Submitted:
24 October 2024
Posted:
25 October 2024
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Materials and Methods
- Propagation of parasites and use as targets:
- Parasite Lysis:
- Recombinase Polymerase Amplification [RPA]:
- CRISPR:
- Detection:
3. Results
- Summary:
- Identification of target sequence for detection:
- Design and testing of RPA primers:
- Selection of RPA Primer Pairs:
- Parasite Lysis for RPA:
- Threshold of RPA amplification:
- Variation of time and temperature for RPA:
- CRISPR detection:
- RPA-CRISPR optimization:
- CRISPR Specificity:
4. Discussion
5. Patents
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- de Vries HJC, Schallig HD. Cutaneous Leishmaniasis: A 2022 Updated Narrative Review into Diagnosis and Management Developments. Am J Clin Dermatol. 2022 Nov;23(6):823-840. [CrossRef] [PubMed] [PubMed Central]
- Pan American Health Organization (PAHO). Leishmaniasis: Epidemiological Report for the Americas. No. 12 (December 2023). Retrieved March 28, 2024, from https://www.paho.org/en/documents/leishmaniasis-epidemiological-report-americas-no12-december-2023.
- Tamiru HF, Mashalla YJ, Mohammed R, Tshweneagae GT. Cutaneous leishmaniasis a neglected tropical disease: community knowledge, attitude and practices in an endemic area, Northwest Ethiopia. BMC Infect Dis. 2019 Oct 16;19(1):855. [CrossRef] [PubMed] [PubMed Central]
- Tolentino N, Pinheiro GRG, Ottino J, de Oliveira AR, Coelho CM, Tinoco HP, Fujiwara RT, Santos RL, Ribeiro VM. Serological evidence of Leishmania infection by employing ELISA and rapid tests in captive felids and canids in Brazil. Vet Parasitol Reg Stud Reports. 2019 Aug;17:100308. [CrossRef] [PubMed]
- CDC: Clinical Care of Leishmaniasis. CDC. March 13, 2024. https://www.cdc.gov/leishmaniasis/hcp/clinical-care/index.html#:~:text=For%20pentavalent%20antimonial%20(SbV,of%20therapy%20may%20be%20indicated.
- Masmoudi A, Hariz W, Marrekchi S, Amouri M, Turki H. Old World cutaneous leishmaniasis: diagnosis and treatment. J Dermatol Case Rep. 2013 Jun 30;7(2):31-41. [CrossRef] [PubMed] [PubMed Central]
- van Griensven J, Diro E. Visceral Leishmaniasis: Recent Advances in Diagnostics and Treatment Regimens. Infect Dis Clin North Am. 2019 Mar;33(1):79-99. [CrossRef] [PubMed]
- Scarpini S, Dondi A, Totaro C, Biagi C, Melchionda F, Zama D, Pierantoni L, Gennari M, Campagna C, Prete A, Lanari M. Visceral Leishmaniasis: Epidemiology, Diagnosis, and Treatment Regimens in Different Geographical Areas with a Focus on Pediatrics. Microorganisms. 2022 Sep 21;10(10):1887. [CrossRef] [PubMed] [PubMed Central]
- Zijlstra EE. The immunology of post-kala-azar dermal leishmaniasis (PKDL). Parasit Vectors. 2016 Aug 23;9(1):464. [CrossRef] [PubMed] [PubMed Central]
- Cabrera RE, Verduguez-Orellana A, Tordoya-Titichoca IJ, Sejas C, Ledezma R, Álvarez I, Limachi-Choque J, Ortuño-Gutiérrez N, Córdova Rojas M, Guzman-Rivero M. Intralesional Meglumine Antimoniate: Safe, Feasible and Effective Therapy for Cutaneous Leishmaniasis in Bolivia. Trop Med Infect Dis. 2022 Oct 7;7(10):286. [CrossRef] [PubMed] [PubMed Central]
- McGwire BS, Satoskar AR. Leishmaniasis: clinical syndromes and treatment. QJM. 2014 Jan;107(1):7-14. [CrossRef] [PubMed] [PubMed Central]
- World Health Organization: The Global Health Observatory – Leishmaniasis (Neglected Tropical Diseases). Sept 2024. https://www.who.int/data/gho/data/themes/topics/gho-ntd-leishmaniasis.
