Submitted:
11 April 2025
Posted:
11 April 2025
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Materials and Methods
Obtaining Patient Gastric Tissue Samples
Isolation of DNA, RNA, and protein from patient tissue samples
Investigation of the Presence of Bacterial Virulence Genes by Conventional PCR
Investigation of the Expression of NLRP3 and ASC Levels by Real-Time PCR
Evaluation of Expressions of GSDMD Caspase-1 IL-18 and IL-1β by Western Blot
Statistical Analysis
3. Results
4. Discussion
Supplementary Materials
Funding
Ethics statement
Data Availability Statement
Conflict of Interest
References
- Stadtländer CTK-H. Helicobacter pylori: Physiology and genetics. Microbe Wash DC.2006;1(3):152–3.
- Miehlke S, et al. The Helicobacter pylori vacA s1, m1 genotype and cagA is associated with gastric carcinoma in Germany. Int J Cancer [Internet]. 2000 [cited 2023 Apr 10];87(3):322–7. Available online: https://pubmed.ncbi.nlm.nih.gov/10897035/.
- Song Y, et al. Long noncoding RNA MALAT1 promotes high glucose-induced human endothelial cells pyroptosis by affecting NLRP3 expression through competitively binding miR-22. Biochem Biophys Res Commun.2019;509(2):359–66. Available from. [CrossRef]
- .Kalali B, et al. H. pylori virulence factors: influence on immune system and pathology. Mediators Inflamm. 2014;2014:426309. [CrossRef]
- Prinz C, et al. Key importance of the Helicobacter pylori adherence factor blood group antigen binding adhesin during chronic gastric inflammation. Cancer Res. 2001;61(5):1903–9.
- Lu H, et al. Functional and intracellular signaling differences associated with the Helicobacter pylori AlpAB adhesin from Western and East Asian strains. J Biol Chem.2007;282(9):6242–54. Available from. [CrossRef]
- Sheh A, et al. Phylogeographic origin of Helicobacter pylori determines host-adaptive responses upon coculture with gastric epithelial cells. Infect Immun [Internet]. 2013 [cited 2023 Apr 10];81(7):2468–77. Available from. [CrossRef]
- Leylabadlo HE, et al. Helicobacter pylori hopQ alleles (type I and II) in gastric cancer. Biomed Rep.2016;4(5):601–4. Available from. [CrossRef]
- Su Y-L, et al. Combination of OipA, BabA, and SabA as candidate biomarkers for predicting Helicobacter pylori-related gastric cancer. Sci Rep.2016;6:36442. Available from. [CrossRef]
- Shao et al. The Pyroptosis-Related Signature Predicts Prognosis and Indicates Immune Microenvironment Infiltration in Gastric Cancer. Front. Cell Dev. Biol. 2021.
- Zhang X, et al. H. pylori CagA activates the NLRP3 inflammasome to promote gastric cancer cell migration and invasion. Inflamm Res .2022;71(1):141–55. [CrossRef]
- Öktem Okullu S, et al. Detection of H. pylori in pediatric patients’ stool sample by multiplex urease PCR. Acibadem Univ Saglik Bilim Derg.2022;13(1). Available from. [CrossRef]
- van Doorn LJ, et al. Clinical relevance of the cagA, vacA, and iceA status of Helicobacter pylori. Gastroenterology.1998;115(1):58–66. Available from. [CrossRef]
- Atherton JC, et al. Simple and accurate PCR-based system for typing vacuolating cytotoxin alleles of Helicobacter pylori. J Clin Microbiol [Internet]. 1999 [cited 2023 Apr 11];37(9):2979–82. Available from: https://pubmed.ncbi.nlm.nih.gov/10449485/.
- Yamaoka Y, et al. Relationship between Helicobacter pylori iceA, cagA, and vacA status and clinical outcome: studies in four different countries. J Clin Microbiol. 1999 [cited 2023 Apr 11];37(7):2274–. Available online: https://pubmed.ncbi.nlm.nih.gov/10364597/.
