Preprint
Article

This version is not peer-reviewed.

Wolbachia Screening in Aedes aegypti and Culex pipiens Mosquitoes from Madeira Island, Portugal

A peer-reviewed version of this preprint was published in:
Insects 2025, 16(4), 418. https://doi.org/10.3390/insects16040418

Submitted:

31 March 2025

Posted:

01 April 2025

You are already at the latest version

Abstract
Mosquito-borne diseases such as dengue and West Nile virus pose serious public health risks. On Madeira Island, the presence of the mosquito species Aedes aegypti and Culex pipiens raises concerns about local transmission. In this study, we tested 100 Ae. aegypti and 40 Cx. pipiens mosquitoes to assess the presence and diversity of Wolbachia, a naturally occurring bacterium known to reduce mosquito ability to transmit viruses. Molecular identification confirmed that all Cx. pipiens specimens belonged to the molestus biotype, with 3 individuals identified as hybrids between molestus and pipiens forms, this is the first evidence of such hybrids in Madeira. Wolbachia was not detected in any of the Ae. aegypti samples. In contrast, all Cx. pipiens mosquitoes were positive, showing a 100% prevalence. Genetic characterization placed these infections within the wPip clade, supergroup B, sequence type 9. These findings provide key baseline data to inform future mosquito control strategies on the island. As Ae. aegypti showed no natural Wolbachia infection, introducing Wolbachia-infected mosquitoes may be necessary to implement such biocontrol approaches in Madeira.
Keywords: 
;  ;  ;  ;  

1. Introduction

Aedes aegypti (Linnaeus, 1762) and Culex pipiens (Linnaeus, 1758) are mosquito species of medical and veterinary importance [1,2]. Ae. aegypti is recognized as the main vector of several arboviruses – including dengue, Zika and chikungunya [1] – while Cx. pipiens is a well-established transmitter of West Nile virus (WNV) [2]. These diseases pose significant public health challenges, with an estimated four billion people at risk of arbovirus infections worldwide [3]. Over the past five decades, the rapid growth of populations, expanding urban areas, increased travel, and the rising resistance to both larvicidal and adulticidal insecticides have collectively driven the spread of mosquito-borne diseases (MBD) worldwide [4]. Recent environmental shifts—such as rising temperatures, urban expansion, and enhanced global mobility—have contributed to the broader distribution and activity of mosquito populations. The number of human cases derived from MBD has risen significantly in Europe, particularly in Central and Mediterranean regions [5]. The spread of Ae. aegypti on Madeira Island, Portugal, in 2005 triggered the first dengue outbreak in 2012, underscoring the island’s vulnerability to future dengue epidemics [6]. Similarly, the presence of Cx. pipiens on the island raises concerns about the potential for local WNV transmission, similar patterns observed elsewhere in Europe [7].
Over the past ten years, Wolbachia has emerged as a promising strategy for controlling mosquito-borne diseases [8]. Wolbachia is an intracellular endosymbiotic bacterium that lives within arthropods and nematodes and often interferes with host reproduction and/or blocks the transmission of arboviruses such as dengue, Zika, and chikungunya [9]. The most common form of this interference is cytoplasmic incompatibility (CI), in which mating between Wolbachia-infected males and uninfected females results in reduced embryo viability. Additionally, in some hosts, Wolbachia can induce processes like parthenogenesis (the development of offspring from unfertilized eggs), feminization (transforming genetically male individuals into females), or even the elimination of male embryos [10]. Since Wolbachia is maternally transmitted, these reproductive modifications ensure that a greater proportion of females in the population become carriers of the infection. Field trials have explored two main approaches: one aimed at suppressing mosquito populations by releasing infected males, and another aimed at replacing the target population with infected individuals of both sexes [5]. To curb dengue transmission in communities, programs releasing Wolbachia-infected mosquitoes are currently underway across multiple countries: United States [11], Brazil [12], Italy [13], Australia [14], Vietnam [15], Indonesia [16], Singapore [17], China [18], and Malaysia [19]. Studies employing this approach have demonstrated significant reductions in dengue incidence, with suppression rates of 40% in Kuala Lumpur [19], over 70% in Yogyakarta [16], and up to 96% in northern Queensland [15]. These findings highlight the potential of Wolbachia-based strategies as a sustainable and environmentally friendly alternative for global mosquito-borne disease control.
Despite Wolbachia’s proven efficacy in reducing pathogen transmission, there are critical gaps in our understanding of its prevalence and genetic diversity in mosquito populations on Madeira Island. Previous studies have focused on the genetic structure, insecticide resistance, and vector competence of Ae. aegypti in Madeira [6,20,21], but no research to date has examined Wolbachia prevalence in this population. Given that Ae. aegypti populations in Madeira have demonstrated resistance to pyrethroids and organophosphates [21], alternative vector control strategies—such as Wolbachia-based approaches—may be necessary to mitigate future arbovirus outbreaks.
This study aims to fill this knowledge gap by screening local populations of Ae. aegypti and Cx. pipiens for Wolbachia infection using molecular techniques, including amplification of the wsp gene and MLST to genotype and differentiate Wolbachia strains. By determining infection rates and strain diversity, this research will provide essential insights into Wolbachia dynamics in Madeira’s mosquito populations and inform future vector control programs on the island.

