Submitted:
04 February 2025
Posted:
05 February 2025
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Materials and Methods
2.1. Grain Management and Quality Assessment
2.2. Experimental Design and Dietary Treatments
2.3. Animal Management
2.4. Faecal Scoring
2.5. Sample Collection
2.6. Feed and Faecal Analysis
2.7. Gut Morphological Analysis
2.8. Gene Expression in the Small Intestine
2.8.1. RNA Extraction and cDNA Synthesis
2.8.2. Quantitative Real-Time Polymerase Chain Reaction (QPCR)
2.9. Volatile Fatty Acid Analysis
2.10. Microbiological Analysis
2.10.1. Microbial DNA Extraction
2.10.2. Illumina Sequencing
2.10.3. Bioinformatics
2.11. Statistics
3. Results
3.1. Grain Quality
3.2. Growth Performance and Faecal Scores
3.3. Coefficient of Apparent Total Tract Digestibility
3.4. Small Intestinal Morphology
3.5. Gene expression Analysis
3.6. Differential Bacterial Abundance Analysis
3.6.1. Bacterial Richness And Diversity
3.6.2. Differently Abundant Phlya
3.6.3. Differently Abundant Families
3.6.4. Differently abundant genera
3.7. Volatile Fatty Acid Analysis
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- NRC, Nutritional Requirements of Swine. Washington DC, USA: National Academcic Press, 2012.
- M. Gloaguen, N. Le Floc’h, E. Corrent, Y. Primot, and J. van Milgen, “The use of free amino acids allows formulating very low crude protein diets for piglets1,” J. Anim. Sci., vol. 92, no. 2, pp. 637–644, Feb. 2014. [CrossRef]
- R. Pieper, C. Villodre Tudela, M. Taciak, J. Bindelle, J. F. Pérez, and J. Zentek, “Health relevance of intestinal protein fermentation in young pigs,” Anim. Health Res. Rev., vol. 17, no. 2, pp. 137–147, Dec. 2016. [CrossRef]
- J. V. O’Doherty, M. A. Bouwhuis, and T. Sweeney, “Novel marine polysaccharides and maternal nutrition to stimulate gut health and performance in post-weaned pigs,” Anim. Prod. Sci., vol. 57, no. 12, p. 2376, 2017. [CrossRef]
- K. L. Batson et al., “Effects of feeding diets containing low crude protein and coarse wheat bran as alternatives to zinc oxide in nursery pig diets,” J. Anim. Sci., vol. 99, no. 5, p. skab090, May 2021. [CrossRef]
- J. M. Heo, F. O. Opapeju, J. R. Pluske, J. C. Kim, D. J. Hampson, and C. M. Nyachoti, “Gastrointestinal health and function in weaned pigs: a review of feeding strategies to control post-weaning diarrhoea without using in-feed antimicrobial compounds: Feeding strategies without using in-feed antibiotics,” J. Anim. Physiol. Anim. Nutr., vol. 97, no. 2, pp. 207–237, Apr. 2013. [CrossRef]
- B. A. Williams, M. W. A. Verstegen, and S. Tamminga, “Fermentation in the large intestine of single-stomached animals and its relationship to animal health,” Nutr. Res. Rev., vol. 14, no. 02, p. 207, Dec. 2001. [CrossRef]
- K. Windey, V. De Preter, and K. Verbeke, “Relevance of protein fermentation to gut health,” Mol. Nutr. Food Res., vol. 56, no. 1, pp. 184–196, Jan. 2012. [CrossRef]
- J. Gao et al., “Protein Level and Infantile Diarrhea in a Postweaning Piglet Model,” Mediators Inflamm., vol. 2020, pp. 1–15, May 2020. [CrossRef]
- J. M. Heo, J. C. Kim, C. F. Hansen, B. P. Mullan, D. J. Hampson, and J. R. Pluske, “Feeding a diet with decreased protein content reduces indices of protein fermentation and the incidence of postweaning diarrhea in weaned pigs challenged with an enterotoxigenic strain of Escherichia coli1,” J. Anim. Sci., vol. 87, no. 9, pp. 2833–2843, Sep. 2009. [CrossRef]
- I. J. Wellock, P. D. Fortomaris, J. G. M. Houdijk, and I. Kyriazakis, “The effect of dietary protein supply on the performance and risk of post-weaning enteric disorders in newly weaned pigs,” Anim. Sci., vol. 82, no. 3, pp. 327–335, Jun. 2006. [CrossRef]
- H. M. Yun, X. J. Lei, J. Y. Cheong, J. S. Kang, and I. H. Kim, “Effect of different levels of fiber and protein on growth performance and fecal characteristics in weaning pigs,” Korean J. Agric. Sci., vol. 44, no. 3, 2017. [CrossRef]
- Y. Wang et al., “Dietary crude protein time-dependently modulates the bacterial community and metabolites and changes dietary nutrient efficiency in growing pigs,” Anim. Nutr., vol. 17, pp. 1–10, Jun. 2024. [CrossRef]
- M. V. A. N. Suiryanrayna and J. V. Ramana, “A review of the effects of dietary organic acids fed to swine,” J. Anim. Sci. Biotechnol., vol. 6, no. 1, p. 45, Dec. 2015. [CrossRef]
- R. Rutenberg, S. Bernstein, E. Fallik, N. Paster, and E. Poverenov, “The improvement of propionic acid safety and use during the preservation of stored grains,” Crop Prot., vol. 110, pp. 191–197, Aug. 2018. [CrossRef]
- P. Konieczka, D. Józefiak, M. Kinsner, and S. Smulikowska, “Effects of high-moisture corn preserved with organic acids combined with rapeseed meal and peas on performance and gut microbiota activity of broiler chickens,” Anim. Feed Sci. Technol., vol. 280, p. 115063, Oct. 2021. [CrossRef]
- S. Maher et al., “Organic acid preservation of cereal grains improves grain quality, growth performance, and intestinal health of post-weaned pigs,” Anim. Feed Sci. Technol., p. 116078, Aug. 2024. [CrossRef]
- K. R. Connolly, T. Sweeney, and J. V. O’Doherty, “Sustainable Nutritional Strategies for Gut Health in Weaned Pigs: The Role of Reduced Dietary Crude Protein, Organic Acids and Butyrate Production,” Animals, vol. 15, no. 1, p. 66, Dec. 2024. [CrossRef]
- P. Louis and H. J. Flint, “Formation of propionate and butyrate by the human colonic microbiota,” Environ. Microbiol., vol. 19, no. 1, pp. 29–41, Jan. 2017. [CrossRef]
- P. Guilloteau, L. Martin, V. Eeckhaut, R. Ducatelle, R. Zabielski, and F. Van Immerseel, “From the gut to the peripheral tissues: the multiple effects of butyrate,” Nutr. Res. Rev., vol. 23, no. 2, pp. 366–384, Dec. 2010. [CrossRef]
- H. M. Hamer, D. Jonkers, K. Venema, S. Vanhoutvin, F. J. Troost, and R.-J. Brummer, “Review article: the role of butyrate on colonic function: REVIEW: ROLE OF BUTYRATE ON COLONIC FUNCTION,” Aliment. Pharmacol. Ther., vol. 27, no. 2, pp. 104–119, Oct. 2007. [CrossRef]
- I. Tonel, M. Pinho, M. M. Lordelo, L. F. Cunha, P. Garres, and J. P. B. Freire, “Effect of butyrate on gut development and intestinal mucosa morphology of piglets,” Livest. Sci., vol. 133, no. 1–3, pp. 222–224, Sep. 2010. [CrossRef]
