wheeler, S.S. Overwintering of West Nile Virus in the United States. J Med Entomol 2019, 56, 1498–1507. [Google Scholar] [CrossRef] [PubMed]
- Baqar, S.; Hayes, C.G.; Murphy, J.R.; Watts, D.M. Vertical Transmission of West Nile Virus by Culex and Aedes Species Mosquitoes. Am J Trop Med Hyg 1993, 48, 757–762. [Google Scholar] [CrossRef] [PubMed]
- Rosen, L. Further Observations on the Mechanism of Vertical Transmission of Flaviviruses by Aedes Mosquitoes. Am J Trop Med Hyg 1988, 39, 123–126. [Google Scholar] [CrossRef] [PubMed]
- Bouchez-Zacria, M.; Calenge, C.; Villers, A.; Lecollinet, S.; Gonzalez, G.; Quintard, B.; Leclerc, A.; Baurier, F.; Paty, M.-C.; Faure, É.; et al. Relevance of the synergy of surveillance and populational networks in understanding the Usutu virus outbreak within common blackbirds (Turdus merula) in Metropolitan France, 2018. Peer Community Journal 2025, 5. [Google Scholar] [CrossRef]
- Decors, A.; Beck, C. 2018, En France : Record de Circulation Du Virus Usutu. Faune sauvage 2019, 9–14. [Google Scholar]
- Schopf, F.; Sadeghi, B.; Bergmann, F.; Fischer, D.; Rahner, R.; Müller, K.; Günther, A.; Globig, A.; Keller, M.; Schwehn, R.; et al. Circulation of West Nile Virus and Usutu Virus in Birds in Germany, 2021 and 2022. Infect Dis (Lond) 2025, 57, 256–277. [Google Scholar] [CrossRef] [PubMed]
- Lecollinet, S.; Blanchard, Y.; Manson, C.; Lowenski, S.; Laloy, E.; Quenault, H.; Touzain, F.; Lucas, P.; Eraud, C.; Bahuon, C.; et al. Dual Emergence of Usutu Virus in Common Blackbirds, Eastern France, 2015. Emerg. Infect. Dis. 2016, 22, 2225–2225. [Google Scholar] [CrossRef] [PubMed]
- Romiti, F.; Casini, R.; Del Lesto, I.; Magliano, A.; Ermenegildi, A.; Droghei, S.; Tofani, S.; Scicluna, M.T.; Pichler, V.; Augello, A.; et al. Characterization of Overwintering Sites (Hibernacula) of the West Nile Vector Culex Pipiens in Central Italy. Parasit Vectors 2025, 18, 74. [Google Scholar] [CrossRef] [PubMed]
- Kauffman, E.B.; Franke, M.A.; Kramer, L.D. Detection Protocols for West Nile Virus in Mosquitoes, Birds, and Nonhuman Mammals. In West Nile Virus; Colpitts, T.M., Ed.; Methods in Molecular Biology; Springer New York: New York, NY, 2016; Vol. 1435, pp. 175–206. ISBN 978-1-4939-3668-7. [Google Scholar]
- Linke, S.; Ellerbrok, H.; Niedrig, M.; Nitsche, A.; Pauli, G. Detection of West Nile Virus Lineages 1 and 2 by Real-Time PCR. Journal of Virological Methods 2007, 146, 355–358. [Google Scholar] [CrossRef] [PubMed]
- Tang, Y.; Anne Hapip, C.; Liu, B.; Fang, C.T. Highly Sensitive TaqMan RT-PCR Assay for Detection and Quantification of Both Lineages of West Nile Virus RNA. Journal of Clinical Virology 2006, 36, 177–182. [Google Scholar] [CrossRef] [PubMed]
- Weissenböck, H.; Bakonyi, T.; Rossi, G.; Mani, P.; Nowotny, N. Usutu Virus, Italy, 1996. Emerg Infect Dis 2013, 19, 274–277. [Google Scholar] [CrossRef] [PubMed]
- Nikolay, B.; Weidmann, M.; Dupressoir, A.; Faye, O.; Boye, C.S.; Diallo, M.; Sall, A.A. Development of a Usutu Virus Specific Real-Time Reverse Transcription PCR Assay Based on Sequenced Strains from Africa and Europe. Journal of Virological Methods 2014, 197, 51–54. [Google Scholar] [CrossRef] [PubMed]