2. Materials and Methods

2.1. Mosquito Collection

Adult Cx. pipiens mosquitoes, were collected in August 2023 and August 2024 using BG-Sentinel traps (Biogents, Regensburg, Germany). These traps were strategically placed in urban and suburban areas of Madeira, within the municipal limits of Funchal, where mosquito activity was known to be high. Figure 1 illustrates the geographic location of Madeira Island, with Funchal highlighted as the collection site. Of the collected mosquitoes from each year, 10 males and 10 females from each year were selected, creating a total of 40 specimens. Captured mosquitoes were placed in 0.5 mL Eppendorf tubes that contained RNAlater (Thermo Fisher Scientific, Waltham, MA, USA) and were stored at room temperature for transport. Regarding Ae. aegypti mosquitoes, eggs were collected in 2023 using oviposition traps placed beside the BG-Sentinel traps in which the adult mosquitoes were collected. The eggs were transported to the laboratory, where they were hatched under controlled conditions in an insectary, with 28°C temperature and 80% humidity conditions. The emerging adults were kept under the same standard insectary settings. To ensure consistency, we analyzed 50 males and 50 females, all tested within 2-4 days post emergence to minimize any age-related physiological differences.
Species identification was conducted under a stereo microscope (SZX7, Stereo Microscope, Olympus LS) using the Ribeiro and Ramos (1999) identification key, allowing precise differentiation of Cx. pipiens from other mosquitoes [22].
Whole mosquitoes were used for individual genomic DNA extractions with the NzyTech Tissue gDNA Isolation Kit (NzyTech, Lisbon, Portugal). The extraction process followed the manufacturer’s protocol. DNA samples were stored at -20°C until further analysis.
For species identification within the Cx. pipiens complex, PCR amplification of the acetylcholinesterase-2 (ace-2) gene was performed using the primers ACEpip-F (5’-GGAAACAACGACGTATGTACT-3’), ACEquin-F (5’-CCTTCTTGAATGGCTGTGGCA-3’), and B1246s-R (5’-TGGAGCCTCCTCTTCACGG-3’), following the protocol described by Smith & Fonseca [23]. The PCR reaction mix consisted of 10 µL of NZY Master Mix (NZYTech), 0.8 µM of ACEquin-F and B1246s-R primers, 0.4 µM of ACEpip-F primer, 1 µL of DNA template, and water to a final volume of 20 µL. The amplification protocol included one cycle at 94°C for 5 min, 35 cycles at 94°C for 30 seconds, 55°C for 30 seconds, 72°C for 1 min, and a cycle at 72 °C for 5 min. In this approach, Cx. pipiens produces a 610 bp fragment, while Culex quinquefasciatus generates a 274 bp fragment, allowing for clear species differentiation [23].
To further distinguish between Cx. pipiens biotypes and their hybrids, the CQ11 microsatellite locus was amplified using the forward primer CQ11F2 (5’-GATCCTAGCAAGCGAGAAC-3’) and the reverse primers pipCQ11R (5’-CATGTTGAGCTTCGGTGAA-3’) and molCQ11R (5’-CCCTCCAGTAAGGTATCAAC-3’), following the protocol outlined by Bahnck & Fonseca [24]. The polymerase chain reaction (PCR) mix contained 10 µL of NZY Master Mix (NZYTech, Lisbon, Portugal), 0.5 µM of each primer, 1 µL of DNA template, and water to a final volume of 20 µL. PCR conditions were: one cycle at 94 °C for 3 min, 40 cycles at 94 °C for 30 seconds, 54 °C for 30 seconds, 72 °C for 40 seconds, and one cycle at 72 °C for 5 min.The Cx. pipiens has two distinct forms: form pipiens and form molestus. The different biotypes are represented by the amplification of a 200 bp band for Cx. pipiens f. pipiens, a 250 bp band for Cx. pipiens f. molestus. For hybrids of Cx. pipiens f. pipiens and Cx. pipiens f. molestus the two bands specific for each biotype are simultaneously amplified (200 bp and 250 bp).

2.2. Wolbachia Detection

Wolbachia detection in mosquito samples was performed using PCR targeting a 610 bp region of the wsp gene using primers 81F and 691R, as described by Zhou et al. [25]. The amplification reaction was carried out in a 10 µL total volume, consisting of 5 µL of NZY Master Mix (NZYTech), 0.25 µL of forward primer (10 µM), 0.25 µL of reverse primer (10 µM), 1 µL of DNA template, and 3.5 µL of PCR-grade water. Cycling conditions were optimized as follows: a cycle at 94°C for 2 min, followed by 37 cycles of 94°C for 30 seconds, 54°C for 45 seconds, and 72°C for 90 seconds, and a cycle at 72°C for 10 min.
Amplified PCR products were analyzed via 2% agarose gel electrophoresis, stained with GreenSafe (NZYTech, Lisbon, Portugal), and visualized under UV light to confirm successful amplification.