- H. Liu, J. Zhao, W. Zhang, and C. Nie, “Impacts of sodium butyrate on intestinal mucosal barrier and intestinal microbial community in a weaned piglet model,” Front. Microbiol., vol. 13, p. 1041885, Jan. 2023. [CrossRef]
- F. Soleimany, S. Jinap, and F. Abas, “Determination of mycotoxins in cereals by liquid chromatography tandem mass spectrometry,” Food Chem., vol. 130, no. 4, pp. 1055–1060, Feb. 2012. [CrossRef]
- J. F. McCARTHY, J. P. Bowland, and F. X. Aherne, “INFLUENCE OF METHOD UPON THE DETERMINATION OF APPARENT DIGESTIBILITY IN THE PIG,” Can. J. Anim. Sci., vol. 57, no. 1, pp. 131–135, Mar. 1977. [CrossRef]
- A. M. Walsh, T. Sweeney, C. J. O’Shea, D. N. Doyle, and J. V. O’Doherty, “Effect of dietary laminarin and fucoidan on selected microbiota, intestinal morphology and immune status of the newly weaned pig,” Br. J. Nutr., vol. 110, no. 9, pp. 1630–1638, Nov. 2013. [CrossRef]
- L. C. Clarke et al., “Effect of β-glucanase and β-xylanase enzyme supplemented barley diets on nutrient digestibility, growth performance and expression of intestinal nutrient transporter genes in finisher pigs,” Anim. Feed Sci. Technol., vol. 238, pp. 98–110, Apr. 2018. [CrossRef]
- K. Iwaki, N. Nimura, Y. Hiraga, T. Kinoshita, K. Takeda, and H. Ogura, “Amino acid analysis by reversed-phase high-performance liquid chromatography,” J. Chromatogr. A, vol. 407, pp. 273–279, Jan. 1987. [CrossRef]
- P. J. Van Soest, J. B. Robertson, and B. A. Lewis, “Methods for Dietary Fiber, Neutral Detergent Fiber, and Nonstarch Polysaccharides in Relation to Animal Nutrition,” J. Dairy Sci., vol. 74, no. 10, pp. 3583–3597, Oct. 1991. [CrossRef]
- R. Rattigan, T. Sweeney, S. Maher, K. Thornton, G. Rajauria, and J. V. O’Doherty, “Laminarin-rich extract improves growth performance, small intestinal morphology, gene expression of nutrient transporters and the large intestinal microbial composition of piglets during the critical post-weaning period,” Br. J. Nutr., vol. 123, no. 3, pp. 255–263, Feb. 2020. [CrossRef]
- D. P. Kiernan, J. V. O’Doherty, K. R. Connolly, M. Ryan, and T. Sweeney, “Exploring the differential expression of a set of key genes involved in the regulation and functioning of the stomach in the post-weaned pig,” Vet. Sci., vol. 10, no. 7, p. 473, Jul. 2023. [CrossRef]
- J. G. Caporaso et al., “QIIME allows analysis of high-throughput community sequencing data,” Nat. Methods, vol. 7, no. 5, pp. 335–336, May 2010. [CrossRef]
- T. Magoč and S. L. Salzberg, “FLASH: fast length adjustment of short reads to improve genome assemblies,” Bioinformatics, vol. 27, no. 21, pp. 2957–2963, Nov. 2011. [CrossRef]
- R. C. Edgar, B. J. Haas, J. C. Clemente, C. Quince, and R. Knight, “UCHIME improves sensitivity and speed of chimera detection,” Bioinformatics, vol. 27, no. 16, pp. 2194–2200, Aug. 2011. [CrossRef]
- T. Rognes, T. Flouri, B. Nichols, C. Quince, and F. Mahé, “VSEARCH: a versatile open source tool for metagenomics,” PeerJ, vol. 4, p. e2584, Oct. 2016. [CrossRef]
- A. M. Eren et al., “Oligotyping: differentiating between closely related microbial taxa using 16S rRNA gene data,” Methods Ecol. Evol., vol. 4, no. 12, pp. 1111–1119, Dec. 2013. [CrossRef]
- F. E. Angly, P. G. Dennis, A. Skarshewski, I. Vanwonterghem, P. Hugenholtz, and G. W. Tyson, “CopyRighter: a rapid tool for improving the accuracy of microbial community profiles through lineage-specific gene copy number correction,” Microbiome, vol. 2, no. 1, p. 11, Dec. 2014. [CrossRef]
- B.-R. Kim et al., “Deciphering diversity indices for a better understanding of microbial communities,” J. Microbiol. Biotechnol., vol. 27, no. 12, pp. 2089–2093, Dec. 2017. [CrossRef]
- B. D. Wagner et al., “On the use of diversity measures in longitudinal sequencing studies of microbial communities,” Front. Microbiol., vol. 9, p. 1037, May 2018. [CrossRef]
- P. J. McMurdie and S. Holmes, “phyloseq: An R package for reproducible interactive analysis and graphics of microbiome census data,” PLoS ONE, vol. 8, no. 4, p. e61217, Apr. 2013. [CrossRef]
- H. Kim, H. Shin, and Y. Y. Kim, “Effects of different levels of dietary crude protein on growth performance, blood profiles, diarrhea incidence, nutrient digestibility, and odor emission in weaning pigs,” Anim. Biosci., vol. 36, no. 8, pp. 1228–1240, Aug. 2023. [CrossRef]
- J. C. Lynegaard et al., “Low protein diets without medicinal zinc oxide for weaned pigs reduced diarrhea treatments and average daily gain,” Animal, vol. 15, no. 1, p. 100075, Jan. 2021. [CrossRef]
- S. Jiang et al., “Low-protein diets supplemented with glycine improves pig growth performance and meat quality: An untargeted metabolomic analysis,” Front. Vet. Sci., vol. 10, p. 1170573, Apr. 2023. [CrossRef]
- R. Marchetti et al., “Protein Content in the Diet Influences Growth and Diarrhea in Weaning Piglets,” Animals, vol. 13, no. 5, p. 795, Feb. 2023. [CrossRef]
- K. M. Pierce, J. J. Callan, P. McCarthy, and J. V. O’Doherty, “The interaction between lactose level and crude protein concentration on piglet post-weaning performance, nitrogen metabolism, selected faecal microbial populations and faecal volatile fatty acid concentrations,” Anim. Feed Sci. Technol., vol. 132, no. 3–4, pp. 267–282, Jan. 2007. [CrossRef]
- M. O. Wellington, T. G. Hulshof, J. W. Resink, K. Ernst, A. Balemans, and G. I. Page, “The effect of supplementation of essential amino acid combinations in a low crude protein diet on growth performance in weanling pigs,” Transl. Anim. Sci., vol. 7, no. 1, p. txad008, Jan. 2023. [CrossRef]
- L. Y. Yue and S. Y. Qiao, “Effects of low-protein diets supplemented with crystalline amino acids on performance and intestinal development in piglets over the first 2 weeks after weaning,” Livest. Sci., vol. 115, no. 2–3, pp. 144–152, Jun. 2008. [CrossRef]
- Y. Kuang et al., “Effects of dietary combinations of organic acids and medium chain fatty acids as a replacement of zinc oxide on growth, digestibility and immunity of weaned pigs,” Anim. Feed Sci. Technol., vol. 208, pp. 145–157, Oct. 2015. [CrossRef]
- X. Wei et al., “Dietary Organic Acids Modulate Gut Microbiota and Improve Growth Performance of Nursery Pigs,” Microorganisms, vol. 9, no. 1, p. 110, Jan. 2021. [CrossRef]
- R. Connolly, T. Sweeney, and S. Maher, “Organic acid and salt treatment of cereal at harvest improves growth performance in the post weaned pig,” Anim.-Sci. Proc., vol. 13, no. 2, p. 204, 2022.