- Pinart M, Rueda JR, Romero GA, Pinzón-Flórez CE, Osorio-Arango K, Silveira Maia-Elkhoury AN, Reveiz L, Elias VM, Tweed JA. Interventions for American cutaneous and mucocutaneous leishmaniasis. Cochrane Database Syst Rev. 2020 Aug 27;8(8):CD004834. [CrossRef] [PubMed] [PubMed Central]
- Lainson R, Shaw JJ, Silveira FT, de Souza AA, Braga RR, Ishikawa EA. The dermal leishmaniases of Brazil, with special reference to the eco-epidemiology of the disease in Amazonia. Mem Inst Oswaldo Cruz. 1994 Jul-Sep;89(3):435-43. [CrossRef] [PubMed]
- Soto J, Soto P, Ajata A, Rivero D, Luque C, Tintaya C, Berman J. Miltefosine Combined with Intralesional Pentamidine for Leishmania braziliensis Cutaneous Leishmaniasis in Bolivia. Am J Trop Med Hyg. 2018 Nov;99(5):1153-1155. [CrossRef] [PubMed] [PubMed Central]
- Barbosa DS, Geiger S, Fujiwana R. Personal Communication. (Department of Parasitology, Institute of Biological Sciences, Federal University of Minas Gerais (UFMG), Belo Horizonte, Brazil.) 2024 Personal Communications.
- Okwor I, Uzonna J. Social and Economic Burden of Human Leishmaniasis. Am J Trop Med Hyg. 2016 Mar;94(3):489-93. [CrossRef] [PubMed] [PubMed Central]
- Shmueli M, Ben-Shimol S. Review of Leishmaniasis Treatment: Can We See the Forest through the Trees? Pharmacy (Basel). 2024 Feb 8;12(1):30. [CrossRef] [PubMed] [PubMed Central]
- Soeiro MNC, Sales-Junior PA, Pereira VRA, Vannier-Santos MA, Murta SMF, Sousa AS, Sangenis LHC, Moreno AMH, Boechat N, Branco FSC, Holetz FB, Ávila AR, Pereira MCS. Drug screening and development cascade for Chagas disease: an update of in vitro and in vivo experimental models. Mem Inst Oswaldo Cruz. 2024 Jul 1;119:e240057. [CrossRef] [PubMed] [PubMed Central]
- Adams ER, Jacquet D, Schoone G, Gidwani K, Boelaert M, Cunningham J. Leishmaniasis direct agglutination test: using pictorials as training materials to reduce inter-reader variability and improve accuracy. PLoS Negl Trop Dis. 2012;6(12):e1946. [CrossRef] [PubMed] [PubMed Central]
- Bi K, Li X, Zhang R, Zheng X, Wang F, Zou Y, Wang L. Clinical and laboratory characterization of cutaneous leishmaniasis in Chinese migrant workers returned from Iraq. PLoS Negl Trop Dis. 2024 Mar 4;18(3):e0012006. [CrossRef] [PubMed] [PubMed Central]
- Akhoundi M, Downing T, Votýpka J, Kuhls K, Lukeš J, Cannet A, Ravel C, Marty P, Delaunay P, Kasbari M, Granouillac B, Gradoni L, Sereno D. Leishmania infections: Molecular targets and diagnosis Mol Aspects Med. 2017 Oct;57:1-29. [CrossRef] [PubMed]
- Sarnoff R, Desai J, Desjeux P, Mittal A, Topno R, Siddiqui NA, Pandey A, Sur D, Das P. The economic impact of visceral leishmaniasis on rural households in one endemic district of Bihar, India. Trop Med Int Health. 2010 Jul;15 Suppl 2:42-9. [CrossRef] [PubMed]
- Khoury F, Campos JE. A Difficult-To-Diagnose Case of American Tegumentary Leishmaniasis. Cureus. 2023 Sep 10;15(9):e44971. [CrossRef] [PubMed] [PubMed Central]