2.3. Multilocus Sequence Typing

The MLST was performed on wsp-positive mosquitoes, targeting five conserved housekeeping genes (gatB, coxA, hcpA, ftsZ, and fbpA) to characterize Wolbachia strains present in the samples [26]. Additionally, the wsp hypervariable region (wspHVR) was amplified to provide further strain differentiation. The primer pairs used for each locus, along with the corresponding amplicon sizes, are provided in Appendix A.
PCR reactions were conducted using a Veriti™ Thermal Cycler, (Applied Biosystems, Foster City, CA, USA) following the same reaction mix conditions as for the wsp amplification. The thermal cycling conditions were optimized for each gene. For gatB, hcpA, ftsZ, and coxA, the cycle consisted of an initial denaturation at 94°C for 30 seconds, followed by 37 cycles of 54°C for 45 seconds and 72°C for 90 seconds. For fbpA, the annealing temperature was set at 55°C for 45 seconds, with all reactions including a final extension step at 72°C for 10 min.
All PCR products were analyzed via 2% agarose gel electrophoresis, stained with GreenSafe (NZYTech, Lisbon, Portugal), and visualized under UV light. Successfully amplified DNA fragments were purified using the ExoProStar™ 1-Step PCR Purification Kit (Cytiva, Marlborough, MA, USA) before sequencing.
A total of 20 Cx. pipiens specimens (5 males and 5 females from 2023, and 5 males and 5 females from 2024) were selected for sequencing. Bidirectional sequencing was performed for two representative samples from each year to improve sequence accuracy and obtain consensus sequences. Sequencing was carried out using an ABI 3130xl Genetic Analyzer (Applied Biosystems, Foster City, CA, USA). Raw sequencing reads were quality-checked, and base-calling errors were corrected using BioEdit (version 7.2.5) [27]. Individual loci (gatB, coxA, fbpA, ftsZ, hcpA, and wspHVR) were aligned and concatenated to generate a complete MLST profile. Consensus sequences were submitted to GenBank, and both individual loci and concatenated sequences were queried in the Wolbachia MLST database (https://pubmlst.org/wolbachia/) to determine sequence type (ST) assignments.

2.4. Phylogenetic Analysis

Homology searches were performed using the BLASTN algorithm [28] and all partial sequences were aligned with via ClustalW in BioEdit version 7.2.5 [27]. For integration of Wolbachia circulating in Madeira Island into the global genetic diversity, the obtained nucleotide concatenated consensus sequences of MLST loci (coxA, gatB, ftsZ, fbpA, hcpA) and the wsp hypervariable region were aligned against multiple sequences available at PubMLST and manually inspected using BioEdit. The obtained nucleotide alignments were further used to build maximum-likelihood phylogenetic trees applying the obtained bestfit model for each alignment using MEGA 11 [29].

3. Results

3.1. Mosquito Morphological Identification

In total, 140 mosquitoes from two genera, Aedes and Culex, were sampled for testing. Among them, 100 samples were identified as Ae. aegypti and were evenly distributed between 50 females and 50 males.
For Cx. pipiens, 40 field-collected mosquitoes were morphologically identified and selected for DNA testing. The ace-2 fragment-size analysis provided no evidence of Cx. quinquefasciatus in all of the 40 samples, rather all of them had fragments of 610 bp, corresponding to the size of Cx. pipiens molecular amplification ID [23,30]. Based on the CQ11 fragment-size analysis, 37 specimens were assigned to Cx. pipiens f. molestus¸ as they all exhibited the 250 bp specific fragment. Additionally, three samples were identified as hybrids[24].

3.2. Wolbachia Screening Through Amplification of wsp Gene

A total of 140 mosquitoes were screened for Wolbachia presence by PCR amplification targeting the wsp gene. None of the 100 Ae. aegypti mosquitoes tested positive for Wolbachia presence. In contrast 100% of Cx. pipiens samples from both 2023 and 2024 collections tested positive for Wolbachia infection.

3.3. Multilocus Sequence Typing (MLST)

All five MLST loci (gatB, coxA, ftsZ, fbpA, hcpA) and the wspHVR were successfully sequenced for all samples.
Allelic profiles generated from these loci were compared against the Wolbachia MLST database (https://pubmlst.org/), confirming that all 20 sequenced Cx. pipiens specimens belonged to sequence type (ST) 9, placing them within the wPip clade, associated with Wolbachia supergroup B (Table 1). No novel alleles or mixed infections were detected in any of the samples. Phylogenetic analysis using concatenated MLST loci sequences (coxA, gatB, ftsZ, fbpA, hcpA) and wspHVR supported these findings, reinforcing their classification within the wPip lineage (Figure 2).

4. Discussion

4.1. Prevalence of Wolbachia in Ae. Aegypti

The absence of Wolbachia in all Ae. aegypti specimens analyzed confirms previous studies indicating that this species does not naturally harbor the bacterium [31,32]. While Wolbachia has been successfully introduced into Ae. aegypti populations for vector control, natural infections are rarely reported [33]. This study provides the first data on Wolbachia screening in Ae. aegypti populations in Madeira Island and shows relevance for potential Wolbachia-based interventions in Madeira, as the feasibility of such strategies depends on the need for artificial transinfection. If Wolbachia is to be introduced into Madeira’s Ae. aegypti, factors such as strain selection, host compatibility, and environmental stability must be considered [34,35].
Although PCR-based detection is highly sensitive, it is still possible that very low-density infections remain undetected [33]. Future studies could complement these findings using quantitative PCR (qPCR) or next-generation sequencing (NGS) to rule out low-level infections [36,37]. Given the confirmed presence of insecticide resistance in Madeira’s Ae. aegypti populations [20,21], alternative control strategies should continue to be explored.

