Submitted:
10 June 2025
Posted:
10 June 2025
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Materials and Methods
2.1. Poliomyelitis Virus Propagation
2.2. Inactivation by Electron Beam Irradiation or Chemicals
2.3. Quantitative Polymerase-Chain Reaction (qPCR)
2.4. Electrochemical Study
2.5. Statistics
3. Results
3.1. Quality of RNA Isolated from Inactivated Virus
D Left Segment of Poliovirus Most Sensitive to Accelerated Electrons
3.4. Electroanalysis of Poliovirus RNA Degradation on SPE/SWCNT
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Piniaeva, A.; Ignatyev, G.; Kozlovskaya, L.; Ivin, Y.; Kovpak, A.; Ivanov, A.; Shishova, A.; Antonova, L.; Khapchaev, Y.; Feldblium, I.; et al. Immunogenicity and Safety of Inactivated Sabin-Strain Polio Vaccine “PoliovacSin”: Clinical Trials Phase I and II. Vaccines 2021, 9, 565. [Google Scholar] [CrossRef]
- Dowdle, W.R.; De Gourville, E.; Kew, O.M.; Pallansch, M.A.; Wood, D.J. Polio eradication: the OPV paradox. Rev. Med. Virol. 2003, 13, 277–291. [Google Scholar] [CrossRef]
- Polio Eradication Strategy 2022–2026: Executive summary. Geneva: World Health Organization; 2021. Licence CC BY-NC-SA 3.0 IGO. 2021.
- Bakker, W.A.M.; Thomassen, Y.E.; van’t Oever, A.G.; Westdijk, J.; van Oijen, M.G.C.T.; Sundermann, L.C.; van’t Veld, P.; Sleeman, E.; van Nimwegen, F.W.; Hamidi, A.; et al. Inactivated polio vaccine development for technology transfer using attenuated Sabin poliovirus strains to shift from Salk-IPV to Sabin-IPV. Vaccine 2011, 29, 7188–7196. [Google Scholar] [CrossRef] [PubMed]
- Sanders, B.; Koldijk, M.; Schuitemaker, H. Inactivated Viral Vaccines. Vaccine Anal. Strateg. Princ. Control 2014, 45–80. [Google Scholar]
- Wilton, T.; Dunn, G.; Eastwood, D.; Minor, P.D.; Martin, J. Effect of Formaldehyde Inactivation on Poliovirus. J. Virol. 2014, 88, 11955–11964. [Google Scholar] [CrossRef] [PubMed]
- Zhdanov, D.D.; Ivin, Y.Y.; Shishparenok, A.N.; Kraevskiy, S. V; Kanashenko, S.L.; Agafonova, L.E.; Shumyantseva, V. V; Gnedenko, O. V; Pinyaeva, A.N.; Kovpak, A.A.; et al. Perspectives for the creation of a new type of vaccine preparations based on pseudovirus particles using polio vaccine as an example. Biomed. Khim. 2023, 69, 253–280. [Google Scholar] [CrossRef] [PubMed]
- Sabbaghi, A.; Miri, S.M.; Keshavarz, M.; Zargar, M.; Ghaemi, A. Inactivation methods for whole influenza vaccine production. Rev. Med. Virol. 2019, 29. [Google Scholar] [CrossRef]
- Seo, H.S. Application of radiation technology in vaccines development. Clin. Exp. Vaccine Res. 2015, 4, 145–158. [Google Scholar] [CrossRef]
- Quarleri, J. Poliomyelitis is a current challenge: long-term sequelae and circulating vaccine-derived poliovirus. GeroScience 2023, 45, 707–717. [Google Scholar] [CrossRef]
- Bahar, M.W.; Porta, C.; Fox, H.; Macadam, A.J.; Fry, E.E.; Stuart, D.I. Mammalian expression of virus-like particles as a proof of principle for next generation polio vaccines. NPJ vaccines 2021, 6, 1–10. [Google Scholar] [CrossRef]
- Lentz, K.N.; Smith, A.D.; Geisler, S.C.; Cox, S.; Buontempo, P.; Skelton, A.; DeMartino, J.; Rozhon, E.; Schwartz, J.; Girijavallabhan, V.; et al. Structure of poliovirus type 2 Lansing complexed with antiviral agent SCH48973: comparison of the structural and biological properties of the three poliovirus serotypes. Structure 1997, 5, 961–978. [Google Scholar] [CrossRef] [PubMed]