- Scaramozzino, N.; Crance, J.-M.; Jouan, A.; DeBriel, D.A.; Stoll, F.; Garin, D. Comparison of Flavivirus Universal Primer Pairs and Development of a Rapid, Highly Sensitive Heminested Reverse Transcription-PCR Assay for Detection of Flaviviruses Targeted to a Conserved Region of the NS5 Gene Sequences. J Clin Microbiol 2001, 39, 1922–1927. [Google Scholar] [CrossRef] [PubMed]
- Rudolf, I.; Betášová, L.; Blažejová, H.; Venclíková, K.; Straková, P.; Šebesta, O.; Mendel, J.; Bakonyi, T.; Schaffner, F.; Nowotny, N.; et al. West Nile Virus in Overwintering Mosquitoes, Central Europe. Parasit Vectors 2017, 10, 452. [Google Scholar] [CrossRef] [PubMed]
- Blom, R.; Schrama, M.J.J.; Spitzen, J.; Weller, B.F.M.; van der Linden, A.; Sikkema, R.S.; Koopmans, M.P.G.; Koenraadt, C.J.M. Arbovirus Persistence in North-Western Europe: Are Mosquitoes the Only Overwintering Pathway? One Health 2022, 16, 100467. [Google Scholar] [CrossRef] [PubMed]
- Koenraadt, C.J.M.; Münger, E.; Schrama, M.J.J.; Spitzen, J.; Altundag, S.; Sikkema, R.S.; Munnink, B.B.O.; Koopmans, M.P.G.; Blom, R. Overwintering of Usutu Virus in Mosquitoes, The Netherlands. Parasit Vectors 2024, 17, 537. [Google Scholar] [CrossRef] [PubMed]
- Kampen, H.; Tews, B.A.; Werner, D. First Evidence of West Nile Virus Overwintering in Mosquitoes in Germany. Viruses 2021, 13, 2463. [Google Scholar] [CrossRef] [PubMed]


| Reference | Primer/Probe | 5’ -> 3’ Sequence | Target | Position |
| Linke et al. [27] | ProC-F1 | CCTGTGTGAGCTGACAAACTTAGT | Capsid | 10-33 |
| ProC-R | GCGTTTTAG CATATTGACAGCC | 132-153 | ||
| ProC-TM | 6FAM-CCTGGTTTCTTAGACATCGAGATCTTCGTGC-TAMRA | 89-113 | ||
| Tang et al. [28] | WN10533-10552 | AAGTTGAGTAGACGGTGCTG | 3′ non-coding region | 10533-10552 |
| WN10625-10606 | AGACGGTTCTGAGGGCTTAC | 10625-10606 | ||
| WN10560-10579 | 6FAM-CTCAACCCCAGGAGGACTGG-TAMRA | 10560-10579 |
| Reference | Primer/Probe | 5’ > 3’ Sequence | Target | Position |
| Nikolay et al. [30] | UsuFP | CAAAGCTGGACAGACATCCCTTAC | Non-structural protein 5 (NS5) | 10189-10212 |
| UsuRP | CGTAGATGTTTTCAGCCCACGT | 10270-10292 | ||
| UsuP_FAM | 6FAM-AAGACATATGGTGTGGAAGCCTGATAGGCA-TAMRA | 10226-10255 | ||
| Weissenböck et al. [29] | USU-Weiss-F | GCCAATGCCCTGCACTTT | Non-structural protein 5 (NS5) | 9721-9739 |
| USU-Weiss-R | TCCCGAGGAGGGTTTCCA | 9777-9795 | ||
| USU-Weiss-P | 6FAM-CGATGTCCAAGGTCAGAAAAGACGTGC-TAMRA | 9746-9773 |
| Reference | Primer/Probe | 5’ > 3’ Sequence | Target | Position |
| Scaramozzino et al. [31] | MAMD | AACATGATGGGRAARAGRGARAA | NS5 (non-structural protein 5) | 9006-9029 |
| cFD2 | GTGTCCCAGCCGGCGGTGTCATCAGC | 9232-9258 |
| Collection date | Number of females collected | PCR assays | Results | Total females tested in qRT-PCR |
| Oct - Dec 2021 | 2,163 (225 pools) | WNV/USUV, pan-flavivirus | Negative | 10,617 (1,121 pools) |
| Jan – Feb & Nov 2022 | 5,838 (607 pools) | Negative | ||
| Feb & Oct 2023 | 523 (71 pools) | Negative | ||
| Feb 2024 | 2,093 (218 pools) | Negative |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).