- Grogl M, Joya CA, Saenz M, Quispe A, Rosales LA, Santos RDP, De Los Santos MB, Donovan N, Ransom JH, Ramos A, Llanos Cuentas E. Evaluation of a diagnostic device, CL Detect rapid test for the diagnosis of new world cutaneous leishmaniasis in Peru. PLoS Negl Trop Dis. 2023 Mar 13;17(3):e0011054. [CrossRef] [PubMed] [PubMed Central]
- Weigle KA, Labrada LA, Lozano C, Santrich C, Barker DC. PCR-based diagnosis of acute and chronic cutaneous leishmaniasis caused by Leishmania (Viannia). J Clin Microbiol. 2002 Feb;40(2):601-6. [CrossRef] [PubMed] [PubMed Central]
- Gebremeskele BT, Adane G, Adem M, Tajebe F. Diagnostic performance of CL Detect rapid-immunochromatographic test for cutaneous leishmaniasis: a systematic review and meta-analysis. Syst Rev. 2023 Dec 20;12(1):240. [CrossRef] [PubMed] [PubMed Central]
- Lamm R, Alves C, Perrotta G, Murphy M, Messina C, Sanchez JF, Perez E, Rosales LA, Lescano AG, Smith E, Valdivia H, Fuhrer J, Ballard SB. Prevalence of and Factors Associated with Negative Microscopic Diagnosis of Cutaneous Leishmaniasis in Rural Peru. Am J Trop Med Hyg. 2018 Aug;99(2):331-337. [CrossRef] [PubMed] [PubMed Central]
- Kaufer A, Ellis J, Stark D. Identification of Clinical Infections of Leishmania Imported into Australia: Revising Speciation with Polymerase Chain Reaction-RFLP of the Kinetoplast Maxicircle. Am J Trop Med Hyg. 2019 Sep;101(3):590-601. [CrossRef] [PubMed] [PubMed Central]
- Foulet F, Botterel F, Buffet P, Morizot G, Rivollet D, Deniau M, Pratlong F, Costa JM, Bretagne S. Detection and identification of Leishmania species from clinical specimens by using a real-time PCR assay and sequencing of the cytochrome B gene. J Clin Microbiol. 2007 Jul;45(7):2110-5. [CrossRef] [PubMed] [PubMed Central]
- eBioMedicine. Leishmania: an urgent need for new treatments. EBioMedicine. 2023 Jan;87:104440. [CrossRef] [PubMed] [PubMed Central]
- Aronson N, Herwaldt BL, Libman M, Pearson R, Lopez-Velez R, Weina P, Carvalho E, Ephros M, Jeronimo S, Magill A. Diagnosis and Treatment of Leishmaniasis: Clinical Practice Guidelines by the Infectious Diseases Society of America (IDSA) and the American Society of Tropical Medicine and Hygiene (ASTMH). Am J Trop Med Hyg. 2017 Jan 11;96(1):24-45. [CrossRef] [PubMed] [PubMed Central]
- Bao M, Zhang S, Ten Pas C, Dollery SJ, Bushnell RV, Yuqing FNU, Liu R, Lu G, Tobin GJ, Du K. Computer vision enabled funnel adapted sensing tube (FAST) for power-free and pipette-free nucleic acid detection. Lab Chip. 2022 Dec 6;22(24):4849-4859. [CrossRef] [PubMed]
- Bao M, Dollery SJ, Yuqing F, Tobin GJ, Du K. Micropillar enhanced FRET-CRISPR biosensor for nucleic acid detection. Lab Chip. 2023 Dec 20;24(1):47-55. [CrossRef] [PubMed] [PubMed Central]
- Bao M, Waitkus J, Liu L, Chang Y, Xu Z, Qin P, Chen J, Du K. Micro- and nanosystems for the detection of hemorrhagic fever viruses. Lab Chip. 2023 Sep 26;23(19):4173-4200. [CrossRef] [PubMed]
- Dollery SJ, Du K, Bao M, Zhang S, Liu R, Wiggins TJ, Tobin GJ. Multichambered device for detecting pathogens/molecules and methods of using same. Provisional patent application filed March 11, 2024.