- Podzorski RP, et al. Analysis of the vacA, cagA, cagE, iceA, and babA2 genes in Helicobacter pylori from sixty-one pediatric patients from the Midwestern United States. Diagn Microbiol Infect Dis.2003;46(2):83–8. Available from. [CrossRef]
- Versalovic J, et al. Distribution of repetitive DNA sequences in eubacteria and application to fingerprinting of bacterial genomes. Nucleic Acids Res.1991;19(24):6823–31. Available from. [CrossRef]
- Zhang W-X, et al. Selection of suitable reference genes for Quantitative Real-time PCR normalization in three types of rat adipose tissue. Int J Mol Sci.2016;17(6):968. Available from. [CrossRef]
- Song Y, et al. Long noncoding RNA MALAT1 promotes high glucose-induced human endothelial cells pyroptosis by affecting NLRP3 expression through competitively binding miR-22. Biochem Biophys Res Commun.2019;509(2):359–66. Available from. [CrossRef]
- Ozaydin N, et al. Prevalence and risk factors of Helicobacter pylori in Turkey: a nationally-representative, cross-sectional, screening with the 13C-Urea breath test. BMC Public Health .2013 [cited 2023 Mar 28];13(1):1215. Available online: https://pubmed.ncbi.nlm.nih.gov/24359515/.
- Karbalaei M, and Keikha M. Potential association between the hopQ alleles of Helicobacter pylori and gastrointestinal diseases: A systematic review and meta-analysis. Meta Gene.2020;26(100816):100816. Available from. [CrossRef]
- Kishk RM, et al. Genotyping of Helicobacter pylori Virulence Genes cagA and vacA: Regional and National Study. Int J Microbiol. 2021;2021:5540560. Available from. [CrossRef]
- Esteghamati A, et al. Prevalence and clinical relevance of cagA and oipA genotypes of Helicobacter pylori in children and adults with gastrointestinal diseases in Tehran, Iran. Med J Islam Repub Iran. 2023;37:22. Available from. [CrossRef]
- Davari F, et al. Elevated expression of the AIM2 gene in response to Helicobacter pylori along with the decrease of NLRC4 inflammasome is associated with peptic ulcer development. APMIS 2023. [CrossRef]
- Milic L, et al. Altered cytokine expression in Helicobacter pylori infected patients with bleeding duodenal ulcer. BMC Res Notes 2019;12(1):278. Available from. [CrossRef]
- Hitzler I, et al. Caspase-1 has both proinflammatory and regulatory properties in Helicobacter infections, which are differentially mediated by its substrates IL-1β and IL-18. J Immunol 2012;188(8):3594–602. Available from. [CrossRef]
- Sugimoto M, et al. Gastric mucosal interleukin-17 and -18 mRNA expression in Helicobacter pylori-induced Mongolian gerbils. Cancer Sci 2009;100(11):2152–9. Available from. [CrossRef]
- Franchi L, et al. The inflammasome: a caspase-1-activation platform that regulates immune responses and disease pathogenesis. Nat Immunol.2009;10(3):241–7. Available from. [CrossRef]
- Blaser MJ,, et al. Infection with Helicobacter pylori strains possessing cagA is associated with an increased risk of developing adenocarcinoma of the stomach. Cancer Res. 1995;55(10):2111–5.
- Yamaoka Y, et al. A M(r) 34,000 proinflammatory outer membrane protein (oipA) of Helicobacter pylori. Proc Natl Acad Sci U S A.2000;97(13):7533–8. [CrossRef]
- Goudarzi H, et al. Determination of the status of Helicobacter pylori sabA gene in relation to clinical findings. J Med Bacteriol [Internet]. 2012 [cited 2023 Apr 10];1(1–2):3–8. Available from: https://jmb.tums.ac.ir/index.php/jmb/article/view/4.