4.2. High Wolbachia Prevalence in Cx. pipiens

Distinguishing between members of the Cx. pipiens complex can be challenging, as the two forms, pipiens and molestus, are morphologically identical, even in key structures such as the male genitalia. To overcome this limitation, we used molecular tools for accurate identification. The ace-2 fragment analysis confirmed that none of the tested specimens belonged to Cx. quinquefasciatus, as all exhibited the expected 610 bp fragment characteristic of Cx. pipiens [23]. Subsequent analysis using the CQ11 microsatellite locus revealed that 37 individuals belonged to Cx. pipiens f. molestus, while three mosquitoes showed both the 250 bp and 200 bp fragments, clear evidence of hybridization between the molestus and pipiens forms [24]. To our knowledge, this is the first report of Cx. pipiens hybrids in the Madeira Island. The predominance of the molestus form suggests that this biotype is well adapted to the island’s urban environment, likely aided by traits such as its ability to reproduce without a blood meal (autogeny), to mate in confined spaces (stenogamy), and to remain active year-round without undergoing diapause [24]. These characteristics give this mosquito a clear ecological advantage in human-altered habitats.
This study represents the first molecular screening of Wolbachia in Cx. pipiens from Madeira Island, revealing a 100% infection rate across both 2023 and 2024 samples. The Wolbachia strain detected in all samples belongs to the wPip clade, within Wolbachia supergroup B, as confirmed by MLST typing. Similar findings have been reported in other global Cx. pipiens populations, supporting the idea that wPip strains form a distinct evolutionary lineage within supergroup B [38,39,40].
Phylogenetic analysis indicated that Wolbachia sequences from Madeira Cx. pipiens exhibit high genetic similarity to those found in North America, particularly those associated with ST9. This finding suggests a possible link between Madeira’s Wolbachia strains and those from geographically distant Culex populations. The strong bootstrap support values (94–100%) confirm the robustness of these relationships (Figure 2). Given Madeira’s historical role as a maritime trade hub, multiple introduction events of Wolbachia in Cx. pipiens cannot be ruled out. Future research comparing Wolbachia sequences from Europe, North Africa, and the Americas could help clarify whether Madeira’s wPip strains originated from a single introduction or multiple independent colonization events.

4.3. Implications for Vector Competence and Control

The detection of Wolbachia in Madeira’s Cx. pipiens has important implications for vector competence and vector control. The presence of hybrids is particularly noteworthy, as interbreeding between forms with different host preferences, the pipiens form tending to feed on birds and the molestus form on mammals, including humans, may lead to mosquito populations with expanded host ranges and potentially greater capacity to transmit zoonotic pathogens like WNV [24].
Studies have shown that Wolbachia can influence pathogen transmission in Cx. pipiens, particularly for WNV and filarial nematodes [41,42]. However, the impact of Wolbachia on WNV transmission is complex, with some studies reporting reduced viral replication, while others suggest it may enhance pathogen transmission depending on the specific Wolbachia strain-host interaction [43]. Understanding how Wolbachia affects WNV dynamics in Madeira’s Cx. pipiens is critical for assessing its role in arbovirus epidemiology.
Given the high prevalence of Wolbachia in Madeira’s Cx. pipiens, the Incompatible Insect Technique (IIT) could be a viable tool for population suppression or modification. IIT relies on Wolbachia-induced cytoplasmic incompatibility to reduce mosquito fertility, effectively lowering population densities over time [44]. This technique has already shown promise in Cx. quinquefasciatus, where field and semi-field trials demonstrated the potential of Wolbachia-based IIT to significantly reduce mosquito populations and interrupt disease transmission cycles, including that of Wuchereria bancrofti [45]. Since all tested Cx. pipiens mosquitoes in this study were naturally infected with wPip, strategic releases of incompatible males could be considered as part of an integrated vector management approach.
Future research should focus on quantifying Wolbachia density using qPCR, evaluating whether infection levels vary under different environmental conditions. Additionally, vector competence studies should be conducted to determine whether Wolbachia ST9 influences WNV transmission in Madeira’s Cx. pipiens.

5. Conclusions

This study represents the first screening of Wolbachia in Ae. aegypti and Cx. pipiens from Madeira Island. The fact that no evidence of Wolbachia infection was found in Ae. aegypti aligns with previous studies that reported the absence of natural Wolbachia infections in Ae. aegypti populations. The detection of Wolbachia in all tested Cx. pipiens f. molestus and hybrid forms highlights its widespread prevalence in the local mosquito population, confirming the presence of the wPip clade, supergroup B, ST 9. Given Wolbachia’s potential to influence vector competence and population control, these findings contribute to the broader understanding of Wolbachia diversity in Cx. pipiens and its potential role in arbovirus transmission.

Author Contributions

Conceptualization, R.F., T.M., G.S. and H.O.; methodology, R.F., T.M., E.D.; software, R.F. and L.Z.Z.; validation, R.F., G.S. and H.C.O.; formal analysis, R.F.; investigation, R.F. and T.M.; resources, L.Z.Z., G.S., B.R.G. and H.C.O.; data curation, R.F. and L.Z.Z.; writing—original draft preparation, R.F. and T.M.; writing—review and editing, R.F., T.M., L.Z.Z., I.F., M.S., N.C.S., B.R.G., G.S. and H.C.O.; supervision, G.S. and H.C.O.; funding acquisition, L.Z.Z., N.C.S., G.S., B.R.G. and H.C.O. R.F. and T.M. contributed equally to this work and share first authorship. All authors have read and agreed to the published version of the manuscript.

Funding

This work was funded by the MOBVEC-Mobile Bio-Lab to support the first response in Arbovirus outbreaks (2023-2026) project, reference HORIZON-EIC-2022-PATHFINDEROPEN-01 under the Pathfinder open program of the European Innovation Council (CEI), ITI/ Larsys, Funded by FCT projects: 10.54499/LA/P/0083/2020; 10.54499/UIDP/50009/2020 & 10.54499/UIDB/50009/2020 and PhD fellowship reference 2022.13476. BDANA (FCT). The funders had no role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Data Availability Statement

The data supporting the results of this article are included. The nucleotide sequence data reported in this paper have been deposited in the NBCI GenBank database under the accession numbers PV224315 - PV224326.

