Submitted:
04 May 2025
Posted:
06 May 2025
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Materials and Methods
3. Results
3.1. Outline of the Validation Strategy
3.2. Validation of the FLT3-ITD Assay with TapeStation Readout
3.3. Validation of the FLT3-TKD Assay with TapeStation Readout
3.4. Limitations of the Modified FLT3 Assay in Detecting Very Small FLT3 ITDs
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| AML | Acute myeloid leukemia |
| ITD(s) | Internal tandem duplication(s) |
| JMD | Juxtamembrane domain |
| TKD | Tyrosine kinase domain |
| PCR | Polymerase chain reaction |
| CE | Capillary electrophoresis |
| wt | Wild type |
| PAGE | Polyacrylamide gel electrophoresis |
| NGS | Next-generation sequencing |
| bp | Base pairs |
| NTC | No template control |
| VAF | Variant allele frequency |
| EPG | Electropherogram |
| VSI(s) | Very short insert(s) |
References
- Fedorov, K.; Maiti, A.; Konopleva, M. Targeting FLT3 Mutation in Acute Myeloid Leukemia: Current Strategies and Future Directions. Cancers (Basel) 2023, 15. [Google Scholar] [CrossRef] [PubMed]
- Grafone, T.; Palmisano, M.; Nicci, C.; Storti, S. An overview on the role of FLT3-tyrosine kinase receptor in acute myeloid leukemia: biology and treatment. Oncol Rev 2012, 6, e8. [Google Scholar] [CrossRef]
- Thiede, C.; Steudel, C.; Mohr, B.; Schaich, M.; Schäkel, U.; Platzbecker, U.; Wermke, M.; Bornhäuser, M.; Ritter, M.; Neubauer, A.; et al. Analysis of FLT3-activating mutations in 979 patients with acute myelogenous leukemia: association with FAB subtypes and identification of subgroups with poor prognosis. Blood 2002, 99, 4326–4335. [Google Scholar] [CrossRef]
- Bergeron, J.; Capo-Chichi, J.-M.; Tsui, H.; Mahe, E.; Berardi, P.; Minden, M.D.; Brandwein, J.M.; Schuh, A.C. The Clinical Utility of FLT3 Mutation Testing in Acute Leukemia: A Canadian Consensus. Current Oncology 2023, 30, 10410–10436. [Google Scholar] [CrossRef]
- Stone, R.M.; Mandrekar, S.J.; Sanford, B.L.; Laumann, K.; Geyer, S.; Bloomfield, C.D.; Thiede, C.; Prior, T.W.; Döhner, K.; Marcucci, G.; et al. Midostaurin plus Chemotherapy for Acute Myeloid Leukemia with a FLT3 Mutation. N Engl J Med 2017, 377, 454–464. [Google Scholar] [CrossRef] [PubMed]
- Daver, N.; Schlenk, R.F.; Russell, N.H.; Levis, M.J. Targeting FLT3 mutations in AML: review of current knowledge and evidence. Leukemia 2019, 33, 299–312. [Google Scholar] [CrossRef] [PubMed]
- O’Donnell, M.R.; Tallman, M.S.; Abboud, C.N.; Altman, J.K.; Appelbaum, F.R.; Arber, D.A.; Bhatt, V.; Bixby, D.; Blum, W.; Coutre, S.E.; et al. Acute Myeloid Leukemia, Version 3.2017, NCCN Clinical Practice Guidelines in Oncology. J Natl Compr Canc Netw 2017, 15, 926–957. [Google Scholar] [CrossRef]
- Döhner, H.; Wei, A.H.; Appelbaum, F.R.; Craddock, C.; DiNardo, C.D.; Dombret, H.; Ebert, B.L.; Fenaux, P.; Godley, L.A.; Hasserjian, R.P.; et al. Diagnosis and management of AML in adults: 2022 recommendations from an international expert panel on behalf of the ELN. Blood 2022, 140, 1345–1377. [Google Scholar] [CrossRef]
- Murphy, K.M.; Levis, M.; Hafez, M.J.; Geiger, T.; Cooper, L.C.; Smith, B.D.; Small, D.; Berg, K.D. Detection of FLT3 internal tandem duplication and D835 mutations by a multiplex polymerase chain reaction and capillary electrophoresis assay. J Mol Diagn 2003, 5, 96–102. [Google Scholar] [CrossRef]
- Kim, Y.; Lee, G.D.; Park, J.; Yoon, J.H.; Kim, H.J.; Min, W.S.; Kim, M. Quantitative fragment analysis of FLT3-ITD efficiently identifying poor prognostic group with high mutant allele burden or long ITD length. Blood Cancer Journal 2015, 5, e336–e336. [Google Scholar] [CrossRef]
- Sakaguchi, M.; Nakajima, N.; Yamaguchi, H.; Najima, Y.; Shono, K.; Marumo, A.; Omori, I.; Fujiwara, Y.; Terada, K.; Yui, S.; et al. The sensitivity of the FLT3-ITD detection method is an important consideration when diagnosing acute myeloid leukemia. Leuk Res Rep 2020, 13, 100198. [Google Scholar] [CrossRef]
- Meshinchi, S.; Woods, W.G.; Stirewalt, D.L.; Sweetser, D.A.; Buckley, J.D.; Tjoa, T.K.; Bernstein, I.D.; Radich, J.P. Prevalence and prognostic significance of Flt3 internal tandem duplication in pediatric acute myeloid leukemia. Blood 2001, 97, 89–94. [Google Scholar] [CrossRef] [PubMed]
- Nakao, M.; Yokota, S.; Iwai, T.; Kaneko, H.; Horiike, S.; Kashima, K.; Sonoda, Y.; Fujimoto, T.; Misawa, S. Internal tandem duplication of the flt3 gene found in acute myeloid leukemia. Leukemia 1996, 10, 1911–1918. [Google Scholar] [PubMed]
- Abu-Duhier, F.M.; Goodeve, A.C.; Wilson, G.A.; Care, R.S.; Peake, I.R.; Reilly, J.T. Genomic structure of human FLT3: implications for mutational analysis. Br J Haematol 2001, 113, 1076–1077. [Google Scholar] [CrossRef]
- Abu-Duhier, F.M.; Goodeve, A.C.; Wilson, G.A.; Care, R.S.; Peake, I.R.; Reilly, J.T. Identification of novel FLT-3 Asp835 mutations in adult acute myeloid leukaemia. Br J Haematol 2001, 113, 983–988. [Google Scholar] [CrossRef]
- Ven, S.; Rani, A. Discriminatory Power of Agarose Gel Electrophoresis in DNA Fragments Analysis. InTech: 2012.