- A. Piva, M. Morlacchini, G. Casadei, P. P. Gatta, G. Biagi, and A. Prandini, “Sodium butyrate improves growth performance of weaned piglets during the first period after weaning,” Ital. J. Anim. Sci., vol. 1, no. 1, pp. 35–41, Jan. 2002. [CrossRef]
- A. Jiao et al., “Sodium acetate, propionate, and butyrate reduce fat accumulation in mice via modulating appetite and relevant genes,” Nutrition, vol. 87–88, p. 111198, Jul. 2021. [CrossRef]
- T. Thymann et al., “Antimicrobial treatment reduces intestinal microflora and improves protein digestive capacity without changes in villous structure in weanling pigs,” Br. J. Nutr., vol. 97, no. 6, pp. 1128–1137, Jun. 2007. [CrossRef]
- J. R. Pluske, I. H. Williams, and F. X. Aherne, “Maintenance of villous height and crypt depth in piglets by providing continuous nutrition after weaning,” Anim. Sci., vol. 62, no. 1, pp. 131–144, Feb. 1996. [CrossRef]
- G. Z. Dong and J. R. Pluske, “The Low Feed Intake in Newly-weaned Pigs: Problems and Possible Solutions,” Asian-Australas. J. Anim. Sci., vol. 20, no. 3, pp. 440–452, Jan. 2007. [CrossRef]
- M. E. Duarte and S. W. Kim, “Intestinal microbiota and its interaction to intestinal health in nursery pigs,” Anim. Nutr., vol. 8, pp. 169–184, Mar. 2022. [CrossRef]
- A. Liu et al., “Response of Gut Microbiota to Dietary Fiber and Metabolic Interaction With SCFAs in Piglets,” Front. Microbiol., vol. 9, p. 2344, Sep. 2018. [CrossRef]
- H. Duan, L. Wang, M. Huangfu, and H. Li, “The impact of microbiota-derived short-chain fatty acids on macrophage activities in disease: Mechanisms and therapeutic potentials,” Biomed. Pharmacother., vol. 165, p. 115276, Sep. 2023. [CrossRef]
- K. Nie, “Roseburia intestinalis: A Beneficial Gut Organism From the Discoveries in Genus and Species,” Front. Cell. Infect. Microbiol., vol. 11, 2021.
- X. Wei, T. Tsai, S. Howe, and J. Zhao, “Weaning Induced Gut Dysfunction and Nutritional Interventions in Nursery Pigs: A Partial Review,” Animals, vol. 11, no. 5, p. 1279, Apr. 2021. [CrossRef]
- M. T. Siddiqui and G. A. Cresci, “The Immunomodulatory Functions of Butyrate,” J. Inflamm. Res., vol. Volume 14, pp. 6025–6041, Nov. 2021. [CrossRef]
- A. Bedford and J. Gong, “Implications of butyrate and its derivatives for gut health and animal production,” Anim. Nutr., vol. 4, no. 2, pp. 151–159, Jun. 2018. [CrossRef]
- R. Rattigan, T. Sweeney, S. Maher, M. T. Ryan, K. Thornton, and J. V. O’Doherty, “Effects of reducing dietary crude protein concentration and supplementation with either laminarin or zinc oxide on the growth performance and intestinal health of newly weaned pigs,” Anim. Feed Sci. Technol., vol. 270, p. 114693, Dec. 2020. [CrossRef]
- T. G. Moreira et al., “Dietary protein modulates intestinal dendritic cells to establish mucosal homeostasis,” Mucosal Immunol., p. S1933021924000606, Jun. 2024. [CrossRef]
- N.-R. Shin, T. W. Whon, and J.-W. Bae, “Proteobacteria: microbial signature of dysbiosis in gut microbiota,” Trends Biotechnol., vol. 33, no. 9, pp. 496–503, Sep. 2015. [CrossRef]
- A. Karasova et al., “Development of piglet gut microbiota at the time of weaning influences development of postweaning diarrhea – A field study,” Res. Vet. Sci., vol. 135, pp. 59–65, Mar. 2021. [CrossRef]
- T. Unno, J. Kim, R. B. Guevarra, and S. G. Nguyen, “Effects of Antibiotic Growth Promoter and Characterization of Ecological Succession in Swine Gut Microbiota,” J. Microbiol. Biotechnol., vol. 25, no. 4, pp. 431–438, Apr. 2015. [CrossRef]
- A. Angelakis et al., “Treponema species enrich the gut microbiota of traditional rural populations but are absent from urban individuals,” New Microbes New Infect., vol. 27, pp. 14–21, Jan. 2019. [CrossRef]
- J. Quan et al., “Metagenomic Characterization of Intestinal Regions in Pigs With Contrasting Feed Efficiency,” Front. Microbiol., vol. 11, p. 32, Jan. 2020. [CrossRef]
- R. Jha, J. M. Fouhse, U. P. Tiwari, L. Li, and B. P. Willing, “Dietary Fiber and Intestinal Health of Monogastric Animals,” Front. Vet. Sci., vol. 6, p. 48, Mar. 2019. [CrossRef]