Acknowledgments

We acknowledge the work of the Madeira REVIVE local team, namely, Adélia Egas, Conceição Reis, Duarte Araújo, Fátima Camacho, Guilherme Madruga, Irene Viveiros, Margarida Clairouin, Marco Magalhães, Maria Isabel Monte, Maurício Santos, Paula Abreu, Rita Bento, Rute Soares, Sónia Gonçalves e Verónica Teixeira.

Conflicts of Interest

The authors declare no conflicts of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or in the decision to publish the results.

Abbreviations

The following abbreviations are used in this manuscript:
ace-2 Acetylcholinesterase-2
IIT Incompatible Insect Technique
MBDs Mosquito-borne diseases
MLST Multilocus Sequence Typing
NGS Next-generation sequencing
PCR Polymerase chain reaction
qPCR Quantitative PCR
ST Sequence type
WNV West Nile virus
wsp Wolbachia surface protein gene

Appendix A

Appendix A.1

Table A1. Primers used in this work, for Wolbachia detection by PCR and for the amplification of the MLST complex and wspHVR.
Table A1. Primers used in this work, for Wolbachia detection by PCR and for the amplification of the MLST complex and wspHVR.
Target Primer Sequences (5‘-3’) Reference
wsp 81F – TGGTCCAATAAGTGATGAAGAAA691R - AAAAATTAAACGCTACTCCA [25]
coxA wsp_F1: GTCCAATARSTGATGARGAAACwsp_R1: CYGCACCAAYAGYRCTRTAAA [26]
gatB gatB_F1: GAKTTAAAYCGYGCAGGBGTTgatB_R1: TGGYAAYTCRGGYAAAGATGA [26]
ftsZ ftsZ_F1: ATYATGGARCATATAAARGATAGftsZ_R1: TCRAGYAATGGATTRGATAT [26]
hcpA hcpA_F1: GAAATARCAGTTGCTGCAAAhcpA_R1: GAAAGTYRAGCAAGYTCTG [26]
fbpA fbpA_F1: GCTGCTCCRCTTGGYWTGATfbpA_R1: CCRCCAGARAAAAYYACTATTC [26]
wspHVR wsp_F1: GTCCAATARSTGATGARGAAACwsp_R1: CYGCACCAAYAGYRCTRTAAA [26]