- He, Z.; Kwee, E.J.; Cleveland, M.H.; Cole, K.D.; Lin-Gibson, S.; He, H.-J. Quantitation and integrity evaluation of RNA genome in lentiviral vectors by direct reverse transcription-droplet digital PCR (direct RT-ddPCR). Sci. Rep. 2023, 13, 14470. [Google Scholar] [CrossRef] [PubMed]
- Wurtzer, S.; Duvivier, M.; Accrombessi, H.; Levert, M.; Richard, E.; Moulin, L. Assessing RNA integrity by digital RT-PCR: Influence of extraction, storage, and matrices. Biol. methods Protoc. 2024, 9, bpae053. [Google Scholar] [CrossRef] [PubMed]
- Burton, J.; Love, H.; Richards, K.; Burton, C.; Summers, S.; Pitman, J.; Easterbrook, L.; Davies, K.; Spencer, P.; Killip, M.; et al. The effect of heat-treatment on SARS-CoV-2 viability and detection. J. Virol. Methods 2021, 290, 114087. [Google Scholar] [CrossRef]
- Sabat, J.; Subhadra, S.; Rath, S.; Ho, L.M.; Kanungo, S.; Panda, S.; Mandal, M.C.; Dash, S.; Pati, S.; Turuk, J. Yielding quality viral RNA by using two different chemistries: a comparative performance study. Biotechniques 2021, 71, 510–515. [Google Scholar] [CrossRef]
- Van Holm, W.; Ghesquière, J.; Boon, N.; Verspecht, T.; Bernaerts, K.; Zayed, N.; Chatzigiannidou, I.; Teughels, W. A Viability Quantitative PCR Dilemma: Are Longer Amplicons Better? Appl. Environ. Microbiol. 2021, 87, e0265320. [Google Scholar] [CrossRef]
- Ogata, H.; Claverie, J.-M. Unique genes in giant viruses: regular substitution pattern and anomalously short size. Genome Res. 2007, 17, 1353–1361. [Google Scholar] [CrossRef]
- Shumyantseva, V. V.; Agafonova, L.E.; Bulko, T. V.; Kuzikov, A. V.; Masamrekh, R.A.; Yuan, J.; Pergushov, D. V.; Sigolaeva, L. V. Electroanalysis of Biomolecules: Rational Selection of Sensor Construction. Biochem. 2021, 86, S140–S151. [Google Scholar] [CrossRef]
- Shumyantseva, V. V; Koroleva, P.I.; Bulko, T. V; Agafonova, L.E. Alternative Electron Sources for Cytochrome P450s Catalytic Cycle: Biosensing and Biosynthetic Application. Processes 2023, 11. [Google Scholar] [CrossRef]
- Paleček, E.; Bartošík, M. Electrochemistry of nucleic acids. Chem. Rev. 2012, 112, 3427–3481. [Google Scholar] [CrossRef]
- Shumyantseva, V. V; Pronina, V. V; Bulko, T. V; Agafonova, L.E. Electroanalysis in Pharmacogenomic Studies: Mechanisms of Drug Interaction with DNA. Biochemistry. (Mosc). 2024, 89, S224–S233. [Google Scholar] [CrossRef]
- Agafonova, L.; Tikhonova, E.; Sanzhakov, M.; Kostryukova, L.; Shumyantseva, V. Electrochemical Studies of the Interaction of Phospholipid Nanoparticles with dsDNA. Processes 2022, 10, 2324. [Google Scholar] [CrossRef]
- Shumyantseva, V. V; Bulko, T. V; Agafonova, L.E.; Pronina, V. V; Kostryukova, L. V Comparative Analysis of the Interaction between the Antiviral Drug Umifenovir and Umifenovir Encapsulated in Phospholipids Micelles (Nanosome/Umifenovir) with dsDNA as a Model for Pharmacogenomic Analysis by Electrochemical Methods. Processes 2023, 11. [Google Scholar] [CrossRef]
- Shumyantseva, V. V; Berezhnova, A. V; Agafonova, L.E.; Bulko, T. V; Veselovsky, A. V Electrochemical Analysis of the Interaction between DNA and Abiraterone D4A Metabolite. J. Anal. Chem. 2024, 79, 873–882. [Google Scholar] [CrossRef]
- Agafonova L.E.; Zhdanov D.D.; Gladilina Yu.A.; Shisparenok A.N.; Shumyantseva V.V. Electrochemical approach for the analysis of DNA degradation in native DNA and apoptotic cells. HELIYON-D-23-46903 2023.