- Mahdavi J, et al. Helicobacter pylori SabA adhesin in persistent infection and chronic inflammation. Science.2002;297(5581):573–8. [CrossRef]
- Liu J, et al. Association of presence/absence and on/off patterns of Helicobacter pylori oipA gene with peptic ulcer disease and gastric cancer risks: a meta-analysis. BMC Infect Dis.2013;13(1):555. Available from. [CrossRef]
- Ansari S, and Yamaoka Y. Helicobacter pylori BabA in adaptation for gastric colonization. World J Gastroenterol.2017;23(23):4158–69. [CrossRef]
- Gerhard M, et al. Clinical relevance of the Helicobacter pylori gene for blood-group antigen-binding adhesin. Proc Natl Acad Sci U S A.1999;96(22):12778–83. Available from. [CrossRef]



| Primer | Sequence | Base pair | Annealing temperatures | References |
|---|---|---|---|---|
| ureA-F | TGATGGGACCAACTCGTAACCGT | 244 bp | 60⁰C | [12] |
| ureA-R | CGCAATGTCTAAGCGTTTGCCGAA | |||
| ureB-F | AGTAGCCCGGTGAACACAACATCCT | 645 bp | 60⁰C | [12] |
| ureB-R | ATGCCTTTGTCATAAGCCGCTTGG | |||
| cagA-F | TTGACCAACAACCACAAACCGAAG | 183 bp | 58⁰C | [13] |
| cagA-R | CTTCCCTTAATTGCGAGATTCC | |||
| vacAs1s2-F | ATGGAAATACAACAAACACAC | 259/286 bp | 58⁰C | [14] |
| vacAs1s2-R | CTGCTTGAATGCGCCAAAC | |||
| vacAm1m2-F | CAATCTGTCCAATCAAGCGAG | 570/645 bp | 58⁰C | [15] |
| vacAm1m2-R | GCGTCAAAATAATTCCAAGG | |||
| alpB-F | TGCGACTGGTTCAGATGGTC | 708 bp | 58⁰C | This study |
| alpB-R | CTGAGCGTGGATTGGAAGGT | |||
| alpA-F | GGCTTACGCTACTACGGCTT | 214 bp | 58⁰C | This study |
| alpA-R | GGCTGTTTCTTAGCGTGCTG | |||
| sabA-F | TCGTCATCAGTGGCGTTTCA | 621 bp | 58⁰C | This study |
| sabA-R | GGTAGTTGGATTGGCCTGCT | |||
| sabB-F | GCTATCAAATCGGCGAAGCG | 234 bp | 58⁰C | This study |
| sabB-R | CTTGCGCGGTGTTGTAGATG | |||
| babA2-F | AATCCAAAAAGGAGAAAAAGTATGAAA | 832 bp | 55.5⁰C | [16] |
| babA2-R | TGTTAGTGATTTCGGTGTAGGACA | |||
| babB-F | GGTGGGCCTATATCCACTGC | 803 bp | 58⁰C | This study |
| babB-R | TGAGTGCCAAAGTGAGCGAT | |||
| babC-F | AACGGCGGTGTGTATCAGTT | 755 bp | 58⁰C | This study |
| babC-R | TGAGTGCCAAAGTGAGCGAT | |||
| labA-F | GCAGCGTTCGTGAAAGACTC | 294 bp | 58⁰C | This study |
| labA-R | CGCATCAGGCAAGCTAGAGA | |||
| hopQ-F | ACTCGGCTTCTGATGTGTGG | 317 bp | 58⁰C | This study |
| hopQ-R | TTTCACGCCCAATTCCATGC | |||
| hopZ-F | AACGGTGCGATGAATGGGAT | 436 bp | 58⁰C | This study |