References

  1. Souza-Neto, J.A.; Powell, J.R.; Bonizzoni, M. Aedes aegypti vector competence studies: a review. Infect. Genet. Evol. 2019, 67, 191–209. [Google Scholar] [CrossRef] [PubMed]
  2. Farajollahi, A.; Fonseca, D.M.; Kramer, L.D.; Kilpatrick, A.M. Bird biting mosquitoes and human disease: a review of the role of Culex pipiens complex mosquitoes in epidemiology. Infect. Genet. Evol. 2011, 11, 1577–1585. [Google Scholar] [CrossRef] [PubMed]
  3. Challenges in combating arboviral infections. Nat. Commun. 2024, 15, 3350. [CrossRef] [PubMed]
  4. Gubler, D. Dengue, urbanization and globalization: the unholy trinity of the 21st century. Int. J. Infect. Dis. 2012, 16, e203. [Google Scholar] [CrossRef]
  5. Madhav, M.; Blasdell, K.R.; Trewin, B.; Paradkar, P.N.; López-Denman, A.J. Culex-transmitted diseases: mechanisms, impact, and future control strategies using Wolbachia. Viruses 2024, 16, 1134. [Google Scholar] [CrossRef]
  6. Seixas, G.; Salgueiro, P.; Bronzato-Badial, A.; Gonçalves, Y.; Reyes-Lugo, M.; Gordicho, V.; Ribolla, P.; Viveiros, B.; Silva, A.C.; Pinto, J.; Sousa, C.A. Origin and expansion of the mosquito Aedes aegypti in Madeira Island (Portugal). Sci. Rep. 2019, 9, 13323. [Google Scholar] [CrossRef]
  7. Bakonyi, T.; Haussig, J.M. West Nile virus keeps on moving up in Europe. Euro Surveill. 2020, 25, 2001938. [Google Scholar] [CrossRef]
  8. Flores, H.A.; O’Neill, S.L. Controlling vector-borne diseases by releasing modified mosquitoes. Nat. Rev. Microbiol. 2018, 16, 508–518. [Google Scholar] [CrossRef]
  9. Kaur, R.; Shropshire, J.D.; Cross, K.L.; Leigh, B.; Mansueto, A.J.; Stewart, V.; Bordenstein, S.R.; Bordenstein, S.R. Living in the endosymbiotic world of Wolbachia: a centennial review. Cell Host Microbe 2021, 29, 879–893. [Google Scholar] [CrossRef]
  10. Chen, H.; Zhang, M.; Hochstrasser, M. The biochemistry of cytoplasmic incompatibility caused by endosymbiotic bacteria. Genes 2020, 11, 852. [Google Scholar] [CrossRef]
  11. Mains, J.W.; Kelly, P.H.; Dobson, K.L.; Petrie, W.D.; Dobson, S.L. Localized control of Aedes aegypti (Diptera: Culicidae) in Miami, FL, via inundative releases of Wolbachia-infected male mosquitoes. J. Med. Entomol. 2019, 56, 1296–1303. [Google Scholar] [CrossRef] [PubMed]
  12. Pinto, S.B.; Riback, T.I.S.; Sylvestre, G.; Costa, G.; Peixoto, J.; Dias, F.B.S.; Tanamas, S.K.; Simmons, C.P.; Dufault, S.M.; Ryan, P.A.; O’Neill, S.L.; Muzzi, F.C.; Kutcher, S.; Montgomery, J.; Green, B.R.; Smithyman, R.; Eppinghaus, A.; Saraceni, V.; Durovni, B.; Moreira, L.A. Effectiveness of Wolbachia-infected mosquito deployments in reducing the incidence of dengue and other Aedes-borne diseases in Niterói, Brazil: a quasi-experimental study. PLoS Negl. Trop. Dis. 2021, 15, e0009556. [Google Scholar] [CrossRef] [PubMed]
  13. Caputo, B.; Moretti, R.; Virgillito, C.; Manica, M.; Lampazzi, E.; Lombardi, G.; Serini, P.; Pichler, V.; Beebe, N.W.; Della Torre, A.; Calvitti, M. A bacterium against the tiger: further evidence of the potential of non inundative releases of males with manipulated Wolbachia infection in reducing fertility of Aedes albopictus field populations in Italy. Pest Manag. Sci. 2023, 79, 4145–4153. [Google Scholar] [CrossRef] [PubMed]
  14. O’Neill, S.L.; Ryan, P.A.; Turley, A.P.; Wilson, G.; Hurst, T.P.; Retzki, K.; Brown-Kenyon, J.; Hodgson, L.; Kenny, N.; Cook, H.; Montgomery, B.L.; Paton, C.J.; Ritchie, S.A.; Hoffmann, A.A.; Jewell, N.P.; Tanamas, S.K.; Anders, K.L.; Simmons, C.P. Establishment of wMel Wolbachia in Aedes aegypti mosquitoes and reduction of local dengue transmission in Cairns and surrounding locations in northern Queensland, Australia. Gates Open Res. 2019, 3, 1547. [Google Scholar] [CrossRef]
  15. Nguyen, T.H.; Nguyen, H.L.; Nguyen, T.Y.; Vu, S.N.; Tran, N.D.; Le, T.N.; Vien, Q.M.; Bui, T.C.; Le, H.T.; Kutcher, S.; Hurst, T.P.; Duong, T.T.H.; Jeffery, J.A.L.; Darbro, J.M.; Kay, B.H.; Iturbe-Ormaetxe, I.; Popovici, J.; Montgomery, B.L.; Turley, A.P.; Hoffmann, A.A. Field evaluation of the establishment potential of wMelPop Wolbachia in Australia and Vietnam for dengue control. Parasit. Vectors 2015, 8, 563. [Google Scholar] [CrossRef]
  16. Indriani, C.; Tantowijoyo, W.; Rancès, E.; Andari, B.; Prabowo, E.; Yusdi, D.; Ansari, M.R.; Wardana, D.S.; Supriyati, E.; Nurhayati, I.; Ernesia, I.; Setyawan, S.; Fitriana, I.; Arguni, E.; Amelia, Y.; Ahmad, R.A.; Jewell, N.P.; Dufault, S.M.; Ryan, P.A.; Utarini, A. Reduced dengue incidence following deployments of Wolbachia-infected Aedes aegypti in Yogyakarta, Indonesia: a quasi-experimental trial using controlled interrupted time series analysis. Gates Open Res. 2020, 4, 50. [Google Scholar] [CrossRef]
  17. Lim, J.T.; Bansal, S.; Chong, C.S.; Dickens, B.; Ng, Y.; Deng, L.; Lee, C.; Tan, L.Y.; Chain, G.; Ma, P.; Sim, S.; Tan, C.H.; Cook, A.R.; Ng, L.C. Efficacy of Wolbachia-mediated sterility to reduce the incidence of dengue: a synthetic control study in Singapore. Lancet Microbe 2024, 5, e29–e40. [Google Scholar] [CrossRef]