- R. B. Canani, “Potential beneficial effects of butyrate in intestinal and extraintestinal diseases,” World J. Gastroenterol., vol. 17, no. 12, p. 1519, 2011. [CrossRef]
- M. Flis, W. Sobotka, and Z. Antoszkiewicz, “Fiber substrates in the nutrition of weaned piglets – a review,” Ann. Anim. Sci., vol. 17, no. 3, pp. 627–644, Jul. 2017. [CrossRef]
- L. Q. Langfeld, K. Du, S. Bereswill, and M. M. Heimesaat, “A review of the antimicrobial and immune-modulatory properties of the gut microbiota-derived short chain fatty acid propionate – What is new?,” Eur. J. Microbiol. Immunol., vol. 11, no. 2, pp. 50–56, Jul. 2021. [CrossRef]
- W. B. Crosby and A. R. Woolums, “Pasteurellaceae: Avibacterium, Bibersteinia, Mannheimia, and Pasteurella,” in Veterinary Microbiology, 1st ed., D. S. McVey, M. Kennedy, M. M. Chengappa, and R. Wilkes, Eds., Wiley, 2022, pp. 108–117. [CrossRef]
- K. R. Connolly et al., “The Role of Propionic Acid as a Feed Additive and Grain Preservative on Weanling Pig Performance and Digestive Health,” 2024. [CrossRef]
- R. Vasquez, J. K. Oh, J. H. Song, and D.-K. Kang, “Gut microbiome-produced metabolites in pigs: a review on their biological functions and the influence of probiotics,” J. Anim. Sci. Technol., vol. 64, no. 4, pp. 671–695, Jul. 2022. [CrossRef]
| Cereal crop type | Wheat | Barley | ||
|---|---|---|---|---|
| Grain preservation method | Dried | OA-preserved | Dried | OA-preserved |
| Analysis post storage (g/kg) | ||||
| DM | 873.5 | 840.5 | 873.5 | 848.5 |
| Ash | 16.0 | 16.0 | 19.5 | 19.0 |
| GE (MJ/kg) | 15.9 | 15.3 | 16.1 | 15.6 |
| Crude protein | 89.0 | 84.5 | 103.5 | 87.5 |
| Crude fibre | 25.5 | 23.5 | 57.5 | 52.0 |
| Starch | 626.5 | 608.5 | 530.0 | 504.0 |
| Fat | 14.0 | 14.5 | 15.5 | 14.0 |
| TMC (cfu/g) | 37000 | 3800 | 27000 | 2400 |
| Mycotoxin levels (μg/kg)a | ||||
| Deoxynivalenol | <75 | <75 | <75 | <75 |
| T-2 toxin | <4.00 | <4.00 | 7.0 | <4.00 |
| HT-2 toxin | <4.00 | <4.00 | 30.1 | 8.7 |
| Zearalenone | <10 | <10 | <10 | <10 |
| Ochratoxin A | 3.8 | <1.00 | 1.75 | <1.00 |
| Dietary Treatments* | ||||
|---|---|---|---|---|
| Starter Diets | Link Diets | |||
| Grain preservation method | Dried | OA-preserved | Dried | OA-preserved |
| Ingredients (g/kg) | ||||
| Wheat | 328/325 | 328/325 | 403/400 | 403/400 |
| Barley | 150 | 150 | 150 | 150 |
| Maize | 170 | 170 | 144.5 | 144.5 |
| Full fat soya | 140 | 140 | 119 | 119 |
| Soya bean meal | 70 | 70 | 59.5 | 59.5 |
| Soya bean concentrate | 60 | 60 | 51 | 51 |
| Whey powder | 50 | 50 | 42.5 | 42.5 |
| Soya oil | 30 | 30 | 25.5 | 25.5 |
| Salt | 2 | 2 | 2 | 2 |
| Mono calcium phosphate | 4.2 | 4.2 | 4.2 | 4.2 |
| Calcium carbonate | 4.5 | 4.5 | 4.5 | 4.5 |
| L-Lysine HCl, 78.8% | 4.9 | 4.9 | 4.9 | 4.9 |
| DL-Methionine | 2.5 | 2.5 | 2.5 | 2.5 |
| L-Threonine | 2.7 | 2.7 | 2.7 | 2.7 |
| Tryptophan | 0.7 | 0.7 | 0.7 | 0.7 |
| Valine | 0.5 | 0.5 | 0.5 | 0.5 |
| Butyric acid | 0/3 | 0/3 | 0/3 | 0/3 |
| Dietary Treatments* | ||||||||
|---|---|---|---|---|---|---|---|---|
| Stage 1 Diets | Stage 2 Diets | |||||||
| Grain preservation method | Dried | OA-preserved | Dried | OA-preserved | Dried | OA-preserved | Dried | OA-preserved |
| Butyric acid supplementation | No | No | Yes | Yes | No | No | Yes | Yes |
| Ingredients (g/kg) | ||||||||
| DM | 896.00 | 882.50 | 896.00 | 884.00 | 892.50 | 888.00 | 891.00 | 877.00 |
| Ash | 32.00 | 33.50 | 35.00 | 35.50 | 33.50 | 32.00 | 30.00 | 32.00 |
| GE (MJ/kg) | 16.65 | 16.2 | 17.04 | 16.75 | 16.68 | 16.47 | 16.98 | 16.20 |
| Crude fat | 58.50 | 57.00 | 59.50 | 58.00 | 54.00 | 53.00 | 52.50 | 50.00 |
| Crude protein | 185.00 | 182.50 | 194.00 | 191.50 | 172.50 | 175.00 | 177.50 | 177.50 |
| Crude fibre | 25.00 | 23.50 | 25.50 | 22.00 | 25.50 | 22.00 | 27.50 | 25.00 |
| NDF | 107.00 | 98.00 | 104.50 | 99.00 | 106.50 | 95.00 | 112.00 | 102.50 |
| ADF | 31.00 | 28.50 | 30.00 | 28.00 | 30.50 | 27.00 | 33.50 | 31.50 |