- Dollery SJ, Du K, Bao M, Zhang S, Liu R, Wiggins TJ, Tobin GJ. Multichambered device for detecting pathogens/molecules and methods of using same. PCT patent application No. 63/406,156 filed September 13, 2023.
- Liu, Li, Zhiheng Xu, Kamel Awayda, Stephen J. Dollery, Mengdi Bao, Jianlin Fan, Denis Cormier, Mitchell R. O'Connell, Gregory J. Tobin, and Ke Du. "Gold Nanoparticle-Labeled CRISPR-Cas13a Assay for the Sensitive Solid-State Nanopore Molecular Counting." Advanced Materials Technologies 7, no. 3 (2022): 2101550.
- Liu L, Duan JJ, Wei XY, Hu H, Wang YB, Jia PP, Pei DS. Generation and application of a novel high-throughput detection based on RPA-CRISPR technique to sensitively monitor pathogenic microorganisms in the environment. Sci Total Environ. 2022 Sep 10;838(Pt 2):156048. [CrossRef] [PubMed]
- Waitkus, J, Yu Chang, Li Liu, Srinivasu Valagerahally Puttaswamy, Taerin Chung, Adrian M Molina Vargas, Stephen J Dollery, Mitchell R O'Connell, Haogang Cai, Gregory J Tobin, Nikhil Bhalla, Ke Du. Gold nanoparticle enabled localized surface plasmon resonance on unique gold nanomushroom structures for on-chip CRISPR-Cas13a sensing. Advanced Materials Interfaces (2022) (in press).
- Vargas-Parada, L. (2010) Kinetoplastids and Their Networks of Interlocked DNA. Nature Education 3(9):63.
- Lukes J, Guilbride DL, Votýpka J, Zíková A, Benne R, Englund PT. Kinetoplast DNA network: evolution of an improbable structure. Eukaryot Cell. 2002 Aug;1(4):495-502. [CrossRef] [PubMed] [PubMed Central]
- Carpenter LR, Englund PT. Kinetoplast maxicircle DNA replication in Crithidia fasciculata and Trypanosoma brucei. Mol Cell Biol. 1995 Dec;15(12):6794-803. [CrossRef] [PubMed] [PubMed Central]
- Trager, W. The development of Leishmania donovani in vitro at 37 degree C; effects of the kind of serum. J Exp Med. 1953 Feb 1;97(2):177-88. [CrossRef] [PubMed] [PubMed Central]
- Ando T, Bhamidimarri SP, Brending N, Colin-York H, Collinson L, De Jonge N, de Pablo PJ, Debroye E, Eggeling C, Franck C, Fritzsche M, Gerritsen H, Giepmans BNG, Grunewald K, Hofkens J, Hoogenboom JP, Janssen KPF, Kaufman R, Klumpermann J, Kurniawan N, Kusch J, Liv N, Parekh V, Peckys DB, Rehfeldt F, Reutens DC, Roeffaers MBJ, Salditt T, Schaap IAT, Schwarz US, Verkade P, Vogel MW, Wagner R, Winterhalter M, Yuan H, Zifarelli G. The 2018 correlative microscopy techniques roadmap. J Phys D Appl Phys. 2018 Nov 7;51(44):443001. [CrossRef] [PubMed] [PubMed Central]
- Cavalcanti DP, de Souza W. The Kinetoplast of Trypanosomatids: From Early Studies of Electron Microscopy to Recent Advances in Atomic Force Microscopy. Scanning. 2018 Jun 19;2018:9603051. [CrossRef] [PubMed] [PubMed Central]
- Gonçalves CS, Ávila AR, de Souza W, Motta MCM, Cavalcanti DP. Revisiting the Trypanosoma cruzi metacyclogenesis: morphological and ultrastructural analyses during cell differentiation. Parasit Vectors. 2018 Feb 6;11(1):83. [CrossRef] [PubMed] [PubMed Central]