- Spencer, D.H.; Abel, H.J.; Lockwood, C.M.; Payton, J.E.; Szankasi, P.; Kelley, T.W.; Kulkarni, S.; Pfeifer, J.D.; Duncavage, E.J. Detection of FLT3 internal tandem duplication in targeted, short-read-length, next-generation sequencing data. J Mol Diagn 2013, 15, 81–93. [Google Scholar] [CrossRef]
- Levis, M.; Small, D. FLT3: ITDoes matter in leukemia. Leukemia 2003, 17, 1738–1752. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.J.; Lee, K.S.; Lee, T.G.; Lee, S.; Shin, S.; Lee, S.-T. A comparative study of next-generation sequencing and fragment analysis for the detection and allelic ratio determination of FLT3 internal tandem duplication. Diagnostic Pathology 2022, 17. [Google Scholar] [CrossRef]
- Bacher, U.; Haferlach, C.; Kern, W.; Haferlach, T.; Schnittger, S. Prognostic relevance of FLT3-TKD mutations in AML: the combination matters—an analysis of 3082 patients. Blood 2008, 111, 2527–2537. [Google Scholar] [CrossRef]
- Yamamoto, Y.; Kiyoi, H.; Nakano, Y.; Suzuki, R.; Kodera, Y.; Miyawaki, S.; Asou, N.; Kuriyama, K.; Yagasaki, F.; Shimazaki, C.; et al. Activating mutation of D835 within the activation loop of FLT3 in human hematologic malignancies. Blood 2001, 97, 2434–2439. [Google Scholar] [CrossRef]
- Mehta, A.; Nathany, S.; Chopra, A.; Mattoo, S.; Kumar, D.; Panigrahi, M.K. Robust home brew fragment sizing assay for detection of MET exon 14 skipping mutation in non-small cell lung cancer patients in resource constrained community hospitals. J Pathol Transl Med 2021, 55, 324–329. [Google Scholar] [CrossRef] [PubMed]
- Rücker, F.G.; Du, L.; Luck, T.J.; Benner, A.; Krzykalla, J.; Gathmann, I.; Voso, M.T.; Amadori, S.; Prior, T.W.; Brandwein, J.M.; et al. Molecular landscape and prognostic impact of FLT3-ITD insertion site in acute myeloid leukemia: RATIFY study results. Leukemia 2022, 36, 90–99. [Google Scholar] [CrossRef] [PubMed]
- Bagrintseva, K.; Geisenhof, S.; Kern, R.; Eichenlaub, S.; Reindl, C.; Ellwart, J.W.; Hiddemann, W.; Spiekermann, K. FLT3-ITD-TKD dual mutants associated with AML confer resistance to FLT3 PTK inhibitors and cytotoxic agents by overexpression of Bcl-x(L). Blood 2005, 105, 3679–3685. [Google Scholar] [CrossRef] [PubMed]
- Tamburini, J.; Mouche, S.; Larrue, C.; Duployez, N.; Bidet, A.; Salotti, A.; Hirsch, P.; Rigolot, L.; Carras, S.; Templé, M.; et al. Very short insertions in the FLT3 gene are of therapeutic significance in acute myeloid leukemia. Blood Adv 2023, 7, 7576–7580. [Google Scholar] [CrossRef]






| Primer name | Primer sequence | Position on sequence in Accession AL445262.7 |
|---|---|---|
| FLT3-11F | GCAATTTAGGTATGAAAGCCAGC | 17469 - 17447 |
| FLT3-11R | CCAAACTCTAAATTTTCTCTTGGAAAC | 17335 - 17361 |
| FLT3-AF | GCTTGTCACCCACGGGAAAG | 1811 - 1792 |
| FLT3-AD | AGTGAGTGCAGTTGTTTACCATGATATC | 1642 - 1669 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).