| Starch | 354.00 | 350.00 | 349.00 | 348.00 | 383.50 | 375.50 | 392.50 | 380.50 |
| Lysine | 15.57 | 15.55 | 15.56 | 15.58 | 14.24 | 14.25 | 14.27 | 14.24 |
| Threonine | 10.71 | 10.70 | 10.68 | 10.71 | 9.99 | 9.96 | 9.96 | 9.98 |
| Methionine and cysteine | 10.03 | 10.01 | 10.00 | 10.03 | 9.55 | 9.53 | 9.52 | 9.56 |
| Leucine | 17.49 | 17.45 | 17.47 | 14.45 | 14.27 | 14.30 | 14.25 | 14.26 |
| Isoleucine | 9.53 | 9.56 | 9.55 | 9.52 | 8.72 | 8.76 | 8.70 | 8.73 |
| Arginine | 12.05 | 12.06 | 12.06 | 12.07 | 11.10 | 11.07 | 11.11 | 11.07 |
| Histidine | 5.18 | 5.20 | 5.18 | 5.22 | 4.79 | 4.78 | 4.77 | 4.80 |
| Phenylalanine | 9.73 | 9.76 | 9.72 | 9.74 | 9.02 | 9.04 | 9.02 | 9.01 |
| Tyrosine | 6.56 | 6.54 | 6.58 | 6.56 | 6.09 | 6.07 | 6.07 | 6.09 |
| Alanine | 9.33 | 9.36 | 9.31 | 9.35 | 8.53 | 8.55 | 8.57 | 8.56 |
| Aspartic | 19.75 | 19.78 | 19.77 | 19.75 | 17.74 | 17.77 | 17.72 | 17.76 |
| Glutaminc | 41.92 | 41.90 | 41.89 | 41.93 | 40.05 | 40.01 | 40.00 | 40.03 |
| Glycine | 7.81 | 7.78 | 7.84 | 7.82 | 7.33 | 7.30 | 7.35 | 7.31 |
| Serine | 9.93 | 9.96 | 9.91 | 9.92 | 9.23 | 9.23 | 9.25 | 9.24 |
| Proline | 14.32 | 14.34 | 14.35 | 19.32 | 13.75 | 13.78 | 13.77 | 13.80 |
| Tryptophan | 2.73 | 2.74 | 2.71 | 2.74 | 2.62 | 2.60 | 2.64 | 2.62 |
| Valine | 10.62 | 10.66 | 10.66 | 10.63 | 7.83 | 7.80 | 7.84 | 7.81 |
| TMC (cfu/g) | 4800 | 3300 | 14000 | 4000 | 5600 | 4000 | 5200 | 4700 |
| Mycotoxin levels (mg/kg)a | ||||||||
| Deoxynivalenol | <75 | <75 | <75 | <75 | <75 | <75 | <75 | <75 |
| T-2 toxin | <4.00 | <4.00 | <4.00 | <4.00 | <4.00 | <4.00 | <4.00 | <4.00 |
| HT-2 toxin | 14.10 | 11.30 | 14.60 | 12.10 | <10.70 | <10.60 | 9.62 | 10.70 |
| Zearalenone | 30.00 | 27.00 | 26.00 | 22.00 | 23.00 | 25.00 | 25.00 | 18.00 |
| Ochratoxin | 2.39 | <1.00 | <1.00 | <1.00 | <1.60 | <1.00 | 1.46 | 1.43 |
| Target gene | Gene name | Accession no. | Forward primer (5’-3’) Reverse primer (5’-3’) |
|
|---|---|---|---|---|
| Nutrient transporters | ||||
| FABP2 | Fatty Acid Binding Protein 2 | NM_001031780.1 | F: CAGCCTCGCAGACGGAACTGAA R: GTGTTCTGGGCTGTGCTCCAAGA |
|
| SLC2A1 | Solute Carrier family 2 Member 1 | XM_003482115.1 | F: TGCTCATCAACCGCAATGA R: GTTCCGCGCAGCTTCTTC |
|
| SLC15A1 | Solute Carrier Family 15 Member 1 | NM_214347.1 | F: GGATAGCCTGTACCCCAAGCT R: CATCCTCCACGTGCTTCTTGA |
|
| Inflammatory markers | ||||
| IL1A | Interleukin 1A | NM_214029.1 | F: CAGCCAACGGGAAGATTCTG R: ATGGCTTCCAGGTCGTCAT |
|
| IL1B | Interleukin 1B | NM_001005149.1 | F: TTGAATTCGAGTCTGCCCTGT R: CCCAGGAAGACGGGCTTT |
|
| IL6 | Interleukin 6 | NM_214399.1 | F: GACAAAGCCACCACCCCTAA R:CTCGTTCTGTGACTGCAGCTTATC |
|
| CXCL8 | C-X-C motif chemokine ligand 8 | NM_213867.1 | F: TGCACTTACTCTTGCCAGAACTG R: CAAACTGGCTGTTGCCTTCTT |
|
| IL10 | Interleukin 10 | NM_214041.1 | F: GCCTTCGGCCCAGTGAA R: AGAGACCCGGTCAGCAACAA |
|
| IL17 | Interleukin 17 | NM_001005729.1 | F: CCCTGTCACTGCTGCTTCTG R: TCATGATTCCCGCCTTCAC |
|
| IL22 | Interleukin 22 | XM_001926156.1 | F: GATGAGAGAGCGCTGCTACCTGG R: GAAGGACGCCACCTCCTGCATGT |
|
| TNF | Tumour Necrosis Factor | NM_214022.1 | F: TGGCCCCTTGAGCATCA R: CGGGCTTATCTGAGGTTTGAGA |
|
| FOXP3 | Forkhead box P3 | NM_001128438.1 | F: GTGGTGCAGTCTCTGGAACAAC R: AGGTGGGCCTGCATAGCA |
|
| Tight junctions | ||||
| TJP1 | Tight Junction Protein 1 | XM_021098827.1 | F: TGAGAGCCAACCATGTCTTGAA R: CTCAGACCCGGCTCTCTGTCT |
|
| CLDN1 | Claudin 1 | NM 001244539.1 | F: CTGGGAGGTGCCCTACTTTG R: TGGATAGGGCCTTGGTGTTG |
|
| Toll like receptors | ||||
| TLR4 | Toll-like Receptor 4 | NM_001293317.1 | F: TGCATGGAGCTGAATTTCTACAA R: GATAAATCCAGCACCTGCAGTTC |
|
| Mucins | ||||
| MUC2 | Mucin 2 | AK231524 | F: CAACGGCCTCTCCTTCTCTGT R: GCCACACTGGCCCTTTGT |
|
| Reference genes | ||||
| H3F3A | Histone H3.3 | NM_213930.1 | F: CATGGCTCGTACAAAGCAGA R: ACCAGGCCTGTAACGATGAG |
|
| YWHAZ | Tyrosine 3-Monooxygenase/tyrtophan 5-monooxygenase Activation Protein Zeta | NM_001315726.1 | F: GGACATCGGATACCCAAGGA R: AAGTTGGAAGGCCGGTTAATTT |
|
| ACTB | Actin Beta | XM_001927228.1 | F:GGACATCGGATACCCAAGGA R:AAGTTGGAAGGCCGGTTAATTT |