| hopZ-R | TCTTCACGCCTAGTTCCACG | |||
| oipA-F | GTTTTTGATGCATGGGATTT | 401 bp | 60⁰C | [17] |
| oipA-R | GTGCATCTCTTATGGCTTT | |||
| GAPDH-F | CTCATGACCACAGTCCATGC | 129 bp | 58⁰C | [18] |
| GAPDH-R | TTCAGCTCTGGGATGACCTT | |||
| RT-NLRP3-F | CAACCTCACGTCACACTGCT | 170 bp | 58⁰C | [19] |
| RT-NLRP3-R | TTTCAGACAACCCCAGGTTC | |||
| RT-ASC-F | CTGACGGATGAGCAGTACCA | 224 bp | 58⁰C | [19] |
| RT-ASC-R | CAGGATGATTTGGTGGGATT |
| H. pylori-infected Patients | Uninfected Patients | |||||
|---|---|---|---|---|---|---|
| Gastritis | Ulcer | Gastritis | Ulcer | Healthy volunteer | ||
| Patient Number | 22 | 22 | 5 | 5 | 5 | |
| Gender | Female | 10 | 9 | 3 | 4 | 2 |
| Male | 12 | 13 | 2 | 1 | 3 | |
| Age | 18-30 | 1 | 3 | - | - | 1 |
| 30-40 | 4 | 3 | 2 | 3 | 3 | |
| 40-50 | 8 | 5 | 2 | 1 | - | |
| 50-60 | 5 | 5 | 1 | 1 | 1 | |
| >60 | 4 | 6 | - | - | - | |
| Genes | Situation | Incıdance of Gastritis | Incıdance of Ulcer |
Relative Risk | p-value | ||
|---|---|---|---|---|---|---|---|
| n | (%) | n | (%) | ||||
| ureA | Present | 22 | 100 | 22 | 100 | - | >>0.99 |
| Absent | 0 | 0.0 | 0 | 0.0 | |||
| ureB | Present | 20 | 90.9 | 22 | 100 | 2.1 | 0.49 |
| Absent | 2 | 9.1 | 0 | 0.0 | |||
| cagA | Present | 10 | 45.5 | 13 | 59.1 | 1.3 | 0.55 |
| Absent | 12 | 54.5 | 9 | 40.9 | |||
| vacA | s1 | 17 | 77.3 | 19 | 86.4 | - | - |
| s2 | 3 | 13.6 | 3 | 13.6 | |||
| Absent | 2 | 9.1 | 0 | 0,0 | |||
| vacA | m1 | 10 | 45.5 | 10 | 45.5 | - | - |
| m2 | 11 | 50.0 | 12 | 54.5 | |||
| Absent | 1 | 4.5 | 0 | 0.0 | |||
| oipA | Present | 15 | 68.2 | 18 | 81.8 | 1.4 | 0.3 |
| Absent | 7 | 31.8 | 4 | 18.2 | |||
| babA2 | Present | 4 | 18.2 | 2 | 9.1 | 0.7 | 0.66 |
| Absent | 18 | 81.8 | 20 | 90.9 | |||
| babB | Present | 8 | 36.4 | 8 | 36.4 | 1 | >>0.99 |
| Absent | 14 | 63.6 | 14 | 63.6 | |||
| babC | Present | 15 | 68.2 | 14 | 63.6 | 0.9 | >>0.99 |
| Absent | 7 | 31.8 | 8 | 36.4 | |||
| sabA | Present | 20 | 90.9 | 21 | 95.5 | 1.4 | >>0.99 |
| Absent | 2 | 9.1 | 1 | 4.5 | |||
| sabB | Present | 20 | 90.9 | 20 | 90.9 | 1 | >>0.99 |
| Absent | 2 | 9.1 | 2 | 9.1 | |||
| alpA | Present | 21 | 95.5 | 22 | 100 | 2.1 | >>0.99 |
| Absent | 1 | 4.5 | 0 | 0,0 | |||
| alpB | Present | 19 | 86.4 | 21 | 95.5 | 1.6 | 0.61 |
| Absent | 3 | 13.6 | 1 | 4.5 | |||
| hopZ | Present | 20 | 90.9 | 22 | 100 | 2.1 | >>0,99 |