- Ceccarelli M, Galluzzi L, Migliazzo A, Magnani M. Detection and characterization of Leishmania (Leishmania) and Leishmania (Viannia) by SYBR green-based real-time PCR and high resolution melt analysis targeting kinetoplast minicircle DNA. PLoS One. 2014 Feb 13;9(2):e88845. [CrossRef] [PubMed] [PubMed Central]
- Camacho E, Rastrojo A, Sanchiz Á, González-de la Fuente S, Aguado B, Requena JM. Leishmania Mitochondrial Genomes: Maxicircle Structure and Heterogeneity of Minicircles. Genes (Basel). 2019 Sep 26;10(10):758. [CrossRef] [PubMed] [PubMed Central]
- Mousavi T, Shokohi S, Abdi J, Naserifar R, Ahmadi M, Mirzaei A. Determination of genetic diversity of Leishmania species using mini-circle kDNA, in Iran-Iraq countries border. Trop Parasitol. 2018 Jµl-Dec;8(2):77-82. [CrossRef] [PubMed] [PubMed Central]
- Torres-Guerrero E, Quintanilla-Cedillo MR, Ruiz-Esmenjaud J, Arenas R. Leishmaniasis: a review. F1000Res. 2017 May 26;6:750. [CrossRef] [PubMed] [PubMed Central]
- Reveiz L, Maia-Elkhoury AN, Nicholls RS, Romero GA, Yadon ZE. Interventions for American cutaneous and mucocutaneous leishmaniasis: a systematic review update. PLoS One. 2013 Apr 29;8(4):e61843. [CrossRef] [PubMed] [PubMed Central]















| Primer Name | Nucleotide Sequence | Length | Nt. Location in PSC1 kinetoplast ACC#BK010875 |
| F1 | GGCAAGTCCTACTCTCCTTTACAAAG | 26 | 1808..1838 |
| F2 | GGCAAGTCCTACTCTCCTTTACAAAGAGAAC | 31 | 1808..1833 |
| F3 | TTGTATGTTTGATTGGGGCAATACT | 25 | 1851..1875 |
| F4 | AGGTTCGAGCAGGTTAACAAGC | 22 | 1922..1943 |
| F5 | ATGTGTTTCATCGTCTACTTATTGC | 25 | 1955..1979 |
| F6 | TTCGTTAGTTGGGTTAAAATCGTTG | 25 | 2012..2036 |
| F7 | GATGCCAGCCGTTGCGGTAATTTCTATGC | 29 | 2417..2445 |
| F8 | GATGCCAGCCGTTGCGGTAATTTC | 24 | 2417..2440 |
| R1 | ATTAATGCTTGTTAACCTGCTCGAAC | 26 | rev:1924..1949 |
| R2 | TAGCAATAAGTAGACGATGAAACAC | 25 | rev:1957..1981 |
| R3 | TGCTTTACAACGATTTTAACCCAAC | 25 | rev:2019..2043 |
| R4 | TGCTTTACAACGATTTTAACCCAACTAACG | 30 | rev:2014..2043 |
| R5 | TAAAAGCATAGAAATTACCGCAACG | 25 | rev:2426..2450 |
| R6 | GTTGTCTTTATTACAAAGAATGGTGGGCAAC | 31 | rev:2738..2768 |
| R7 | GTTGTCTTTATTACAAAGAATGGTG | 25 | rev:2744..2768 |
| Guide Name | Nucleotide Target Sequence | Length | Location on Maxicircle |
| All-1 (L+T1) | TTTACAACGATTTTAACCCAACTAA | 25 (21+PAM) | rev:2016..2040 |
| All-2 (L+T2) | TTTAGGAATAGTTAATAATAATTTA | 25 (21+PAM) | 2284..2308 |
| All-3 (LnotT1) | TTTGACAACATGATAAGGATTATAA | 25 (21+PAM) | 2629..2653 |
| All-4 (LnotT2) | TTTATAAAATAAATGTATAATATTT | 25 (21+PAM) | rev:2450..2474 |
| MC-1 (P+G1) | TTTAAAAATATAAAAGTCAATTGTT | 25 (21+PAM) | 2138..2161 |
| MC-2 (P+G2) | TTTATATTATTTTATATTATTTTAT | 25 (21+PAM) | 2178..2201 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).