|
| Treatment* | P -value | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| Grain preservation method | Dried | OA-preserved | Dried | OA-preserved | SEM | Grain | Butyric | Grain x Butyric | |
| Butyric acid supplementation | No | No | Yes | Yes | |||||
| D 0-15 | |||||||||
| ADFI (g/d) | 451 | 450 | 419 | 414 | 15.86 | 0.823 | 0.030 | 0.913 | |
| ADG (g/d) | 262 | 366 | 337 | 354 | 20.34 | 0.603 | 0.354 | 0.773 | |
| FCR (kg/kg) | 1.31 | 1.25 | 1.29 | 1.21 | 0.057 | 0.208 | 0.538 | 0.921 | |
| BW (kg) | 12.83 | 12.90 | 12.46 | 12.71 | 0.305 | 0.603 | 0.354 | 0.773 | |
| FS | 2.18 | 2.19 | 2.17 | 2.16 | 0.029 | 0.981 | 0.356 | 0.681 | |
| D 15-35 | |||||||||
| ADFI (g/d) | 862ab | 933b | 879ab | 834a | 26.51 | 0.611 | 0.116 | 0.028 | |
| ADG (g/d) | 551 | 630 | 561 | 553 | 27.04 | 0.176 | 0.210 | 0.107 | |
| FCR | 1.65 | 1.50 | 1.62 | 1.54 | 0.076 | 0.123 | 0.970 | 0.605 | |
| BW (kg) | 22.74 | 24.24 | 22.55 | 22.67 | 0.678 | 0.228 | 0.189 | 0.301 | |
| D 0-35 | |||||||||
| ADFI (g/d) | 675 | 714 | 670 | 643 | 21.77 | 0.759 | 0.047 | 0.100 | |
| ADG (g/d) | 465 | 515 | 459 | 463 | 20.36 | 0.179 | 0.147 | 0.242 | |
| FCR | 1.49 | 1.40 | 1.49 | 1.39 739 | 0.047 | 0.040 | 0.992 | 0.918 | |
| Treatment* | SEM | P-value | ||||||
|---|---|---|---|---|---|---|---|---|
| Grain preservation method | Dried | OA-preserved | Dried | OA-preserved | Grain | Butyric | Grain x Butyric | |
| Butyric acid supplementation | No | No | Yes | Yes | ||||
| DM | 0.845 | 0.852 | 0.847 | 0.865 | 0.004 | 0.005 | 0.063 | 0.181 |
| OM | 86.30 | 86.88 | 86.47 | 88.00 | 0.383 | 0.008 | 0.095 | 0.216 |
| Ash | 57.70ab | 59.87b | 56.72a | 63.71c | 1.091 | <0.010 | 0.186 | 0.031 |
| N | 78.41 | 80.89 | 79.96 | 82.23 | 0.710 | 0.002 | 0.045 | 0.878 |
| GE | 83.68 | 84.57 | 84.26 | 85.77 | 0.422 | 0.007 | 0.039 | 0.455 |
| Treatment* | SEM | P-value | ||||||
|---|---|---|---|---|---|---|---|---|
| Grain preservation method | Dried | OA-preserved | Dried | OA-preserved | Grain | Butyric | Grain x Butyric | |
| Butyric acid supplementation | No | No | Yes | Yes | ||||
| Duodenum | ||||||||
| VH μm | 271.79 | 303.53 | 244.60 | 308.73 | 20.257 | 0.023 | 0.587 | 0.440 |
| CDμ m | 124.66 | 134.99 | 88.94 | 114.58 | 9.435 | 0.063 | 0.006 | 0.433 |
| VH:CD | 2.29 | 2.28 | 2.93 | 2.81 | 0.267 | 0.802 | 0.034 | 0.844 |
| Jejunum | ||||||||
| VH μm | 307.42a | 303.48ab | 250.46a | 366.93b | 24.592 | 0.028 | 0.895 | 0.024 |
| CD μm | 135.23 | 106.17 | 101.81 | 121.26 | 13.119 | 0.712 | 0.486 | 0.081 |
| VH:CD | 2.46 | 2.88 | 2.61 | 3.11 | 0.261 | 0.082 | 0.472 | 0.892 |
| Ileum | ||||||||
| VH μm | 294.51 | 297.82 | 285.33 | 299.50 | 17.489 | 0.615 | 0.830 | 0.763 |
| CD μm | 102.70 | 93.09 | 98.73 | 103.09 | 7.536 | 0.725 | 0.689 | 0.372 |
| VH:CD | 2.90 | 3.32 | 2.93 | 3.05 | 0.242 | 0.266 | 0.622 | 0.549 |
| Treatment* | SEM | P-value | ||||||
|---|---|---|---|---|---|---|---|---|
| Grain preservation method | Dried | OA-preserved | Dried | OA-preserved | Grain | Butyric | Grain x Butyric | |
| Butyric acid supplementation | No | No | Yes | Yes | ||||
| Duodenum | ||||||||
| IL1A | 1.58 | 0.93 | 0.96 | 1.50 | 0.272 | 0.829 | 0.932 | 0.029 |
| MUC2 | 1.04ab | 0.88a | 0.94a | 1.26b | 0.125 | 0.517 | 0.256 | 0.050 |
| Jejunum | ||||||||
| SLC2A1 | 1.00a | 0.99a | 0.94a | 1.36b | 0.097 | 0.040 | 0.125 | 0.036 |
| CXCL8 | 1.13 | 0.87 | 1.38 | 0.91 | 0.180 | 0.042 | 0.418 | 0.556 |
| TJP1 | 0.93 | 1.03 | 0.94 | 1.04 | 0.040 | 0.025 | 0.866 | 0.939 |
| Ileum | ||||||||
| TLR4 | 1.22a | 0.90ab | 0.78b | 1.24a | 0.131 | 0.580 | 0.688 | 0.006 |
| Phylum | Treatments* | P-value | ||||||
|---|---|---|---|---|---|---|---|---|
| Grain preservation method | Dried | OA-preserved | Dried | OA-preserved | SEM | Grain | Butyric | Grain x Butyric |
| Butyric acid supplementation | No | No | Yes | Yes | ||||
| Ileum | ||||||||
| Firmicutes | 80.46a | 91.20ab | 98.77b | 82.67ab | 4.271 | 0.582 | 0.270 | 0.005 |
| Proteobacteria | 19.54a | 1.61b | 0.87b | 12.35c | 1.977 | 0.783 | 0.082 | <0.001 |