| Absent | 2 | 9,.1 | 0 | 0.0 | |||
| hopQ | Present | 21 | 95.5 | 22 | 100 | 2.1 | >>0,99 |
| Absent | 1 | 4.5 | 0 | 0.0 | |||
| labA | Present | 11 | 50.0 | 7 | 31.8 | 0.69 | 0.36 |
| Absent | 11 | 50.0 | 15 | 68.2 | |||
| In the patient population with increased target pyroptosis markers (%) | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ASC | NLRP3 | Active caspase-1 | Active GSDMD-N | Active IL-18 | Active IL-1β | |||||||
| PCC | RR | PCC | RR | PCC | RR | PCC | RR | PCC | RR | PCC | RR | |
| ureA | >0.99 | 0 | >0.99 | - | >0.99 | 0 | >0.99 | 0 | >0.99 | - | >0,99 | - |
| ureB | >0,99 | 2 | 0,49 | 1,82 | 0,43 | 2,46 | 0,51 | 1,71 | 0,42 | 2,57 | >0,99 | 2 |
| cagA | 0,62 | 1,47 | 0,67 | 1,24 | 0,22 | 0,42 | >0,99 | 1,25 | 0,16 | 2,8 | 0,64 | 0,63 |
| vacA m1 | >0.99 | 1.27 | >0.99 | 0.89 | 0.46 | 0.42 | >0.99 | 0.5 | >0.99 | 0.56 | >0.99 | - |
| vacA m2 | >0.99 | 0.4 | >0.99 | 1.33 | 0.44 | 0.4 | >0.99 | 0.71 | 0.3 | 0.22 | >0.99 | - |
| vacA s1 | >0.99 | 0 | 0.33 | - | >0.99 | 0.33 | >0.99 | 1 | >0.99 | 0.67 | >0.99 | - |
| vacA s2 | >0.99 | 0.53 | 0.51 | 0.58 | 0.44 | 0.42 | 0.47 | 0.5 | 0.38 | 0.3 | >0.99 | - |
| sabA | >0.99 | 2 | >0.99 | 1.15 | 0.22 | 0.42 | >0.99 | 1.63 | >0.99 | 0.76 | 0.64 | - |
| sabB | 0.1 | 0.33 | >0.99 | 1.15 | >0.99 | 1.18 | 0.51 | 1.71 | >0.99 | 0.76 | >0.99 | - |
| babA | 0.21 | 0.43 | 0.24 | 0.53 | 0.28 | 0.48 | >0.99 | - | 0.35 | 0.65 | 0.53 | 0.5 |
| babB | >0.99 | 0.9 | 0.67 | 1.84 | >0.99 | 0.91 | 0.58 | 1.44 | 0.37 | 0.54 | >0.99 | 1.25 |
| babC | >0.99 | 1.14 | 0.17 | 1.84 | >0.99 | 0.83 | >0.99 | 0.9 | >0.99 | 0.83 | 0.32 | 0.33 |
| hopQ | >0.99 | 2 | >0.99 | 1.75 | 0.43 | 2.55 | >0.99 | 1.63 | 0.42 | 2.57 | >0.99 | - |
| hopZ | >0.99 | 2 | >0.99 | 1.82 | 0.43 | 2.46 | >0.99 | 1.63 | 0.55 | 0.65 | >0.99 | - |
| alpA | >0.99 | 2 | >0.99 | 1.75 | 0.43 | 2.46 | 0.003* | 0.17 | 0.42 | 2.57 | >0.99 | - |
| alpB | 0.47 | 2.14 | 0.49 | 1.82 | 0.43 | 2.46 | 1.71 | 0.42 | 0.42 | 2.57 | >0.99 | - |
| labA | 0.06 | 0.32 | 0.67 | 1.24 | 0.24 | 0.56 | >0.99 | 0.8 | 0.38 | 0.58 | 0.14 | 0.38 |
| oipA | 0.34 | 1.79 | 0.67 | 1.24 | 0.23 | 1.79 | >0.99 | 1.25 | 0.26 | 2.25 | >0.99 | 0.83 |
| PCC: Pearson’s correlation coefficient, RR: relative risk | ||||||||||||
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).