  18. Zheng, X.; Zhang, D.; Li, Y.; Yang, C.; Wu, Y.; Liang, X.; Liang, Y.; Pan, X.; Hu, L.; Sun, Q.; Wang, X.; Wei, Y.; Zhu, J.; Qian, W.; Yan, Z.; Parker, A.G.; Gilles, J.R.L.; Bourtzis, K.; Bouyer, J.; Tang, M.; Zheng, B.; Yu, J.; Liu, J.; Zhuang, J.; Hu, Z.; Zhang, M.; Gong, J.-T.; Hong, X.-Y.; Zhang, Z.; Lin, L.; Liu, Q.; Hu, Z.; Wu, Z.; Baton, L.A.; Hoffmann, A.A.; Xi, Z. Incompatible and sterile insect techniques combined eliminate mosquitoes. Nature 2019, 572, 56–61. [Google Scholar] [CrossRef]
  19. Hoffmann, A.A.; Ahmad, N.W.; Keong, W.M.; Ling, C.Y.; Ahmad, N.A.; Golding, N.; Tierney, N.; Jelip, J.; Putit, P.W.; Mokhtar, N.; Sandhu, S.S.; Ming, L.S.; Khairuddin, K.; Denim, K.; Rosli, N.M.; Shahar, H.; Omar, T.; Ghazali, M.K.R.; Zabari, N.Z.A.M.; Sinkins, S.P. Introduction of Aedes aegypti mosquitoes carrying wAlbB Wolbachia sharply decreases dengue incidence in disease hotspots. iScience 2024, 27, 108942. [Google Scholar] [CrossRef]
  20. Seixas, G.; Jupille, H.; Yen, P.-S.; Viveiros, B.; Failloux, A.-B.; Sousa, C.A. Potential of Aedes aegypti Populations in Madeira Island to Transmit Dengue and Chikungunya Viruses. Parasites Vectors 2018, 11, 509. [Google Scholar] [CrossRef]
  21. Seixas, G.; Grigoraki, L.; Weetman, D.; Vicente, J.L.; Silva, A.C.; Pinto, J.; Vontas, J.; Sousa, C.A. Insecticide resistance is mediated by multiple mechanisms in recently introduced Aedes aegypti from Madeira Island (Portugal). PLoS Negl. Trop. Dis. 2017, 11, e0005799. [Google Scholar] [CrossRef] [PubMed]
  22. Ribeiro, H.; Ramos, H.C. Identification keys of the mosquitoes of Continental Portugal, Azores and Madeira. Eur. Mosq. Bull. 1999, 3, 1–11. [Google Scholar]
  23. Smith, J.L.; Fonseca, D.M. Rapid assays for identification of members of the Culex (Culex) pipiens complex, their hybrids, and other sibling species (Diptera: Culicidae). Am. J. Trop. Med. Hyg. 2004, 70, 339–345. [Google Scholar] [CrossRef] [PubMed]
  24. Bahnck, C.M.; Fonseca, D.M. Rapid assay to identify the two genetic forms of Culex (Culex) pipiens L. (Diptera: Culicidae) and hybrid populations. Am. J. Trop. Med. Hyg. 2006, 75, 251–255. [Google Scholar] [CrossRef]
  25. Zhou, W.; Rousset, F.; O’Neill, S. Phylogeny and PCR-based classification of Wolbachia strains using wsp gene sequences. Proc. Biol. Sci. 1998, 265, 509–515. [Google Scholar] [CrossRef]
  26. Baldo, L.; Hotopp, J.C.D.; Jolley, K.A.; Bordenstein, S.R.; Biber, S.A.; Choudhury, R.R.; Hayashi, C.; Maiden, M.C.J.; Tettelin, H.; Werren, J.H. Multilocus sequence typing system for the endosymbiont Wolbachia pipientis. Appl. Environ. Microbiol. 2006, 72, 7098–7110. [Google Scholar] [CrossRef]
  27. Hall, T.A. BioEdit: a user-friendly biological sequence alignment editor. Nucleic Acids Symp. Ser. 1999, 41, 95–98. [Google Scholar]
  28. Altschul, S.F.; et al. Basic local alignment search tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef]
  29. Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular Evolutionary Genetics Analysis version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef]
  30. Vanderheyden, A.; Smitz, N.; De Wolf, K.; Deblauwe, I.; Dekoninck, W.; Meganck, K.; Gombeer, S.; Vanslembrouck, A.; De Witte, J.; Schneider, A.; et al. DNA Identification and Diversity of the Vector Mosquitoes Culex pipiens s.s. and Culex torrentium in Belgium (Diptera: Culicidae). Diversity 2022, 14, 486. [Google Scholar] [CrossRef]
  31. Bourtzis, K. Wolbachia-based technologies for insect pest population control. In Transgenesis and the Management of Vector-Borne Disease; Aksoy, S., Ed.; Adv. Exp. Med. Biol. 2008, 627, 104–113. [Google Scholar] [CrossRef]
  32. Gloria-Soria, A.; Chiodo, T.G.; Powell, J.R. Lack of evidence for natural Wolbachia infections in Aedes aegypti. J. Med. Entomol. 2018, 55, 1307–1310. [Google Scholar] [CrossRef]
  33. Ross, P.A.; Callahan, A.G.; Yang, Q.; Jasper, M.; Arif, M.A.K.; Afizah, A.N.; Nazni, W.A.; Hoffmann, A.A. An elusive endosymbiont: does Wolbachia occur naturally in Aedes aegypti? Ecol. Evol. 2020, 10, 1581–1591. [Google Scholar] [CrossRef]
  34. Minwuyelet, A.; Petronio, G.P.; Yewhalaw, D.; Sciarretta, A.; Magnifico, I.; Nicolosi, D.; Di Marco, R.; Atenafu, G. Symbiotic Wolbachia in mosquitoes and its role in reducing the transmission of mosquito-borne diseases: updates and prospects. Front. Microbiol. 2023, 14, 1267832. [Google Scholar] [CrossRef]
  35. Ross, P.A.; Robinson, K.L.; Yang, Q.; Callahan, A.G.; Schmidt, T.L.; Axford, J.K.; Coquilleau, M.P.; Staunton, K.M.; Townsend, M.; Ritchie, S.A.; Lau, M.J.; Gu, X.; Hoffmann, A.A. A decade of stability for wMel Wolbachia in natural Aedes aegypti populations. PLoS Pathog. 2022, 18, e1010256. [Google Scholar] [CrossRef]
  36. Reyes, J.I.L.; Suzuki, T.; Suzuki, Y.; Watanabe, K. Detection and quantification of natural Wolbachia in Aedes aegypti in Metropolitan Manila, Philippines using locally designed primers. Front. Cell. Infect. Microbiol. 2024, 14, 1360438. [Google Scholar] [CrossRef]
  37. Inácio da Silva, L.M.; Dezordi, F.Z.; Paiva, M.H.S.; Wallau, G.L. Systematic review of Wolbachia symbiont detection in mosquitoes: an entangled topic about methodological power and true symbiosis. Pathogens 2021, 10, 39. [Google Scholar] [CrossRef]