| Colon | ||||||||
| Firmicutes | 76.98 | 70.84 | 74.17 | 77.90 | 3.121 | 0.680 | 0.485 | 0.117 |
| Bacteroidetes | 8.53a | 17.63b | 11.34a | 10.72a | 1.484 | 0.004 | 0.323 | 0.001 |
| Actinobacteria | 5.50 | 3.65 | 5.28 | 2.32 | 0.829 | 0.002 | 0.188 | 0.271 |
| Tenericutes | 0.48 | 1.71 | 0.47 | 2.34 | 0.541 | 0.001 | 0.716 | 0.684 |
| Proteobacteria | 2.97 | 1.35 | 0.07 | 0.51 | 0.610 | 0.409 | 0.004 | 0.070 |
| Spirochaetes | 1.59 | 0.49 | 5.33 | 1.36 | 0.816 | 0.001 | 0.002 | 0.783 |
| Family | Treatments* | P-value | ||||||
|---|---|---|---|---|---|---|---|---|
| Grain preservation method | Dried | OA-preserved | Dried | OA-preserved | SEM | Grain | Butyric | Grain x Butyric |
| Butyric acid supplementation | No | No | Yes | Yes | ||||
| Ileum | ||||||||
| Lactobacillaceae | 79.18 | 77.07 | 81.49 | 73.90 | 4.45 | 0.242 | 0.899 | 0.499 |
| Clostridiaceae | 4.77a | 6.15a | 12.29b | 1.77c | 1.431 | 0.002 | 0.509 | <0.001 |
| Streptococcaceae | 0.39a | 8.43b | 4.99b | 6.72b | 1.298 | <0.001 | 0.008 | 0.002 |
| Pasteurellaceae | 0.39a | 1.16a | 0.45a | 9.32b | 1.365 | 0.001 | 0.047 | 0.079 |
| Colon | ||||||||
| Lactobacillaceae | 8.46 | 6.94 | 8.52 | 9.72 | 1.10 | 0.790 | 0.171 | 0.189 |
| Lachnospiraceae | 12.28 | 10.76 | 13.65 | 11.49 | 1.32 | 0.156 | 0.417 | 0.847 |
| Erysipelotrichaceae | 0.35 | 0.66 | 0.54 | 0.57 | 0.287 | 0.488 | 0.773 | 0.564 |
| Eubacteriaceae | 3.07 | 3.44 | 3.67 | 3.76 | 0.701 | 0.726 | 0.496 | 0.828 |
| Ruminococcaceae | 37.23 | 34.12 | 33.64 | 38.81 | 2.203 | 0.641 | 0.816 | 0.061 |
| Clostridiaceae | 2.59 | 3.59 | 4.46 | 2.88 | 0.746 | 0.786 | 0.431 | 0.067 |
| Propionibacteriaceae | 5.27 | 3.36 | 5.40 | 1.69 | 0.822 | <0.001 | 0.106 | 0.084 |
| Streptococcaceae | 0.14 | 0.67 | 0.92 | 0.07 | 0.363 | 0.562 | 0.831 | 0.125 |
| Oscillospiraceae | 2.06 | 2.15 | 2.87 | 2.01 | 0.599 | 0.520 | 0.598 | 0.417 |
| Sphingobacteriaceae | 0.09 | 0.10 | 0.25 | 0.09 | 0.176 | 0.692 | 0.687 | 0.606 |
| Spiroplasmataceae | 0.45 | 1.20 | 0.23 | 0.99 | 0.414 | 0.026 | 0.414 | 0.656 |
| Rikenellaceae | 1.22a | 4.51b | 2.58ab | 1.23a | 0.751 | 0.297 | 0.307 | <0.001 |
| Hungateiclostridiaceae | 2.21 | 3.22 | 1.26 | 2.41 | 0.634 | 0.048 | 0.097 | 0.580 |
| Muribaculaceae | 0.32 | 0.45 | 0.26 | 0.26 | 0.236 | 0.781 | 0.573 | 0.801 |
| Acidaminococcaceae | 0.59 | 0.65 | 0.44 | 0.83 | 0.322 | 0.449 | 0.961 | 0.571 |
| Veillonellaceae | 0.19 | 0.78 | 0.21 | 0.18 | 0.313 | 0.396 | 0.354 | 0.315 |
| Prevotellaceae | 7.11a | 13.40b | 8.77a | 9.33ab | 1.294 | 0.006 | 0.520 | 0.021 |
| Christensenellaceae | 2.16 | 1.09 | 1.37 | 1.60 | 0.556 | 0.381 | 0.893 | 0.167 |
| Spirochaetaceae | 1.66 | 0.50 | 3.86 | 1.386 | 0.743 | 0.003 | 0.010 | 0.797 |
| Coriobacteriacea | 0.45 | 0.16 | 0.13 | 0.29 | 0.238 | 0.870 | 0.682 | 0.254 |
| Propionibacteriaceae | 5.27 | 3.36 | 5.40 | 1.69 | 0.822 | <0.001 | 0.106 | 0.084 |
| Eubacteriaceae | 3.07 | 3.44 | 3.67 | 3.76 | 0.701 | 0.726 | 0.496 | 0.828 |
| Anaeroplasmataceae | 0.05 | 0.11 | 0.27 | 0.02 | 0.184 | 0.618 | 0.933 | 0.321 |
| Genus | Treatments* | P-value | ||||||
|---|---|---|---|---|---|---|---|---|
| Grain preservation method | Dried | OA-preserved | Dried | OA-preserved | SEM | Grain | Butyric | Grain x Butyric |
| Butyric acid supplementation | No | No | Yes | Yes | ||||
| Ileum | ||||||||
| Lactobacillus | 66.01a | 77.75ab | 82.21b | 74.88ab | 3.943 | 0.499 | 0.091 | 0.022 |
| Clostridium | 4.82a | 6.24a | 12.37b | 2.05a | 1.436 | 0.002 | 0.698 | <0.001 |
| Streptococcus | 0.39a | 8.51b | 5.01b | 7.79b | 1.305 | <0.001 | 0.005 | 0.003 |
| Colon | ||||||||
| Lactobacillus | 8.75 | 7.01 | 8.67 | 9.71 | 1.102 | 0.658 | 0.205 | 0.180 |
| Collinsella | 0.46 | 0.16 | 0.13 | 0.29 | 0.240 | 0.869 | 0.672 | 0.250 |
| Catenibacterium | 0.08 | 0.13 | 0.11 | 0.03 | 0.129 | 0.802 | 0.692 | 0.551 |
| Gemmiger | 7.09ab | 5.27a | 5.54ab | 9.27b | 1.077 | 0.440 | 0.264 | 0.007 |
| Ruminococcus | 2.14 | 1.21 | 2.23 | 0.65 | 0.564 | 0.010 | 0.380 | 0.319 |