- Thomassen, Y.E.; Welle, J.; van Eikenhorst, G.; van der Pol, L.A.; Bakker, W.A.M. Transfer of an adherent Vero cell culture method between two different rocking motion type bioreactors with respect to cell growth and metabolic rates. Process Biochem. 2012, 47, 288–296. [Google Scholar] [CrossRef]
- Jiang, S.D.; Pye, D.; Cox, J.C. Inactivation of poliovirus with beta-propiolactone. J. Biol. Stand. 1986, 14, 103–109. [Google Scholar] [CrossRef] [PubMed]
- Ozer, T.; Geiss, B.J.; Henry, C.S. Review-Chemical and Biological Sensors for Viral Detection. J. Electrochem. Soc. 2020, 167, 37523. [Google Scholar] [CrossRef] [PubMed]
- Stempkowska, I.; Ligaj, M.; Jasnowska, J.; Langer, J.; Filipiak, M. Electrochemical response of oligonucleotides on carbon paste electrode. Bioelectrochemistry 2007, 70, 488–494. [Google Scholar] [CrossRef]
- Brabec, V.; Koudelka, J. Oxidation of deoxyribonucleic acid at carbon electrodes. The effect of the quality of the deoxyribonucleic acid sample. J. Electroanal. Chem. Interfacial Electrochem. 1980, 116, 793–805. [Google Scholar] [CrossRef]
- Grieb, T.; Forng, R.-Y.; Brown, R.; Owolabi, T.; Maddox, E.; Mcbain, A.; Drohan, W.N.; Mann, D.M.; Burgess, W.H. Effective use of Gamma Irradiation for Pathogen Inactivation of Monoclonal Antibody Preparations. Biologicals 2002, 30, 207–216. [Google Scholar] [CrossRef]
- Ranawat, P.; Rawat, S. Radiation resistance in thermophiles: mechanisms and applications. World J. Microbiol. Biotechnol. 2017, 33, 112. [Google Scholar] [CrossRef]
- Comas-Garcia, M. Packaging of Genomic RNA in Positive-Sense Single-Stranded RNA Viruses: A Complex Story. Viruses 2019, 11. [Google Scholar] [CrossRef] [PubMed]
- Song, Y.; Gorbatsevych, O.; Liu, Y.; Mugavero, J.; Shen, S.H.; Ward, C.B.; Asare, E.; Jiang, P.; Paul, A. V; Mueller, S.; et al. Limits of variation, specific infectivity, and genome packaging of massively recoded poliovirus genomes. Proc. Natl. Acad. Sci. 2017, 114, E8731–E8740. [Google Scholar] [CrossRef]
- Venkatesh, A.G.; Brickner, H.; Looney, D.; Hall, D.A.; Aronoff-Spencer, E. Clinical detection of Hepatitis C viral infection by yeast-secreted HCV-core:Gold-binding-peptide. Biosens. Bioelectron. 2018, 119, 230–236. [Google Scholar] [CrossRef] [PubMed]
- Sha, Z.; Xu, J.; Wang, Y.; Ma, L.; Li, X.; Chen, Y.; Gu, H.-Y. Direct electrochemistry & enzyme characterization of fresh tobacco RNA. J. Electroanal. Chem. 2023, 931, 117156. [Google Scholar] [CrossRef]





| # | Region Name | Sense primer (5’-3’) | Antisense primer (5’-3’) | Product size, bp | Start position |
|---|---|---|---|---|---|
| 1 | CloSpa | aacagctctggggttgtacc | tggtttcgtgcttctaagttgc | 118 | 5 |
| 2 | IRES | tccccggtgacattgcatag | caaagtagtcggttccgcca | 373 | 176 |
| 3 | VP4 | gcgcccaagtttcatcacag | tttagcatgggagcggtctta | 202 | 752 |
| 4 | VP2 left | tccccaaacattgaggcgtg | tctggaactgcaaacacccc | 386 | 955 |
| 5 | VP2 right | agaatgcgaatccaggcgaa | tggcacagtgatgttgcgta | 371 | 1388 |
| 6 | VP3 left | gtaaccagtacctgaccgca | gagagacacaagatcggcgt | 229 | 1796 |
| 7 | VP3 right | ttttgcggctcaatgatggc | tatctcgcagtaagcgcaca | 325 | 2125 |
| 8 | VP1 left | tggtgacatgattgaggggg | gactctgatcgcgttcgtct | 219 | 2486 |
| 9 | VP1 middle | cggacatgcattgaaccaagt | attcccacgtagggcactga | 162 | 2922 |
| 10 | VP1 right | gtaccactagcgggtcaagc | cccttttctggtagtggggt | 261 | 3142 |
| 11 | 2A | gcaaaatgccgtgagtgtca | ctgctccatagcttcctcctc | 367 | 3465 |
| 12 | 2B | tgagtcacttggtgctgcat | ttctttagccactgccacgg | 231 | 3849 |
| 13 | 2C left | ctgcaaagggactggagtgg | agtggtgcaaacctcttgga | 237 | 4163 |
| 14 | 2C middle | gagcaagcaccgtattgagc | tgcctttctcttctagcgagg | 287 | 4467 |
| 15 | 2C right | accaactccagtcggatcac | aactgaattgccttgccaca | 212 | 4786 |
| 16 | 3A | ccctccggagtgtatcaacg | gcccagcgaacagcttgta | 209 | 5157 |
| 17 | 3C | aggccctgggtttgattacg | ggtttgtcgtccaccgagat | 397 | 5436 |
| 18 | 3D left | aaccaaacttgaacccagcg | tccgcatttccttggtgtct | 362 | 6051 |
| 19 | 3D middle | gtggagcagggaaaatccag | ggcatgccgccttttacg | 359 | 6487 |
| 20 | 3D right | tacccccatgaggttgatgc | acggcggtacaatgtagagt | 369 | 6985 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).