  38. Dumas, E.; Atyame, C.M.; Milesi, P.; Fonseca, D.M.; Shaikevich, E.V.; Unal, S.; Makoundou, P.; Weill, M.; Duron, O. Population structure of Wolbachia and cytoplasmic introgression in a complex of mosquito species. BMC Evol. Biol. 2013, 13, 181. [Google Scholar] [CrossRef]
  39. Atyame, C.M.; Delsuc, F.; Pasteur, N.; Weill, M.; Duron, O. Diversification of Wolbachia endosymbiont in the Culex pipiens mosquito. Mol. Biol. Evol. 2011, 28, 2761–2772. [Google Scholar] [CrossRef]
  40. da Moura, A.J.F.; Valadas, V.; da Veiga Leal, S.; Montalvo Sabino, E.; Sousa, C.A.; Pinto, J. Screening of natural Wolbachia infection in mosquitoes (Diptera: Culicidae) from the Cape Verde islands. Parasit. Vectors 2023, 16, 486. [Google Scholar] [CrossRef]
  41. Glaser, R.L.; Meola, M.A. The native Wolbachia endosymbionts of Drosophila melanogaster and Culex quinquefasciatus increase host resistance to West Nile virus infection. PLoS ONE 2010, 5, e11977. [Google Scholar] [CrossRef] [PubMed]
  42. Teixeira, L.; Ferreira, Á.; Ashburner, M. The bacterial symbiont Wolbachia induces resistance to RNA viral infections in Drosophila melanogaster. PLoS Biol. 2008, 6, e1000002. [Google Scholar] [CrossRef] [PubMed]
  43. Dodson, B.L.; Hughes, G.L.; Paul, O.; Matacchiero, A.C.; Kramer, L.D.; Rasgon, J.L. Wolbachia enhances West Nile virus (WNV) infection in the mosquito Culex tarsalis. PLoS Negl. Trop. Dis. 2014, 8, e2965. [Google Scholar] [CrossRef]
  44. Lim, P.L.J.; Cook, A.R.; Bansal, S.; Chow, J.Y.; Lim, J.T. Wolbachia incompatible insect technique program optimization over large spatial scales using a process-based model of mosquito metapopulation dynamics. BMC Biol. 2024, 22, 16. [Google Scholar] [CrossRef] [PubMed]
  45. Atyame, C.M.; Pasteur, N.; Dumas, E.; Tortosa, P.; Tantely, M.L.; Pocquet, N.; Licciardi, S.; Bheecarry, A.; Zumbo, B.; Weill, M.; Duron, O. Cytoplasmic incompatibility as a means of controlling Culex pipiens quinquefasciatus in the southwestern Indian Ocean islands. PLoS Negl. Trop. Dis. 2011, 5, e1440. [Google Scholar] [CrossRef]
Figure 1. Map showing the geographic location of Madeira Island, Portugal. The highlighted area represents Funchal, where mosquito traps were placed within the municipal limits.
Figure 1. Map showing the geographic location of Madeira Island, Portugal. The highlighted area represents Funchal, where mosquito traps were placed within the municipal limits.
Preprints 154245 g001
Figure 2. Phylogenetic tree was inferred using Maximum likelihood method and Hasegawa-Kishino-Yano model (with discrete Gamma distribution and some evolutionary invariable sites; HKY+G+I) and 14 (2 novel) COX sequences obtained from mosquitoes circulating in Madeira Island (Table 1) and 12 sequences available in PubMLST. Bootstrap values (1000 replicates) are shown below the branches. Wolbachia sequences are identified by PubMLST ID numbers, insect species, country region, country, and year of collection (if available). Colored circles and sequences highlighted in red indicate sequences from Madeira Island. Wolbachia supergroups are presented with a different color: blue, supergroup A; red, supergroup B and green, supergroup D. Composite figure was created in https://BioRender.com.
Figure 2. Phylogenetic tree was inferred using Maximum likelihood method and Hasegawa-Kishino-Yano model (with discrete Gamma distribution and some evolutionary invariable sites; HKY+G+I) and 14 (2 novel) COX sequences obtained from mosquitoes circulating in Madeira Island (Table 1) and 12 sequences available in PubMLST. Bootstrap values (1000 replicates) are shown below the branches. Wolbachia sequences are identified by PubMLST ID numbers, insect species, country region, country, and year of collection (if available). Colored circles and sequences highlighted in red indicate sequences from Madeira Island. Wolbachia supergroups are presented with a different color: blue, supergroup A; red, supergroup B and green, supergroup D. Composite figure was created in https://BioRender.com.
Preprints 154245 g002
Table 1. MLST Allelic Profiles, wspHVR Variants, and corresponding Sequence Types (ST) of Wolbachia detected in Cx. pipiens.
Table 1. MLST Allelic Profiles, wspHVR Variants, and corresponding Sequence Types (ST) of Wolbachia detected in Cx. pipiens.
Sex Year gatB coxA hcpA ftsZ fbpA HVR1 HVR2 HVR3 HVR4 ST
Female 2023 4 3 3 22 4 10 8 10 8 9
2024 4 3 3 22 4 10 8 10 8 9
Male 2023 4 3 3 22 4 10 8 10 8 9
2024 4 3 3 22 4 10 8 10 8 9
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.
Copyright: This open access article is published under a Creative Commons CC BY 4.0 license, which permit the free download, distribution, and reuse, provided that the author and preprint are cited in any reuse.
Prerpints.org logo

Preprints.org is a free preprint server supported by MDPI in Basel, Switzerland.

Subscribe

© 2026 MDPI (Basel, Switzerland) unless otherwise stated

Accessibility

Disclaimer

Terms of Use

Privacy Policy

Privacy Settings