| Faecalibacterium | 24.44 | 24.63 | 21.95 | 26.12 | 1.807 | 0.218 | 0.737 | 0.257 |
| Butyricicoccus | 1.03 | 0.81 | 1.36 | 1.40 | 0.418 | 0.752 | 0.227 | 0.694 |
| Holdemanella | 0.20 | 0.25 | 0.25 | 0.19 | 0.187 | 0.974 | 0.967 | 0.757 |
| Clostridium | 1.65 | 2.69 | 3.12 | 1.74 | 0.625 | 0.845 | 0.690 | 0.139 |
| Streptococcus | 0.14 | 0.66 | 0.92 | 0.07 | 0.362 | 0.559 | 0.827 | 0.225 |
| Oscillibacter | 2.13 | 2.16 | 2.91 | 2.81 | 0.603 | 0.958 | 0.215 | 0.920 |
| Spiroplasma | 0.46 | 1.21 | 0.23 | 1.00 | 0.416 | 0.025 | 0.405 | 0.645 |
| Propionibacterium | 5.58 | 3.36 | 4.37 | 1.68 | 0.835 | 0.001 | 0.023 | 0.279 |
| Anaerocella | 1.22a | 3.19b | 2.58ab | 1.23a | 0.631 | 0.689 | 0.705 | 0.004 |
| Pseudobutyrivibrio | 0.46 | 0.71 | 0.38 | 0.44 | 0.297 | 0.580 | 0.535 | 0.776 |
| Eubacterium | 3.16 | 3.45 | 3.69 | 3.76 | 0.702 | 0.788 | 0.535 | 0.858 |
| Dorea | 2.09 | 1.10 | 3.53 | 1.46 | 0.665 | 0.010 | 0.156 | 0.657 |
| Anaerobacterium | 1.72 | 2.60 | 1.18 | 2.09 | 0.571 | 0.076 | 0.271 | 0.765 |
| Prevotella | 6.30 | 7.70 | 5.73 | 6.15 | 0.981 | 0.341 | 0.265 | 0.645 |
| Phascolarctobacterium | 0.58 | 0.65 | 0.45 | 0.46 | 0.305 | 0.906 | 0.558 | 0.922 |
| Roseburia | 1.72 | 4.38 | 2.95 | 3.61 | 0.740 | 0.012 | 0.419 | 0.094 |
| Fournierella | 0.58 | 1.48 | 1.10 | 0.69 | 0.430 | 0.546 | 0.875 | 0.079 |
| Megasphaera | 0.13 | 0.49 | 0.58 | 0.18 | 0.269 | 0.930 | 0.745 | 0.101 |
| Agathobacter | 1.11 | 1.34 | 0.25 | 1.56 | 0.441 | 0.031 | 0.140 | 0.075 |
| Alloprevotella | 0.76a | 3.67b | 2.63b | 2.94b | 0.724 | 0.004 | 0.071 | 0.012 |
| Blautia | 3.13 | 1.09 | 1.68 | 0.25 | 0.626 | 0.002 | 0.021 | 0.328 |
| Prevotellamassilia | 0.47 | 0.30 | 0.08 | 0.27 | 0.241 | 0.652 | 0.273 | 0.322 |
| Kineothrix | 1.06 | 0.30 | 0.20 | 0.67 | 0.390 | 0.959 | 0.467 | 0.143 |
| Christensenella | 2.14 | 1.09 | 1.37 | 1.60 | 0.554 | 0.386 | 0.910 | 0.173 |
| Pseudoflavonifractor | 1.77a | 0.68ab | 0.43b | 1.11ab | 0.503 | 0.982 | 0.268 | 0.029 |
| Solitalea | 0.09 | 0.11 | 0.25 | 0.09 | 0.176 | 0.703 | 0.699 | 0.593 |
| Paramuribaculum | 0.07 | 0.06 | 0.14 | 0.05 | 0.134 | 0.662 | 0.849 | 0.740 |
| Methanobrevibacter | 1.04 | 0.63 | 0.59 | 0.83 | 0.386 | 0.839 | 0.729 | 0.326 |
| Asteroleplasma | 0.05 | 0.11 | 0.27 | 0.02 | 0.185 | 0.618 | 0.930 | 0.318 |
| Treponema | 1.48 | 0.46 | 3.72 | 0.99 | 0.729 | 0.002 | 0.026 | 0.845 |
| Treatment* | P-value | |||||||
|---|---|---|---|---|---|---|---|---|
| Grain preservation method | Dried | OA-Preserved | Dried | OA-preserved | SEM | Grain | Butyric | Grain x Butyric |
| Butyric acid supplementation | No | No | Yes | Yes | ||||
| Caecum (mol/gram) | ||||||||
| Acetate | 0.505 | 0.450 | 0.429 | 0.429 | 0.018 | 0.112 | 0.007 | 0.1101 |
| Propionate | 0.280 | 0.265 | 0.328 | 0.321 | 0.014 | 0.399 | <0.001 | 0.749 |
| Butyrate | 0.161 | 0.202 | 0.184 | 0.200 | 0.013 | 0.024 | 0.397 | 0.308 |
| Valerate | 0.032 | 0.039 | 0.030 | 0.027 | 0.004 | 0.593 | 0.056 | 0.177 |
| Isobutyrate | 0.010a | 0.021b | 0.016ab | 0.012a | 0.003 | 0.198 | 0.449 | 0.007 |
| Isovalerate | 0.011a | 0.024b | 0.013a | 0.011a | 0.003 | 0.078 | 0.059 | 0.008 |
| BCFA | 0.046 | 0.059 | 0.062 | 0.047 | 0.007 | 0.923 | 0.735 | 0.131 |
| Total | 142.05 | 153.38 | 141.05 | 181.44 | 10.255 | 0.013 | 0.177 | 0.148 |
| Colon (mol/gram) | ||||||||
| Acetate | 0.512 | 0.499 | 0.434 | 0.421 | 0.012 | 0.330 | <0.001 | 0.988 |
| Propionate | 0.281 | 0.298 | 0.334 | 0.326 | 0.011 | 0.667 | <0.001 | 0.249 |
| Butyrate | 0.145 | 0.146 | 0.184 | 0.192 | 0.010 | 0.644 | <0.001 | 0.746 |
| Valerate | 0.032 | 0.032 | 0.027 | 0.028 | 0.004 | 0.817 | 0.293 | 0.914 |
| Isobutyrate | 0.015ab | 0.012b | 0.011b | 0.018a | 0.002 | 0.341 | 0.550 | 0.033 |
| Isovalerate | 0.017 | 0.012 | 0.010 | 0.014 | 0.002 | 0.958 | 0.378 | 0.076 |
| BCFA | 0.063a | 0.052a | 0.058a | 0.083b | 0.007 | 0.263 | 0.057 | 0.010 |
| Total | 162.47 | 196.79 | 194.71 | 185.50 | 10.927 | 0.261 | 0.346 | 0.050 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).